Molecular Methods for Pathogenic Bacteria Detection and Recent Advances in Wastewater Analysis
Abstract
1. Introduction
2. Pathogenic Bacteria in Wastewater
2.1. Enteric Pathogenic Bacteria
2.1.1. E. coli O157:H7
2.1.2. Campylobacter spp.
2.1.3. Salmonella spp.
2.1.4. Shigella spp.
2.1.5. Clostridioides difficile
2.2. Non-Enteric Pathogenic Bacteria
2.2.1. Legionella spp.
2.2.2. Mycobacterium spp.
3. Molecular Methods for Pathogenic Bacteria Detection
3.1. Biomarkers of Pathogenic Bacteria
3.2. Molecular Methods
3.2.1. Nucleic Acid Targeting Methods
PCR-Based Method
DNA Microarrays
Loop-Mediated Isothermal Amplification (LAMP)
Fluorescent in Situ Hybridization (FISH)
Sequencing
3.2.2. Immunology-Based Methods
3.2.3. Biosensor-Based Methods
3.2.4. Paper-Based Device
4. Recent Advances of Molecular Methods for Pathogenic Bacteria in Wastewater
4.1. Sample Processing and DNA/RNA Extraction Methods
4.2. Detection and Quantification of Pathogenic Bacteria
4.3. Profiling Potential Pathogens
4.4. Antimicrobial Resistance Analysis
4.5. Prospect of Molecular Methods for Pathogenic Bacteria in Wastewater Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
References
- Hoffmann, V.; Moser, C.; Saak, A. Food safety in low and middle-income countries: The evidence through an economic lens. World Dev. 2019, 123, 104611. [Google Scholar] [CrossRef]
- O’Brien, S.J. Foodborne Diseases: Prevalence of Foodborne Diseases in Europe. Encycl. Food Saf. 2014, 13, 302–311. [Google Scholar] [CrossRef]
- Benedict, K.M.; Reses, H.; Vigar, M.; Roth, D.M.; Roberts, V.A.; Mattioli, M.; Cooley, L.A.; Hilborn, E.D.; Wade, T.J.; Fullerton, K.E.; et al. Surveillance for Waterborne Disease Outbreaks Associated with Drinking Water—United States, 2013–2014. MMWR Morb. Mortal. Wkly. Rep. 2017, 66, 1216–1221. [Google Scholar] [CrossRef]
- Tiwari, A.; Oliver, D.M.; Bivins, A.; Sherchan, S.P.; Pitkänen, T. Bathing Water Quality Monitoring Practices in Europe and the United States. Int. J. Environ. Res. Public Health 2021, 18, 5513. [Google Scholar] [CrossRef] [PubMed]
- Sohier, D.; Pavan, S.; Riou, A.; Combrisson, J.; Postollec, F. Evolution of microbiological analytical methods for dairy industry needs. Front. Microbiol. 2014, 5, 16. [Google Scholar] [CrossRef]
- Deshmukh, R.A.; Joshi, K.; Bhand, S.; Roy, U. Recent developments in detection and enumeration of waterborne bacteria: A retrospective minireview. Microbiologyopen 2016, 5, 901–922. [Google Scholar] [CrossRef]
- Gilbride, K. Molecular methods for the detection of waterborne pathogens. In Waterborne Pathogens; Elsevier: Amsterdam, The Netherlands, 2014; pp. 231–290. [Google Scholar]
- Kudłak, B.; Wieczerzak, M. Aptamer based tools for environmental and therapeutic monitoring: A review of developments, applications, future perspectives. Crit. Rev. Environ. Sci. Technol. 2020, 50, 816–867. [Google Scholar] [CrossRef]
- Pang, B.; Zhao, C.; Li, L.; Song, X.; Xu, K.; Wang, J.; Liu, Y.; Fu, K.; Bao, H.; Song, D.; et al. Development of a low-cost paper-based ELISA method for rapid Escherichia coli O157:H7 detection. Anal. Biochem. 2018, 542, 58–62. [Google Scholar] [CrossRef] [PubMed]
- Jayan, H.; Pu, H.; Sun, D.-W. Recent development in rapid detection techniques for microorganism activities in food matrices using bio-recognition: A review. Trends Food Sci. Technol. 2020, 95, 233–246. [Google Scholar] [CrossRef]
- Sims, N.; Kasprzyk-Hordern, B. Future Perspectives of Wastewater-Based Epidemiology: Monitoring Infectious Disease Spread and Resistance to the Community Level. Environ. Int. 2020, 139, 105689. [Google Scholar] [CrossRef] [PubMed]
- Feng, L.; Zhang, W.; Li, X. Monitoring of regional drug abuse through wastewater-based epidemiology—A critical review. Sci. China Earth Sci. 2018, 61, 239–255. [Google Scholar] [CrossRef]
- Hui, Q.; Pan, Y.; Yang, Z. Paper-based devices for rapid diagnostics and testing sewage for early warning of COVID-19 outbreak. Case Stud. Chem. Environ. Eng. 2020, 2, 100064. [Google Scholar] [CrossRef]
- Choi, P.M.; Tscharke, B.J.; Donner, E.; O’Brien, J.W.; Grant, S.C.; Kaserzon, S.L.; Mackie, R.; O’Malley, E.; Crosbie, N.D.; Thomas, K.V. Wastewater-based epidemiology biomarkers: Past, present and future. TrAC Trends Anal. Chem. 2018, 105, 453–469. [Google Scholar] [CrossRef]
- Ahmed, W.; Bibby, K.; D’Aoust, P.M.; Delatolla, R.; Gerba, C.P.; Haas, C.N.; Hamilton, K.A.; Hewitt, J.; Julian, T.R.; Kaya, D.; et al. Differentiating between the possibility and probability of SARS-CoV-2 transmission associated with wastewater: Empirical evidence is needed to substantiate risk. FEMS Microbes 2021, 2, xtab007. [Google Scholar] [CrossRef]
- Tiwari, A.; Lipponen, A.; Hokajärvi, A.-M.; Luomala, O.; Sarekoski, A.; Rytkönen, A.; Österlund, P.; Al-Hello, H.; Juutinen, A.; Miettinen, I.T.; et al. Detection and quantification of SARS-CoV-2 RNA in wastewater influent in relation to reported COVID-19 incidence in Finland. medRxiv 2021, 770, 145274. [Google Scholar] [CrossRef]
- Ramirez-Castillo, F.Y.; Loera-Muro, A.; Jacques, M.; Garneau, P.; Avelar-Gonzalez, F.J.; Harel, J.; Guerrero-Barrera, A.L. Waterborne pathogens: Detection methods and challenges. Pathogens 2015, 4, 307–334. [Google Scholar] [CrossRef] [PubMed]
- Fijalkowski, K.L.; Kacprzak, M.J.; Rorat, A. Occurrence changes of Escherichia coli (including O157:H7 serotype) in wastewater and sewage sludge by quantitation method of (EMA) real time—PCR. Desalination Water Treat. 2014, 52, 3965–3972. [Google Scholar] [CrossRef]
- Banting, G.S.; Braithwaite, S.; Scott, C.; Kim, J.; Jeon, B.; Ashbolt, N.; Ruecker, N.; Tymensen, L.; Charest, J.; Pintar, K. Evaluation of various Campylobacter-specific quantitative PCR (qPCR) assays for detection and enumeration of Campylobacteraceae in irrigation water and wastewater via a miniaturized most-probable-number–qPCR assay. Appl. Environ. Microbiol. 2016, 82, 4743–4756. [Google Scholar] [CrossRef] [PubMed]
- Teklehaimanot, G.Z.; Genthe, B.; Kamika, I.; Momba, M.N.B. Prevalence of enteropathogenic bacteria in treated effluents and receiving water bodies and their potential health risks. Sci. Total Environ. 2015, 518–519, 441–449. [Google Scholar] [CrossRef] [PubMed]
- Teklehaimanot, G.Z.; Coetzee, M.A.A.; Momba, M.N.B. Faecal pollution loads in the wastewater effluents and receiving water bodies: A potential threat to the health of Sedibeng and Soshanguve communities, South Africa. Environ. Sci. Pollut. Res. 2014, 21, 9589–9603. [Google Scholar] [CrossRef]
- Koivunen, J.; Siitonen, A.; Heinonen-Tanski, H. Elimination of enteric bacteria in biological–chemical wastewater treatment and tertiary filtration units. Water Res. 2003, 37, 690–698. [Google Scholar] [CrossRef]
- Sandhu, B.K.; McBride, S.M. Clostridioides difficile. Trends Microbiol. 2018, 26, 1049–1050. [Google Scholar] [CrossRef]
- Xu, C.; Salsali, H.; Weese, S.; Warriner, K. Inactivation of Clostridium difficile in sewage sludge by anaerobic thermophilic digestion. Can. J. Microbiol. 2015, 62, 16–23. [Google Scholar] [CrossRef] [PubMed]
- Caicedo, C.; Rosenwinkel, K.H.; Exner, M.; Verstraete, W.; Suchenwirth, R.; Hartemann, P.; Nogueira, R. Legionella occurrence in municipal and industrial wastewater treatment plants and risks of reclaimed wastewater reuse: Review. Water Res. 2019, 149, 21–34. [Google Scholar] [CrossRef] [PubMed]
- Vermeulen, L.C.; Brandsema, P.S.; van de Kassteele, J.; Bom, B.C.J.; Sterk, H.A.M.; Sauter, F.J.; van den Berg, H.H.J.L.; de Roda Husman, A.M. Atmospheric dispersion and transmission of Legionella from wastewater treatment plants: A 6-year case-control study. Int. J. Hyg. Environ. Health 2021, 237, 113811. [Google Scholar] [CrossRef] [PubMed]
- Radomski, N.; Betelli, L.; Moilleron, R.; Haenn, S.; Moulin, L.; Cambau, E.; Rocher, V.; Gonçalves, A.; Lucas, F.S. Mycobacterium Behavior in Wastewater Treatment Plant, A Bacterial Model Distinct From Escherichia coli and Enterococci. Environ. Sci. Technol. 2011, 45, 5380–5386. [Google Scholar] [CrossRef]
- Manning, S.D.; Babcock, H. Escherichia Coli Infections; Chelsea House Publishers: New York, NY, USA, 2010. [Google Scholar]
- Levin, R.E. Rapid Detection and Characterization of Foodborne Pathogens by Molecular Techniques; CRC Press: Boca Raton, FL, USA, 2009. [Google Scholar]
- Singleton, P.; Sainsbury, D. Dictionary of Microbiology and Molecular Biology; John Wiley & Sons: Hoboken, NJ, USA, 2006. [Google Scholar]
- Leblanc-Maridor, M.; Beaudeau, F.; Seegers, H.; Denis, M.; Belloc, C. Rapid identification and quantification of Campylobacter coli and Campylobacter jejuni by real-time PCR in pure cultures and in complex samples. BMC Microbiol. 2011, 11, 113. [Google Scholar] [CrossRef]
- Rinsoz, T.; Hilfiker, S.; Oppliger, A. Quantification of Thermotolerant Campylobacter in Swiss Water Treatment Plants, by Real-Time Quantitative Polymerase Chain Reaction. Water Environ. Res. 2009, 81, 929–933. [Google Scholar] [CrossRef]
- Moreno, Y.; Botella, S.; Alonso, J.L.; Ferrús, M.A.; Hernández, M.; Hernández, J. Specific detection of Arcobacter and Campylobacter strains in water and sewage by PCR and fluorescent in situ hybridization. Appl. Environ. Microbiol. 2003, 69, 1181–1186. [Google Scholar] [CrossRef]
- Igwaran, A.; Okoh, A.I. Human campylobacteriosis: A public health concern of global importance. Heliyon 2019, 5, e02814. [Google Scholar] [CrossRef]
- Hansson, I.; Sandberg, M.; Habib, I.; Lowman, R.; Engvall, E.O. Knowledge gaps in control of Campylobacter for prevention of campylobacteriosis. Transbound. Emerg. Dis. 2018, 65, 30–48. [Google Scholar] [CrossRef]
- Bolton, D.J. Campylobacter virulence and survival factors. Food Microbiol. 2015, 48, 99–108. [Google Scholar] [CrossRef]
- Eucker, T.P.; Konkel, M.E. The cooperative action of bacterial fibronectin-binding proteins and secreted proteins promote maximal Campylobacter jejuni invasion of host cells by stimulating membrane ruffling. Cell. Microbiol. 2012, 14, 226–238. [Google Scholar] [CrossRef] [PubMed]
- Carvalho Alexandro, C.T.; Ruiz-Palacios Guillermo, M.; Ramos-Cervantes, P.; Cervantes, L.-E.; Jiang, X.; Pickering Larry, K. Molecular Characterization of Invasive and Noninvasive Campylobacter jejuni and Campylobacter coli Isolates. J. Clin. Microbiol. 2001, 39, 1353–1359. [Google Scholar] [CrossRef] [PubMed]
- Mendez-Arancibia, E.; Vargas, M.; Soto, S.; Ruiz, J.; Kahigwa, E.; Schellenberg, D.; Urassa, H.; Gascón, J.; Vila, J. Prevalence of different virulence factors and biofilm production in enteroaggregative Escherichia coli isolates causing diarrhea in children in Ifakara (Tanzania). Am. J. Trop Med. Hyg. 2008, 78, 985–989. [Google Scholar] [CrossRef] [PubMed]
- De Boer, R.F.; Ott, A.; Güren, P.; van Zanten, E.; van Belkum, A.; Kooistra-Smid, A.M. Detection of Campylobacter species and Arcobacter butzleri in stool samples by use of real-time multiplex PCR. J. Clin. Microbiol. 2013, 51, 253–259. [Google Scholar] [CrossRef] [PubMed]
- Henry, R.; Schang, C.; Chandrasena, G.I.; Deletic, A.; Edmunds, M.; Jovanovic, D.; Kolotelo, P.; Schmidt, J.; Williamson, R.; McCarthy, D. Environmental monitoring of waterborne Campylobacter: Evaluation of the Australian standard and a hybrid extraction-free MPN-PCR method. Front. Microbiol. 2015, 6, 74. [Google Scholar] [CrossRef] [PubMed]
- Dar, M.A.; Ahmad, S.M.; Bhat, S.A.; Ahmed, R.; Urwat, U.; Mumtaz, P.T.; Bhat, S.A.; Dar, T.A.; Shah, R.A.; Ganai, N.A. Salmonella typhimurium in poultry: A review. Worlds Poult. Sci. J. 2017, 73, 345–354. [Google Scholar] [CrossRef]
- Liu, H.; Whitehouse, C.A.; Li, B. Presence and Persistence of Salmonella in Water: The Impact on Microbial Quality of Water and Food Safety. Front. Public Health 2018, 6, 159. [Google Scholar] [CrossRef]
- House, D.; Bishop, A.; Parry, C.; Dougan, G.; Wain, J. Typhoid fever: Pathogenesis and disease. Curr. Opin. Infect. Dis. 2001, 14, 573–578. [Google Scholar] [CrossRef]
- Cheng, C.-M.; Doran, T.; Lin, W.; Chen, K.-S.; Williams-Hill, D.; Pamboukian, R. Interlaboratory validation for a real-time PCR Salmonella detection method using the ABI 7500 FAST real-time PCR system. J. Food Prot. 2015, 78, 1119–1124. [Google Scholar] [CrossRef] [PubMed]
- González-Escalona, N.; Brown, E.W.; Zhang, G. Development and evaluation of a multiplex real-time PCR (qPCR) assay targeting ttrRSBCA locus and invA gene for accurate detection of Salmonella spp. in fresh produce and eggs. Food Res. Int. 2012, 48, 202–208. [Google Scholar] [CrossRef]
- Postollec, F.; Falentin, H.; Pavan, S.; Combrisson, J.; Sohier, D. Recent advances in quantitative PCR (qPCR) applications in food microbiology. Food Microbiol. 2011, 28, 848–861. [Google Scholar] [CrossRef] [PubMed]
- Chaudhry, R.; Chandel, D.; Verma, N.; Singh, N.; Singh, P.; Dey, A. Rapid diagnosis of typhoid fever by an in-house flagellin PCR. J. Med. Microbiol. 2010, 59, 1391–1393. [Google Scholar] [CrossRef]
- Andrews, J.R.; Ryan, E.T. Diagnostics for invasive Salmonella infections: Current challenges and future directions. Vaccine 2015, 33, C8–C15. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; Suita, K.; Okuno, K.; Takaya, A.; Yamamoto, T.; Isogai, E. Membrane vesicle protein PagC as a novel biomarker for detecting pathogenic Salmonella in the viable but not culturable state. J. Vet. Med. Sci 2018, 80, 133–137. [Google Scholar] [CrossRef]
- The, H.C.; Thanh, D.P.; Holt, K.E.; Thomson, N.R.; Baker, S. The genomic signatures of Shigella evolution, adaptation and geographical spread. Nat. Rev. Microbiol. 2016, 14, 235–250. [Google Scholar] [CrossRef] [PubMed]
- Murugesan, P.; Revathi, K.; Elayaraja, S.; Vijayalakshmi, S.; Balasubramanian, T. Distribution of enteric bacteria in the sediments of Parangipettai and Cuddalore coast of India. J. Environ. Biol. 2012, 33, 705–711. [Google Scholar] [PubMed]
- Binet, R.; Deer, D.M.; Uhlfelder, S.J. Rapid detection of Shigella and enteroinvasive Escherichia coli in produce enrichments by a conventional multiplex PCR assay. Food Microbiol. 2014, 40, 48–54. [Google Scholar] [CrossRef][Green Version]
- Thong, K.L.; Hoe, S.L.; Puthucheary, S.D.; Yasin, R. Detection of virulence genes in Malaysian Shigella species by multiplex PCR assay. BMC Infect. Dis. 2005, 5, 8. [Google Scholar] [CrossRef] [PubMed]
- Vantarakis, A.; Komninou, G.; Venieri, D.; Papapetropoulou, M. Development of a multiplex PCR detection of Salmonella spp. and Shigella spp. in mussels. Lett. Appl. Microbiol. 2000, 31, 105–109. [Google Scholar] [CrossRef] [PubMed]
- Farfán, M.J.; Garay, T.A.; Prado, C.A.; Filliol, I.; Ulloa, M.T.; Toro, C.S. A new multiplex PCR for differential identification of Shigella flexneri and Shigella sonnei and detection of Shigella virulence determinants. Epidemiol. Infect. 2010, 138, 525–533. [Google Scholar] [CrossRef] [PubMed]
- Maheux, A.F.; Bissonnette, L.; Boissinot, M.; Bernier, J.-L.T.; Huppé, V.; Picard, F.J.; Bérubé, È.; Bergeron, M.G. Rapid concentration and molecular enrichment approach for sensitive detection of Escherichia coli and Shigella species in potable water samples. Appl. Environ. Microbiol. 2011, 77, 6199–6207. [Google Scholar] [CrossRef]
- Romano, V.; Pasquale, V.; Lemee, L.; El Meouche, I.; Pestel-Caron, M.; Capuano, F.; Buono, P.; Dumontet, S. Clostridioides difficile in the environment, food, animals and humans in southern Italy: Occurrence and genetic relatedness. Comp. Immunol. Microbiol. Infect. Dis. 2018, 59, 41–46. [Google Scholar] [CrossRef] [PubMed]
- Numberger, D.; Riedel, T.; McEwen, G.; Nübel, U.; Frentrup, M.; Schober, I.; Bunk, B.; Spröer, C.; Overmann, J.; Grossart, H.-P.; et al. Genomic analysis of three Clostridioides difficile isolates from urban water sources. Anaerobe 2019, 56, 22–26. [Google Scholar] [CrossRef]
- Peniche, A.G.; Savidge, T.C.; Dann, S.M. Recent insights into Clostridium difficile pathogenesis. Curr. Opin. Infect. Dis. 2013, 26, 447–453. [Google Scholar] [CrossRef] [PubMed]
- Dubberke, E.R.; Haslam, D.B.; Lanzas, C.; Bobo, L.D.; Burnham, C.A.D.; Gröhn, Y.T.; Tarr, P.I. The ecology and pathobiology of Clostridium difficile infections: An interdisciplinary challenge. Zoonoses Public Health 2011, 58, 4–20. [Google Scholar] [CrossRef] [PubMed]
- Freeman, J.; Bauer, M.P.; Baines, S.D.; Corver, J.; Fawley, W.N.; Goorhuis, B.; Kuijper, E.J.; Wilcox, M.H. The changing epidemiology of Clostridium difficile infections. Clin. Microbiol. Rev. 2010, 23, 529–549. [Google Scholar] [CrossRef] [PubMed]
- Hensgens, M.P.M.; Keessen, E.C.; Squire, M.M.; Riley, T.V.; Koene, M.G.J.; de Boer, E.; Lipman, L.J.A.; Kuijper, E.J. Clostridium difficile infection in the community: A zoonotic disease? Clin. Microbiol. Infect. 2012, 18, 635–645. [Google Scholar] [CrossRef] [PubMed]
- O’Grady, K.; Knight, D.R.; Riley, T.V. Antimicrobial resistance in Clostridioides difficile. Eur. J. Clin. Microbiol. Infect. Dis. 2021, 40, 2459–2478. [Google Scholar] [CrossRef] [PubMed]
- Nikaeen, M.; Aghili Dehnavi, H.; Hssanzadeh, A.; Jalali, M. Occurrence of Clostridium difficile in two types of wastewater treatment plants. J. Formos. Med. Assoc. 2015, 114, 663–665. [Google Scholar] [CrossRef]
- Blasi, F.; Lovito, C.; Albini, E.; Bano, L.; Dalmonte, G.; Drigo, I.; Maresca, C.; Massacci, F.R.; Orsini, S.; Primavilla, S.; et al. Clostridioides difficile in Calves in Central Italy: Prevalence, Molecular Typing, Antimicrobial Susceptibility and Association with Antibiotic Administration. Animals 2021, 11, 515. [Google Scholar] [CrossRef]
- Caicedo, C.; Beutel, S.; Scheper, T.; Rosenwinkel, K.H.; Nogueira, R. Occurrence of Legionella in wastewater treatment plants linked to wastewater characteristics. Environ. Sci. Pollut. Res. 2016, 23, 16873–16881. [Google Scholar] [CrossRef] [PubMed]
- Guo, F.; Zhang, T.; Li, B.; Wang, Z.; Ju, F.; Liang, Y.-T. Mycobacterial species and their contribution to cholesterol degradation in wastewater treatment plants. Sci. Rep. 2019, 9, 836. [Google Scholar] [CrossRef]
- Bierque, E.; Thibeaux, R.; Girault, D.; Soupé-Gilbert, M.-E.; Goarant, C. A systematic review of Leptospira in water and soil environments. PLoS ONE 2020, 15, e0227055. [Google Scholar] [CrossRef] [PubMed]
- Leslie, E.; Hinds, J.; Hai, F.I. Causes, Factors, and Control Measures of Opportunistic Premise Plumbing Pathogens—A Critical Review. Appl. Sci. 2021, 11, 4474. [Google Scholar] [CrossRef]
- Muder, R.R.; Victor, L.Y. Infection due to Legionella species other than L. pneumophila. Clin. Infect. Dis. 2002, 35, 990–998. [Google Scholar] [CrossRef]
- Chauhan, D.; Shames, S.R. Pathogenicity and Virulence of Legionella: Intracellular replication and host response. Virulence 2021, 12, 1122–1144. [Google Scholar] [CrossRef]
- Sabrià, M.; Pedro-Botet, M.L.; Gómez, J.; Roig, J.; Vilaseca, B.; Sopena, N.; Baños, V. Fluoroquinolones vs macrolides in the treatment of Legionnaires disease. Chest 2005, 128, 1401–1405. [Google Scholar] [CrossRef] [PubMed]
- Postma, D.F.; Van Werkhoven, C.H.; Van Elden, L.J.; Thijsen, S.F.; Hoepelman, A.I.; Kluytmans, J.A.; Boersma, W.G.; Compaijen, C.J.; Van Der Wall, E.; Prins, J.M. Antibiotic treatment strategies for community-acquired pneumonia in adults. N. Engl. J. Med. 2015, 372, 1312–1323. [Google Scholar] [CrossRef]
- Garin, N.; Genné, D.; Carballo, S.; Chuard, C.; Eich, G.; Hugli, O.; Lamy, O.; Nendaz, M.; Petignat, P.-A.; Perneger, T. β-Lactam monotherapy vs β-lactam–macrolide combination treatment in moderately severe community-acquired pneumonia: A randomized noninferiority trial. JAMA Intern. Med. 2014, 174, 1894–1901. [Google Scholar] [CrossRef]
- Johnson, M.M.; Odell, J.A. Nontuberculous mycobacterial pulmonary infections. J. Thorac. Dis 2014, 6, 210–220. [Google Scholar] [CrossRef] [PubMed]
- Pontiroli, A.; Khera, T.T.; Oakley, B.B.; Mason, S.; Dowd, S.E.; Travis, E.R.; Erenso, G.; Aseffa, A.; Courtenay, O.; Wellington, E.M.H. Prospecting Environmental Mycobacteria: Combined Molecular Approaches Reveal Unprecedented Diversity. PLoS ONE 2013, 8, e68648. [Google Scholar] [CrossRef]
- Chakaya, J.; Khan, M.; Ntoumi, F.; Aklillu, E.; Fatima, R.; Mwaba, P.; Kapata, N.; Mfinanga, S.; Hasnain, S.E.; Katoto, P.; et al. Global Tuberculosis Report 2020—Reflections on the Global TB burden, treatment and prevention efforts. Int. J. Infect. Dis. 2021, 6, 1201–9712. [Google Scholar] [CrossRef] [PubMed]
- Rizzo, L.; Manaia, C.; Merlin, C.; Schwartz, T.; Dagot, C.; Ploy, M.C.; Michael, I.; Fatta-Kassinos, D. Urban wastewater treatment plants as hotspots for antibiotic resistant bacteria and genes spread into the environment: A review. Sci. Total Environ. 2013, 447, 345–360. [Google Scholar] [CrossRef] [PubMed]
- Hyun, B.; Cha, H.-G.; Lee, N.; Yum, S.; Baek, S.H.; Shin, K. Development of an ATP assay for rapid onboard testing to detect living microorganisms in ballast water. J. Sea Res. 2018, 133, 73–80. [Google Scholar] [CrossRef]
- Zhang, Y.; Liu, W.-T. The application of molecular tools to study the drinking water microbiome—Current understanding and future needs. Crit. Rev. Environ. Sci. Technol. 2019, 49, 1188–1235. [Google Scholar] [CrossRef]
- Liu, Q.; Wu, J.e.; Lim, Z.Y.; Aggarwal, A.; Yang, H.; Wang, S. Evaluation of the metabolic response of Escherichia coli to electrolysed water by 1H NMR spectroscopy. LWT-Food Sci. Technol. 2017, 79, 428–436. [Google Scholar] [CrossRef]
- Slavov, S.; Alusta, P.; Buzatu, D.A.; Wilkes, J.G. Feature selection from mass spectra of bacteria for serotyping Salmonella. J. Anal. Appl. Pyrolysis 2017, 124, 393–402. [Google Scholar] [CrossRef]
- Zhang, Y.; Lai, B.S.; Juhas, M. Recent Advances in Aptamer Discovery and Applications. Molecules 2019, 24, 941. [Google Scholar] [CrossRef] [PubMed]
- Zou, Y.; Duan, N.; Wu, S.; Shen, M.; Wang, Z. Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H7. J. Agric. Food Chem. 2018, 66, 5677–5682. [Google Scholar] [CrossRef] [PubMed]
- Yu, X.; Chen, F.; Wang, R.; Li, Y. Whole-bacterium SELEX of DNA aptamers for rapid detection of E.coli O157:H7 using a QCM sensor. J. Biotechnol. 2018, 266, 39–49. [Google Scholar] [CrossRef] [PubMed]
- Buss, J.E.; Cresse, M.; Doyle, S.; Buchan, B.W.; Craft, D.W.; Young, S. Campylobacter culture fails to correctly detect Campylobacter in 30% of positive patient stool specimens compared to non-cultural methods. Eur. J. Clin. Microbiol. Infect. Dis. 2019, 38, 1087–1093. [Google Scholar] [CrossRef] [PubMed]
- Ormen, O.; Aalberg, K.; Madslien, E.H. Multiplex polymerase chain reaction detection of enteropathogens in sewage in Norway. Acta Vet. Scand. 2019, 61, 11. [Google Scholar] [CrossRef] [PubMed]
- Yanagimoto, K.; Yamagami, T.; Uematsu, K.; Haramoto, E. Characterization of Salmonella Isolates from Wastewater Treatment Plant Influents to Estimate Unreported Cases and Infection Sources of Salmonellosis. Pathogens 2020, 9, 52. [Google Scholar] [CrossRef]
- Kasturi, K.N.; Drgon, T. Real-Time PCR Method for Detection of Salmonella spp. in Environmental Samples. Appl. Environ. Microbiol. 2017, 83, e00644-17. [Google Scholar] [CrossRef]
- Lekunberri, I.; Balcázar, J.L.; Borrego, C.M. Detection and quantification of the plasmid-mediated mcr-1 gene conferring colistin resistance in wastewater. Int. J. Antimicrob. Agents 2017, 50, 734–736. [Google Scholar] [CrossRef] [PubMed]
- Sandberg, K.D.; Ishii, S.; LaPara, T.M. A Microfluidic Quantitative Polymerase Chain Reaction Method for the Simultaneous Analysis of Dozens of Antibiotic Resistance and Heavy Metal Resistance Genes. Environ. Sci. Technol. Lett. 2018, 5, 20–25. [Google Scholar] [CrossRef]
- Pan, H.; Dong, K.; Rao, L.; Zhao, L.; Wu, X.; Wang, Y.; Liao, X. Quantitative detection of viable but nonculturable state Escherichia coli O157:H7 by ddPCR combined with propidium monoazide. Food Control. 2020, 112, 107140. [Google Scholar] [CrossRef]
- Li, Y. Establishment and Application of a Visual DNA Microarray for the Detection of Food-borne Pathogens. Anal. Sci. 2016, 32, 215–218. [Google Scholar] [CrossRef]
- Lee, J.-E.; Mun, H.; Kim, S.-R.; Kim, M.-G.; Chang, J.-Y.; Shim, W.-B. A colorimetric Loop-mediated isothermal amplification (LAMP) assay based on HRP-mimicking molecular beacon for the rapid detection of Vibrio parahaemolyticus. Biosens. Bioelectron. 2020, 151, 111968. [Google Scholar] [CrossRef] [PubMed]
- Salimi, G.; Mousavi, Z.E.; Kiani, H. Efficiency of fluorescence in situ hybridization (FISH) method for the rapid detection of Salmonella in minced lamb meat: Method analysis and optimization. J. Microbiol. Methods 2020, 175, 105989. [Google Scholar] [CrossRef] [PubMed]
- Lyu, J.; Zhang, J.; Ren, X. Detection and identification of bacterial pathogens directly from sputum samples by pyrosequencing. J. Med. Microbiol. 2019, 68, 368–373. [Google Scholar] [CrossRef] [PubMed]
- Winand, R.; Bogaerts, B.; Hoffman, S.; Lefevre, L.; Delvoye, M.; Van Braekel, J.; Fu, Q.; Roosens, N.H.; De Keersmaecker, S.C.; Vanneste, K. Targeting the 16s rRNA gene for bacterial identification in complex mixed samples: Comparative evaluation of second (illumina) and third (oxford nanopore technologies) generation sequencing technologies. Int. J. Mol. Sci. 2020, 21, 298. [Google Scholar] [CrossRef] [PubMed]
- Su, J.Q.; An, X.L.; Li, B.; Chen, Q.L.; Gillings, M.R.; Chen, H.; Zhang, T.; Zhu, Y.G. Metagenomics of urban sewage identifies an extensively shared antibiotic resistome in China. Microbiome 2017, 5, 84. [Google Scholar] [CrossRef]
- Park, S.; Kim, Y.T.; Kim, Y.-K. Optical enzyme-linked immunosorbent assay on a strip for detection of Salmonella typhimurium. BioChip J. 2010, 4, 110–116. [Google Scholar] [CrossRef]
- Yang, X.; Feng, L.; Qin, X. Preparation of the Cf-GQDs-Escherichia coli O157: H7 bioprobe and its application in optical imaging and sensing of Escherichia coli O157: H7. Food Anal. Methods 2018, 11, 2280–2286. [Google Scholar] [CrossRef]
- Sun, Y.; Chang, Y.; Zhang, Q.; Liu, M. An Origami Paper-Based Device Printed with DNAzyme-Containing DNA Superstructures for Escherichia coli Detection. Micromachines 2019, 10, 531. [Google Scholar] [CrossRef] [PubMed]
- Khan, I.U.; Gannon, V.; Kent, R.; Koning, W.; Lapen, D.R.; Miller, J.; Neumann, N.; Phillips, R.; Robertson, W.; Topp, E. Development of a rapid quantitative PCR assay for direct detection and quantification of culturable and non-culturable Escherichia coli from agriculture watersheds. J. Microbiol. Methods 2007, 69, 480–488. [Google Scholar] [CrossRef]
- Maheux, A.F.; Bérubé, È.; Boudreau, D.K.; Villéger, R.; Cantin, P.; Boissinot, M.; Bissonnette, L.; Bergeron, M.G. Abilities of the mCP agar method and CRENAME alpha toxin-specific real-time PCR assay to detect Clostridium perfringens spores in drinking water. Appl. Environ. Microbiol. 2013, 79, 7654–7661. [Google Scholar] [CrossRef]
- Ram, S.; Vajpayee, P.; Shanker, R. Rapid culture-independent quantitative detection of enterotoxigenic Escherichia coli in surface waters by real-time PCR with molecular beacon. Environ. Sci. Technol. 2008, 42, 4577–4582. [Google Scholar] [CrossRef]
- Kralik, P.; Ricchi, M. A Basic Guide to Real Time PCR in Microbial Diagnostics: Definitions, Parameters, and Everything. Front. Microbiol 2017, 8, 108. [Google Scholar] [CrossRef] [PubMed]
- Omar, K.; Barnard, T. Detection of diarrhoeagenic Escherichia coli in clinical and environmental water sources in South Africa using single-step 11-gene m-PCR. World J. Microbiol. Biotechnol. 2014, 30, 2663–2671. [Google Scholar] [CrossRef] [PubMed]
- Racki, N.; Dreo, T.; Gutierrez-Aguirre, I.; Blejec, A.; Ravnikar, M. Reverse transcriptase droplet digital PCR shows high resilience to PCR inhibitors from plant, soil and water samples. Plant. Methods 2014, 10, 42. [Google Scholar] [CrossRef] [PubMed]
- Taylor, S.C.; Carbonneau, J.; Shelton, D.N.; Boivin, G. Optimization of Droplet Digital PCR from RNA and DNA extracts with direct comparison to RT-qPCR: Clinical implications for quantification of Oseltamivir-resistant subpopulations. J. Virol. Methods 2015, 224, 58–66. [Google Scholar] [CrossRef] [PubMed]
- Devonshire, A.S.; Sanders, R.; Whale, A.S.; Nixon, G.J.; Cowen, S.; Ellison, S.L.; Parkes, H.; Pine, P.S.; Salit, M.; McDaniel, J.; et al. An international comparability study on quantification of mRNA gene expression ratios: CCQM-P103.1. Biomol. Detect. Quantif. 2016, 8, 15–28. [Google Scholar] [CrossRef] [PubMed]
- Kokkoris, V.; Vukicevich, E.; Richards, A.; Thomsen, C.; Hart, M.M. Challenges Using Droplet Digital PCR for Environmental Samples. Appl. Microbiol. 2021, 1, 74–88. [Google Scholar] [CrossRef]
- Singh, G.; Sithebe, A.; Enitan, A.M.; Kumari, S.; Bux, F.; Stenstrom, T.A. Comparison of droplet digital PCR and quantitative PCR for the detection of Salmonella and its application for river sediments. J. Water Health 2017, 15, 505–508. [Google Scholar] [CrossRef]
- Yang, J.; Zhang, N.; Lv, J.; Zhu, P.; Pan, X.; Hu, J.; Wu, W.; Li, S.; Li, H. Comparing the performance of conventional PCR, RTQ-PCR, and droplet digital PCR assays in detection of Shigella. Mol. Cell. Probes 2020, 51, 101531. [Google Scholar] [CrossRef] [PubMed]
- Gosiewski, T.; Flis, A.; Sroka, A.; Kędzierska, A.; Pietrzyk, A.; Kędzierska, J.; Drwiła, R.; Bulanda, M. Comparison of nested, multiplex, qPCR.; FISH.; SeptiFast and blood culture methods in detection and identification of bacteria and fungi in blood of patients with sepsis. BMC Microbiol. 2014, 14, 313. [Google Scholar] [CrossRef]
- Ibekwe, A.M.; Watt, P.M.; Grieve, C.M.; Sharma, V.K.; Lyons, S.R. Multiplex fluorogenic real-time PCR for detection and quantification of Escherichia coli O157:H7 in dairy wastewater wetlands. Appl Env. Microbiol 2002, 68, 4853–4862. [Google Scholar] [CrossRef]
- LaGier, M.J.; Joseph, L.A.; Passaretti, T.V.; Musser, K.A.; Cirino, N.M. A real-time multiplexed PCR assay for rapid detection and differentiation of Campylobacter jejuni and Campylobacter coli. Mol. Cell. Probes 2004, 18, 275–282. [Google Scholar] [CrossRef]
- Reischer, G.H.; Kasper, D.C.; Steinborn, R.; Farnleitner, A.H.; Mach, R.L. A quantitative real-time PCR assay for the highly sensitive and specific detection of human faecal influence in spring water from a large alpine catchment area. Lett. Appl. Microbiol. 2007, 44, 351–356. [Google Scholar] [CrossRef]
- Nayak, A.; Rose, J. Detection of Helicobacter pylori in sewage and water using a new quantitative PCR method with SYBR® green. J. Appl. Microbiol. 2007, 103, 1931–1941. [Google Scholar] [CrossRef] [PubMed]
- Wery, N.; Lhoutellier, C.; Ducray, F.; Delgenes, J.-P.; Godon, J.-J. Behaviour of pathogenic and indicator bacteria during urban wastewater treatment and sludge composting, as revealed by quantitative PCR. Water Res. 2008, 42, 53–62. [Google Scholar] [CrossRef] [PubMed]
- Haugland, R.A.; Siefring, S.C.; Wymer, L.J.; Brenner, K.P.; Dufour, A.P. Comparison of Enterococcus measurements in freshwater at two recreational beaches by quantitative polymerase chain reaction and membrane filter culture analysis. Water Res. 2005, 39, 559–568. [Google Scholar] [CrossRef] [PubMed]
- Baeumner, A.J.; Humiston, M.C.; Montagna, R.A.; Durst, R.A. Detection of viable oocysts of Cryptosporidium parvum following nucleic acid sequence based amplification. Anal. Chem. 2001, 73, 1176–1180. [Google Scholar] [CrossRef] [PubMed]
- Pitkänen, T.; Ryu, H.; Elk, M.; Hokajärvi, A.-M.; Siponen, S.; Vepsäläinen, A.; Räsänen, P.; Santo Domingo, J.W. Detection of Fecal Bacteria and Source Tracking Identifiers in Environmental Waters Using rRNA-Based RT-qPCR and rDNA-Based qPCR Assays. Environ. Sci. Technol. 2013, 47, 13611–13620. [Google Scholar] [CrossRef] [PubMed]
- Tiwari, A.; Niemelä, S.I.; Vepsäläinen, A.; Rapala, J.; Kalso, S.; Pitkänen, T. Comparison of Colilert-18 with miniaturised most probable number method for monitoring of Escherichia coli in bathing water. J. Water Health 2015, 14, 121–131. [Google Scholar] [CrossRef] [PubMed]
- Inkinen, J.; Siponen, S.; Jayaprakash, B.; Tiwari, A.; Hokajärvi, A.-M.; Pursiainen, A.; Ikonen, J.; Kauppinen, A.; Miettinen, I.T.; Paananen, J.; et al. Diverse and active archaea communities occur in non-disinfected drinking water systems-Less activity revealed in disinfected and hot water systems. Water Res. X 2021, 12, 100101. [Google Scholar] [CrossRef]
- Fumian, T.M.; Leite, J.P.G.; Castello, A.A.; Gaggero, A.; Caillou, M.S.L.d.; Miagostovich, M.P. Detection of rotavirus A in sewage samples using multiplex qPCR and an evaluation of the ultracentrifugation and adsorption-elution methods for virus concentration. J. Virol. Methods 2010, 170, 42–46. [Google Scholar] [CrossRef]
- Al-Tebrineh, J.; Pearson, L.A.; Yasar, S.A.; Neilan, B.A. A multiplex qPCR targeting hepato- and neurotoxigenic cyanobacteria of global significance. Harmful Algae 2012, 15, 19–25. [Google Scholar] [CrossRef]
- Kamau, E.; Alemayehu, S.; Feghali, K.C.; Saunders, D.; Ockenhouse, C.F. Multiplex qPCR for detection and absolute quantification of malaria. PLoS ONE 2013, 8, e71539. [Google Scholar] [CrossRef]
- Bumgarner, R. Overview of DNA microarrays: Types, applications, and their future. Curr. Protoc. Mol. Biol. 2013, 101, 22-1. [Google Scholar] [CrossRef]
- Inoue, D.; Hinoura, T.; Suzuki, N.; Pang, J.; Malla, R.; Shrestha, S.; Chapagain, S.K.; Matsuzawa, H.; Nakamura, T.; Tanaka, Y. High-throughput DNA microarray detection of pathogenic bacteria in shallow well groundwater in the Kathmandu Valley, Nepal. Curr. Microbiol. 2015, 70, 43–50. [Google Scholar] [CrossRef] [PubMed]
- Lemuth, K.; Rupp, S. Microarrays as Research Tools and Diagnostic Devices. In RNA and DNA Diagnostics; Springer: Cham, Switzerland, 2015; pp. 259–280. [Google Scholar] [CrossRef]
- Cristescu, M.E.; Hebert, P.D.N. Uses and Misuses of Environmental DNA in Biodiversity Science and Conservation. Annu. Rev. Ecol. Evol. Syst. 2018, 49, 209–230. [Google Scholar] [CrossRef]
- Sheet, O.; Grabowski, N.; Klein, G.; Abdulmawjood, A. Development and validation of a loop mediated isothermal amplification (LAMP) assay for the detection of Staphylococcus aureus in bovine mastitis milk samples. Mol. Cell. Probes 2016, 30, 320–325. [Google Scholar] [CrossRef] [PubMed]
- Niu, J.H.; Jian, H.; Guo, Q.X.; Chen, C.L.; Wang, X.Y.; Liu, Q.; Guo, Y.D. Evaluation of loop-mediated isothermal amplification (LAMP) assays based on 5S rDNA-IGS2 regions for detecting Meloidogyne enterolobii. Plant. Pathol. 2012, 61, 809–819. [Google Scholar] [CrossRef]
- Nzelu, C.O.; Cáceres, A.G.; Guerrero-Quincho, S.; Tineo-Villafuerte, E.; Rodriquez-Delfin, L.; Mimori, T.; Uezato, H.; Katakura, K.; Gomez, E.A.; Guevara, A.G. A rapid molecular diagnosis of cutaneous leishmaniasis by colorimetric malachite green-loop-mediated isothermal amplification (LAMP) combined with an FTA card as a direct sampling tool. Acta Trop. 2016, 153, 116–119. [Google Scholar] [CrossRef]
- Amann, R.; Fuchs, B.M. Single-cell identification in microbial communities by improved fluorescence in situ hybridization techniques. Nat. Rev. Microbiol. 2008, 6, 339–348. [Google Scholar] [CrossRef]
- Lukumbuzya, M.; Schmid, M.; Pjevac, P.; Daims, H. A Multicolor Fluorescence in situ Hybridization Approach Using an Extended Set of Fluorophores to Visualize Microorganisms. Front. Microbiol. 2019, 10, 1383. [Google Scholar] [CrossRef]
- Santiago, P.; Jiménez-Belenguer, A.; García-Hernández, J.; Estellés, R.M.; Hernández Pérez, M.; Castillo López, M.A.; Ferrús, M.A.; Moreno, Y. High prevalence of Salmonella spp. in wastewater reused for irrigation assessed by molecular methods. Int. J. Hyg. Environ. Health 2018, 221, 95–101. [Google Scholar] [CrossRef] [PubMed]
- Gwinn, M.; MacCannell, D.; Armstrong, G.L. Next-Generation Sequencing of Infectious Pathogens. JAMA 2019, 321, 893–894. [Google Scholar] [CrossRef]
- Behjati, S.; Tarpey, P.S. What is next generation sequencing? Arch. Dis. Child. Educ. Pract. 2013, 98, 236–238. [Google Scholar] [CrossRef]
- Treangen, T.J.; Salzberg, S.L. Repetitive DNA and next-generation sequencing: Computational challenges and solutions. Nat. Rev. Genet. 2012, 13, 36–46. [Google Scholar] [CrossRef] [PubMed]
- Zhu, X.; Yan, S.; Yuan, F.; Wan, S. The Applications of Nanopore Sequencing Technology in Pathogenic Microorganism Detection. Can. J. Infect. Dis. Med. Microbiol. 2020, 2020, 6675206. [Google Scholar] [CrossRef]
- Greninger, A.L.; Naccache, S.N.; Federman, S.; Yu, G.; Mbala, P.; Bres, V.; Stryke, D.; Bouquet, J.; Somasekar, S.; Linnen, J.M.; et al. Rapid metagenomic identification of viral pathogens in clinical samples by real-time nanopore sequencing analysis. Genome Med. 2015, 7, 99. [Google Scholar] [CrossRef]
- Schmidt, M.H.W.; Vogel, A.; Denton, A.K.; Istace, B.; Wormit, A.; van de Geest, H.; Bolger, M.E.; Alseekh, S.; Maß, J.; Pfaff, C.; et al. De Novo Assembly of a New Solanum pennellii Accession Using Nanopore Sequencing. Plant. Cell 2017, 29, 2336–2348. [Google Scholar] [CrossRef] [PubMed]
- Cao, M.D.; Ganesamoorthy, D.; Elliott, A.G.; Zhang, H.; Cooper, M.A.; Coin, L.J.M. Streaming algorithms for identification of pathogens and antibiotic resistance potential from real-time MinION(TM) sequencing. Gigascience 2016, 5, 32. [Google Scholar] [CrossRef]
- Ammar, R.; Paton, T.A.; Torti, D.; Shlien, A.; Bader, G.D. Long read nanopore sequencing for detection of HLA and CYP2D6 variants and haplotypes. F1000Res 2015, 4, 17. [Google Scholar] [CrossRef]
- De Siqueira, G.M.V.; Pereira-Dos-Santos, F.M.; Silva-Rocha, R.; Guazzaroni, M.-E. Nanopore Sequencing Provides Rapid and Reliable Insight Into Microbial Profiles of Intensive Care Units. Front. Public Health 2021, 9, 710985. [Google Scholar] [CrossRef]
- Wattam, A.R.; Inzana, T.J.; Williams, K.P.; Mane, S.P.; Shukla, M.; Almeida, N.F.; Dickerman, A.W.; Mason, S.; Moriyón, I.; O’Callaghan, D.; et al. Comparative genomics of early-diverging Brucella strains reveals a novel lipopolysaccharide biosynthesis pathway. mBio 2012, 3, e00246-12. [Google Scholar] [CrossRef] [PubMed]
- Widmer, A.F.; Frei, R.; Kuijper, J.; Wilcox, M.H.; Schindler, R.; Spaniol, V.; Goldenberger, D.; Egli, A.; Tschudin-Sutter, S. Multicenter Prevalence Study Comparing Molecular and Toxin Assays for Clostridioides difficile Surveillance, Switzerland. Emerg. Infect. Dis. 2020, 26, 2370. [Google Scholar] [CrossRef] [PubMed]
- Mao, K.; Zhang, H.; Pan, Y.; Yang, Z. Biosensors for wastewater-based epidemiology for monitoring public health. Water Res. 2021, 191, 116787. [Google Scholar] [CrossRef] [PubMed]
- Yildirim, N.; Long, F.; Gu, A.Z. Aptamer based E. coli detection in waste waters by portable optical biosensor system. In Proceedings of the 40th Annual Northeast Bioengineering Conference (NEBEC), Boston, MA, USA, 25–27 April 2014; pp. 1–3. [Google Scholar]
- Doria, G.; Conde, J.; Veigas, B.; Giestas, L.; Almeida, C.; Assunção, M.; Rosa, J.; Baptista, P.V. Noble metal nanoparticles for biosensing applications. Sensors 2012, 12, 1657–1687. [Google Scholar] [CrossRef] [PubMed]
- Jyoti, A.; Tomar, R.S.; Shanker, R. Nanosensors for the detection of pathogenic bacteria. In Nanoscience in Food and Agriculture 1; Springer: Cham, Switzerland, 2016; pp. 129–150. [Google Scholar]
- Ahmed, A.; Rushworth, J.V.; Hirst, N.A.; Millner, P.A. Biosensors for whole-cell bacterial detection. Clin. Microbiol. Rev. 2014, 27, 631–646. [Google Scholar] [CrossRef] [PubMed]
- Choi, J.R.; Yong, K.W.; Tang, R.; Gong, Y.; Wen, T.; Li, F.; Pingguan-Murphy, B.; Bai, D.; Xu, F. Advances and challenges of fully integrated paper-based point-of-care nucleic acid testing. TrAC Trends Anal. Chem. 2017, 93, 37–50. [Google Scholar] [CrossRef]
- Suea-Ngam, A.; Choopara, I.; Li, S.; Schmelcher, M.; Somboonna, N.; Howes, P.D.; deMello, A.J. In Situ Nucleic Acid Amplification and Ultrasensitive Colorimetric Readout in a Paper-Based Analytical Device Using Silver Nanoplates. Adv. Healthc. Mater. 2021, 10, 2001755. [Google Scholar] [CrossRef]
- Mao, K.; Zhang, H.; Yang, Z. Can a Paper-Based Device Trace COVID-19 Sources with Wastewater-Based Epidemiology? Environ. Sci. Technol. 2020, 54, 3733–3735. [Google Scholar] [CrossRef]
- Boehle, K.E.; Gilliand, J.; Wheeldon, C.R.; Holder, A.; Adkins, J.A.; Geiss, B.J.; Ryan, E.P.; Henry, C.S. Utilizing Paper-Based Devices for Antimicrobial-Resistant Bacteria Detection. Angew. Chem. Int. Ed. 2017, 56, 6886–6890. [Google Scholar] [CrossRef]
- Nishat, S.; Jafry, A.T.; Martinez, A.W.; Awan, F.R. Paper-based microfluidics: Simplified fabrication and assay methods. Sens. Actuators B Chem. 2021, 336, 129681. [Google Scholar] [CrossRef]
- Ganaja, K.A.; Chaplan, C.A.; Zhang, J.; Martinez, N.W.; Martinez, A.W. Paper Microzone Plates as Analytical Tools for Studying Enzyme Stability: A Case Study on the Stabilization of Horseradish Peroxidase Using Trehalose and SU-8 Epoxy Novolac Resin. Anal. Chem. 2017, 89, 5333–5341. [Google Scholar] [CrossRef]
- Daughton, C.G. Illicit Drugs in Municipal Sewage. In Pharmaceuticals and Care Products in the Environment; American Chemical Society: Washington, DC, USA, 2001; pp. 348–364. [Google Scholar]
- Aarestrup, F.M.; Woolhouse, M.E.J. Using sewage for surveillance of antimicrobial resistance. Science 2020, 367, 630–632. [Google Scholar] [CrossRef] [PubMed]
- Hellmer, M.; Paxeus, N.; Magnius, L.; Enache, L.; Arnholm, B.; Johansson, A.; Bergstrom, T.; Norder, H. Detection of pathogenic viruses in sewage provided early warnings of hepatitis A virus and norovirus outbreaks. Appl. Env. Microbiol. 2014, 80, 6771–6781. [Google Scholar] [CrossRef] [PubMed]
- Park, S.H.; Hanning, I.; Jarquin, R.; Moore, P.; Donoghue, D.J.; Donoghue, A.M.; Ricke, S.C. Multiplex PCR assay for the detection and quantification of Campylobacter spp., Escherichia coli O157:H7, and Salmonella serotypes in water samples. FEMS Microbiol. Lett. 2011, 316, 7–15. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Marangi, M.; Giangaspero, A.; Lacasella, V.; Lonigro, A.; Gasser, R.B. Multiplex PCR for the detection and quantification of zoonotic taxa of Giardia, Cryptosporidium and Toxoplasma in wastewater and mussels. Mol. Cell. Probes 2015, 29, 122–125. [Google Scholar] [CrossRef] [PubMed]
- An, X.L.; Su, J.Q.; Li, B.; Ouyang, W.Y.; Zhao, Y.; Chen, Q.L.; Cui, L.; Chen, H.; Gillings, M.R.; Zhang, T.; et al. Tracking antibiotic resistome during wastewater treatment using high throughput quantitative PCR. Environ. Int. 2018, 117, 146–153. [Google Scholar] [CrossRef] [PubMed]
- Karkman, A.; Johnson, T.A.; Lyra, C.; Stedtfeld, R.D.; Tamminen, M.; Tiedje, J.M.; Virta, M. High-throughput quantification of antibiotic resistance genes from an urban wastewater treatment plant. FEMS Microbiol. Ecol. 2016, 92, fiw01. [Google Scholar] [CrossRef] [PubMed]
- Urbaniak, C.; Sielaff, A.C.; Frey, K.G.; Allen, J.E.; Singh, N.; Jaing, C.; Wheeler, K.; Venkateswaran, K. Detection of antimicrobial resistance genes associated with the International Space Station environmental surfaces. Sci. Rep. 2018, 8, 814. [Google Scholar] [CrossRef] [PubMed]
- Mumy, K.L.; Findlay, R.H. Convenient determination of DNA extraction efficiency using an external DNA recovery standard and quantitative-competitive PCR. J. Microbiol. Methods 2004, 57, 259–268. [Google Scholar] [CrossRef] [PubMed]
- Gyawali, P.; Ahmed, W.; Jagals, P.; Sidhu, J.P.S.; Toze, S. Comparison of concentration methods for rapid detection of hookworm ova in wastewater matrices using quantitative PCR. Exp. Parasitol. 2015, 159, 160–167. [Google Scholar] [CrossRef]
- Lemarchand, K.; Berthiaume, F.; Maynard, C.; Harel, J.; Payment, P.; Bayardelle, P.; Masson, L.; Brousseau, R. Optimization of microbial DNA extraction and purification from raw wastewater samples for downstream pathogen detection by microarrays. J. Microbiol. Methods 2005, 63, 115–126. [Google Scholar] [CrossRef]
- Li, A.-D.; Metch, J.W.; Wang, Y.; Garner, E.; Zhang, A.N.; Riquelme, M.V.; Vikesland, P.J.; Pruden, A.; Zhang, T. Effects of sample preservation and DNA extraction on enumeration of antibiotic resistance genes in wastewater. FEMS Microbiol. Ecol. 2017, 94, fix189. [Google Scholar] [CrossRef] [PubMed]
- Walden, C.; Carbonero, F.; Zhang, W. Assessing impacts of DNA extraction methods on next generation sequencing of water and wastewater samples. J. Microbiol. Methods 2017, 141, 10–16. [Google Scholar] [CrossRef] [PubMed]
- Bonetta, S.; Pignata, C.; Lorenzi, E.; De Ceglia, M.; Meucci, L.; Bonetta, S.; Gilli, G.; Carraro, E. Detection of pathogenic Campylobacter, E. coli O157:H7 and Salmonella spp. in wastewater by PCR assay. Environ. Sci. Pollut. Res. 2016, 23, 15302–15309. [Google Scholar] [CrossRef] [PubMed]
- Kibbee, R.J.; Örmeci, B. Development of a sensitive and false-positive free PMA-qPCR viability assay to quantify VBNC Escherichia coli and evaluate disinfection performance in wastewater effluent. J. Microbiol. Methods 2017, 132, 139–147. [Google Scholar] [CrossRef] [PubMed]
- Baccari, O.; Elleuch, J.; Barkallah, M.; Boukedi, H.; Ayed, N.B.; Hammami, A.; Fendri, I.; Abdelkafi, S. Development of a new TaqMan-based PCR assay for the specific detection and quantification of Simkania negevensis. Mol. Cell. Probes 2020, 53, 101645. [Google Scholar] [CrossRef]
- Liu, P.; Ibaraki, M.; Kapoor, R.; Amin, N.; Das, A.; Miah, R.; Mukhopadhyay, A.K.; Rahman, M.; Dutta, S.; Moe, C.L. Development of Moore Swab and Ultrafiltration Concentration and Detection Methods for Salmonella Typhi and Salmonella Paratyphi A in Wastewater and Application in Kolkata, India and Dhaka, Bangladesh. Front. Microbiol. 2021, 12, 684094. [Google Scholar] [CrossRef]
- Jikumaru, A.; Ishii, S.; Fukudome, T.; Kawahara, Y.; Iguchi, A.; Masago, Y.; Nukazawa, K.; Suzuki, Y. Fast, sensitive, and reliable detection of waterborne pathogens by digital PCR after coagulation and foam concentration. J. Biosci. Bioeng. 2020, 130, 76–81. [Google Scholar] [CrossRef] [PubMed]
- Pärnänen, K.M.M.; Narciso-da-Rocha, C.; Kneis, D.; Berendonk, T.U.; Cacace, D.; Do, T.T.; Elpers, C.; Fatta-Kassinos, D.; Henriques, I.; Jaeger, T.; et al. Antibiotic resistance in European wastewater treatment plants mirrors the pattern of clinical antibiotic resistance prevalence. Sci. Adv. 2019, 5, eaau9124. [Google Scholar] [CrossRef]
- Nathaniel, B.R.; Ghai, M.; Druce, M.; Maharaj, I.; Olaniran, A.O. Development of a loop-mediated isothermal amplification assay targeting lmo0753 gene for detection of Listeria monocytogenes in wastewater. Lett. Appl. Microbiol. 2019, 69, 264–270. [Google Scholar] [CrossRef]
- Riquelme, M.V.; Leng, W.; Carzolio, M.; Pruden, A.; Vikesland, P. Stable oligonucleotide-functionalized gold nanosensors for environmental biocontaminant monitoring. J. Environ. Sci. 2017, 62, 49–59. [Google Scholar] [CrossRef] [PubMed]
- Tang, R.; Yang, H.; Gong, Y.; You, M.; Liu, Z.; Choi, J.R.; Wen, T.; Qu, Z.; Mei, Q.; Xu, F. A fully disposable and integrated paper-based device for nucleic acid extraction, amplification and detection. Lab. A Chip 2017, 17, 1270–1279. [Google Scholar] [CrossRef] [PubMed]
- Guo, J.; Li, J.; Chen, H.; Bond, P.L.; Yuan, Z. Metagenomic analysis reveals wastewater treatment plants as hotspots of antibiotic resistance genes and mobile genetic elements. Water Res. 2017, 123, 468–478. [Google Scholar] [CrossRef] [PubMed]
- Yasir, M. Analysis of Microbial Communities and Pathogen Detection in Domestic Sewage Using Metagenomic Sequencing. Diversity 2021, 13, 6. [Google Scholar] [CrossRef]
- Numberger, D.; Ganzert, L.; Zoccarato, L.; Mühldorfer, K.; Sauer, S.; Grossart, H.-P.; Greenwood, A.D. Characterization of bacterial communities in wastewater with enhanced taxonomic resolution by full-length 16S rRNA sequencing. Sci. Rep. 2019, 9, 9673. [Google Scholar] [CrossRef]
- Oluseyi Osunmakinde, C.; Selvarajan, R.; Mamba, B.B.; Msagati, T.A.M. Profiling Bacterial Diversity and Potential Pathogens in Wastewater Treatment Plants Using High-Throughput Sequencing Analysis. Microorganisms 2019, 7, 506. [Google Scholar] [CrossRef] [PubMed]
- Ciesielski, M.; Blackwood, D.; Clerkin, T.; Gonzalez, R.; Thompson, H.; Larson, A.; Noble, R. Assessing sensitivity and reproducibility of RT-ddPCR and RT-qPCR for the quantification of SARS-CoV-2 in wastewater. J. Virol. Methods 2021, 297, 114230. [Google Scholar] [CrossRef]
- Nshimyimana, J.P.; Cruz, M.C.; Wuertz, S.; Thompson, J.R. Variably improved microbial source tracking with digital droplet PCR. Water Res. 2019, 159, 192–202. [Google Scholar] [CrossRef] [PubMed]
- Gordillo, R.; Rodríguez, A.; Werning, M.L.; Bermúdez, E.; Rodríguez, M. Quantification of viable Escherichia coli O157: H7 in meat products by duplex real-time PCR assays. Meat Sci. 2014, 96, 964–970. [Google Scholar] [CrossRef]
- Garrido, A.; Chapela, M.-J.; Román, B.; Ferreira, M.; Lago, J.; Vieites, J.M.; Cabado, A.G. Development of a multiplex real-time PCR method for simultaneous detection of Salmonella enterica, Shigella flexneri and Listeria monocytogenes in processed food samples. Eur. Food Res. Technol. 2012, 234, 571–580. [Google Scholar] [CrossRef]
- Collins, S.; Jorgensen, F.; Willis, C.; Walker, J. Real-time PCR to supplement gold-standard culture-based detection of Legionella in environmental samples. J. Appl. Microbiol. 2015, 119, 1158–1169. [Google Scholar] [CrossRef] [PubMed]
- Cui, B.; Liang, S. Monitoring Opportunistic Pathogens in Domestic Wastewater from a Pilot-Scale Anaerobic Biofilm Reactor to Reuse in Agricultural Irrigation. Water 2019, 11, 1283. [Google Scholar] [CrossRef]
- Wong, Y.P.; Othman, S.; Lau, Y.L.; Radu, S.; Chee, H.Y. Loop-mediated isothermal amplification (LAMP): A versatile technique for detection of micro-organisms. J. Appl. Microbiol. 2018, 124, 626–643. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Lou, J.; Wang, H.; Wu, L.; Xu, J. Use of an improved high-throughput absolute abundance quantification method to characterize soil bacterial community and dynamics. Sci. Total Environ. 2018, 633, 360–371. [Google Scholar] [CrossRef]
- Lou, J.; Yang, L.; Wang, H.; Wu, L.; Xu, J. Assessing soil bacterial community and dynamics by integrated high-throughput absolute abundance quantification. PeerJ 2018, 6, e4514. [Google Scholar] [CrossRef]
- Tourlousse, D.M.; Yoshiike, S.; Ohashi, A.; Matsukura, S.; Noda, N.; Sekiguchi, Y. Synthetic spike-in standards for high-throughput 16S rRNA gene amplicon sequencing. Nucleic Acids Res. 2017, 45, e23. [Google Scholar] [CrossRef]
- Wang, X.; Howe, S.; Deng, F.; Zhao, J. Current Applications of Absolute Bacterial Quantification in Microbiome Studies and Decision-Making Regarding Different Biological Questions. Microorganisms 2021, 9, 1797. [Google Scholar] [CrossRef]
- Ejeian, F.; Etedali, P.; Mansouri-Tehrani, H.-A.; Soozanipour, A.; Low, Z.-X.; Asadnia, M.; Taheri-Kafrani, A.; Razmjou, A. Biosensors for wastewater monitoring: A review. Biosens. Bioelectron. 2018, 118, 66–79. [Google Scholar] [CrossRef]
- Garner, E.; Davis, B.C.; Milligan, E.; Blair, M.F.; Keenum, I.; Maile-Moskowitz, A.; Pan, J.; Gnegy, M.; Liguori, K.; Gupta, S.; et al. Next generation sequencing approaches to evaluate water and wastewater quality. Water Res. 2021, 194, 116907. [Google Scholar] [CrossRef]
- Shapiro, E.; Biezuner, T.; Linnarsson, S. Single-cell sequencing-based technologies will revolutionize whole-organism science. Nat. Rev. Genet. 2013, 14, 618–630. [Google Scholar] [CrossRef]
- Xue, J.; Schmitz, B.W.; Caton, K.; Zhang, B.; Zabaleta, J.; Garai, J.; Taylor, C.M.; Romanchishina, T.; Gerba, C.P.; Pepper, I.L.; et al. Assessing the spatial and temporal variability of bacterial communities in two Bardenpho wastewater treatment systems via Illumina MiSeq sequencing. Sci. Total Environ. 2019, 657, 1543–1552. [Google Scholar] [CrossRef]
- Stamps, B.W.; Spear, J.R. Identification of Metagenome-Assembled Genomes Containing Antimicrobial Resistance Genes, Isolated from an Advanced Water Treatment Facility. Microbiol. Resour. Announc. 2020, 9, e00003-20. [Google Scholar] [CrossRef]
- Alneberg, J.; Karlsson, C.M.G.; Divne, A.-M.; Bergin, C.; Homa, F.; Lindh, M.V.; Hugerth, L.W.; Ettema, T.J.G.; Bertilsson, S.; Andersson, A.F.; et al. Genomes from uncultivated prokaryotes: A comparison of metagenome-assembled and single-amplified genomes. Microbiome 2018, 6, 173. [Google Scholar] [CrossRef] [PubMed]
- Pascault, N.; Loux, V.; Derozier, S.; Martin, V.; Debroas, D.; Maloufi, S.; Humbert, J.-F.; Leloup, J. Technical challenges in metatranscriptomic studies applied to the bacterial communities of freshwater ecosystems. Genetica 2015, 143, 157–167. [Google Scholar] [CrossRef] [PubMed]
- Yergeau, E.; Masson, L.; Elias, M.; Xiang, S.; Madey, E.; Huang, H.; Brooks, B.; Beaudette, L.A. Comparison of Methods to Identify Pathogens and Associated Virulence Functional Genes in Biosolids from Two Different Wastewater Treatment Facilities in Canada. PLoS ONE 2016, 11, e0153554. [Google Scholar] [CrossRef] [PubMed]
- World Health Organization. Global Antimicrobial Resistance Surveillance System: Manual for Early Implementation; World Health Organization: Geneva, Switzerland, 2015. [Google Scholar]
- Bitton, G. Microbiology of Drinking Water Production and Distribution; John Wiley & Sons: Hoboken, NJ, USA, 2014; p. 312. [Google Scholar]
- Sun, Y.; Shen, Y.-X.; Liang, P.; Zhou, J.; Yang, Y.; Huang, X. Multiple antibiotic resistance genes distribution in ten large-scale membrane bioreactors for municipal wastewater treatment. Bioresour. Technol. 2016, 222, 100–106. [Google Scholar] [CrossRef] [PubMed]
- Mao, D.; Yu, S.; Rysz, M.; Luo, Y.; Yang, F.; Li, F.; Hou, J.; Mu, Q.; Alvarez, P. Prevalence and proliferation of antibiotic resistance genes in two municipal wastewater treatment plants. Water Res. 2015, 85, 458–466. [Google Scholar] [CrossRef]
- Nesme, J.; Cécillon, S.; Delmont, T.O.; Monier, J.-M.; Vogel, T.M.; Simonet, P. Large-scale metagenomic-based study of antibiotic resistance in the environment. Curr. Biol. 2014, 24, 1096–1100. [Google Scholar] [CrossRef]
- Xia, Y.; Li, A.-D.; Deng, Y.; Jiang, X.-T.; Li, L.-G.; Zhang, T. MinION Nanopore Sequencing Enables Correlation between Resistome Phenotype and Genotype of Coliform Bacteria in Municipal Sewage. Front. Microbiol. 2017, 8, 2105. [Google Scholar] [CrossRef]
- Che, Y.; Xia, Y.; Liu, L.; Li, A.-D.; Yang, Y.; Zhang, T. Mobile antibiotic resistome in wastewater treatment plants revealed by Nanopore metagenomic sequencing. Microbiome 2019, 7, 44. [Google Scholar] [CrossRef] [PubMed]
- Law, J.W.-F.; Ab Mutalib, N.-S.; Chan, K.-G.; Lee, L.-H. Rapid methods for the detection of foodborne bacterial pathogens: Principles, applications, advantages and limitations. Front. Microbiol. 2015, 5, 770. [Google Scholar] [CrossRef] [PubMed]
| Pathogenic Bacteria | Related Disease | Infectivity a | Persistence b | Density in WWTP Influent | Reference | |
|---|---|---|---|---|---|---|
| Enteric pathogens | E. coliO157:H7 | Gastroenteritis | High | Moderate | 101–106 CFU/100 mL | [18] |
| Campylobacter spp. | Gastroenteritis | Moderate | Moderate | 102–105 MPN/100 mL | [19] | |
| Shigellaspp. | Shigellosis | High | Short | 10–107 MPN/100 mL | [20,21] | |
| Salmonellaspp. | Salmonellosis; Typhoid fever | Low | May multiply | 1–107 MPN/100 mL | [20,22] | |
| Clostridioidesdifficile | Severe diarrhea and colitis | High | Long | - | [23,24] | |
| Non-enteric pathogens | Legionellaspp. | Acute respiratory illness, legionellosis | Moderate | May multiply | 107–1010 cells/100 mL | [25,26] |
| Mycobacteriumspp. | Pulmonary disease, skin infection | Low | May multiply | 105 gene copies/100 mL | [27] | |
| Molecular Method | Target Bacteria/Genes | Sample Type | Limit of Detection | References | |||
|---|---|---|---|---|---|---|---|
| Nucleic acid targeting methods | Polymerase chain reaction (PCR)-based method | Multiplex-PCR (mPCR) | Enteropathogens | Wastewater | - | [88] | |
| Single qPCR | Salmonella | Salmonella Isolates | - | [89] | |||
| Multiplex qPCR | Taqman method | invA of Salmonella spp.; the paratose synthase (prt) gene, and the tyvelose epimerase (tyv) gene of group D and group A Salmonella, the Salmonella-differentiating fragment 1 (Sdf-1) sequence of S. Enteritidis | Environmental Samples | 1 copies/reaction b | [90] | ||
| SYBR green | mcr-1 gene | Wastewater | 12 copies/reaction b | [91] | |||
| Microfluidic quantitative PCR | Antibiotic resistance and heavy metal resistance genes | Wastewater | - | [92] | |||
| Droplet digital PCR (ddPCR) | VBNC E. coli O157:H7/rfbE | Food | 5–6 copies/μL b | [93] | |||
| DNA Microarray | Salmonella enterica, Shigella flexneri, E. coli O157:H7, and Listeria monocytogenes | Food | 102 CFU/mL a | [94] | |||
| LAMP | V. parahaemolyticus | Flatfish | 1 CFU/mL in buffer b; 10 CFU/g in fish sample a | [95] | |||
| FISH | Salmonella | Minced lamb meat | 10 CFU/g a | [96] | |||
| Sequencing | Pyrosequencing | Bacterial communities | Sputum | - | [97] | ||
| Illumina technology | 16S rRNA gene | Well-characterized bacterial reference sample | - | [98] | |||
| Oxford Nanopore Technologies | |||||||
| Whole-genome sequencing (WGS) | 381 different resistance genes | Wastewater | - | [99] | |||
| Immunology-based methods | Enzyme-linked immunosorbent assay (ELISA) | S. enterica typhimurium. | River water | 9.2 × 103 CFU/mL a | [100] | ||
| Biosensor-based methods | Cross-linking reaction between antibody and water-soluble cf-GQDs (carboxyl functionalized graphene quantum dots) | E. coli O157: H7 | Milk | 102 CFU/mL a, b | [101] | ||
| Paper-based device | Origami paper-based device | E. coli | Bacteria culture | 103 CFU/mL b within 35 min | [102] | ||
| Paper-based ELISA | E. coli O157:H7 | Food | 1 × 104 CFU/mL a, b | [9] | |||
| Downstream Analysis | Targets | Best/Limited Fragment Length | Suggested Extraction Kits/Methods | Storage and Pretreatment of Samples | Recovery Efficiency | Sample Type | Reference |
|---|---|---|---|---|---|---|---|
| PCR-based method | Lambda DNA | - | FastDNA Spin Kit for Soil | Stored at −70 °C | 15.5% to 43.3% | Sediment | [168] |
| Ancylostoma caninum ova | - | MO Bio Power Max® Soil DNA Extraction Kit (MO BIO Laboratories Inc, Carlsbad, CA USA); Filtration | Stored at 4 °C in the dark | Treated wastewater: 39–50% Raw wastewater: 7.1–12% | Wastewater | [169] | |
| Microarray | 16S Rdna, cpn60, and wecE | Detection sensitivity is optimal when DNA targets > 500 bp | Bead beating separation and ammonium acetate purification | Centrifuged at 3000× g for 16 min at room temperature; stored at −20 °C | 81 μg DNA/mL | Wastewater | [170] |
| NGS | ARG | 150 bp (Limitation of the sequencing length) | FastDNA Spin Kit for Soil | Ethanol fixation (50%); filter-concentrated using 0.22-μm mixed cellulose ester filters; stored at –20 °C | 10.3 ± 3.6 μg/sample | Wastewater | [171] |
| 16S rRNA amplicons | Qiagen Mini Kit and MO Bio PowerSoil Kit | Centrifuged at 10,000× g for 5 min to pellet; filtered through 0.22 μm cellulose nitrate membrane filters | - | Wastewater | [172] |
| Detection Method | Cultivation | DNA/RNA Extraction | Target Pathogen | Biomarker | Sample Type | Limit of Detection (LoD) | References |
|---|---|---|---|---|---|---|---|
| PCR | Yes | Yes | Campylobacter spp., C. jejuni, C. coli | 16S rRNA, mapA, ceuE | Wastewater | 2 CFU/100 mL | [173] |
| E. coli O157:H7 | stx2 | ||||||
| S. typhimurium | stx1 | ||||||
| Real-time PCR | No | Yes | E. coli | uidA gene | Wastewater | 10 gc/reaction (standard curve) | [174] |
| No | Simkania negevensis | 16S rRNA gene | Wastewater | 5 gc/reaction (standard curve) | [175] | ||
| No | Yes | S. enterica serovar Typhi | stgA | Wastewater | 0.05–0.005 CFU/mL of seeded wastewater | [176] | |
| S. enterica serovar Paratyphi A | SSPAI | ||||||
| Droplet digital PCR (ddPCR) | Yes | Yes | Shiga toxin-producing E. coli | stx2 | River water, wastewater | 6 gc/reaction of standard curve; 32 copies/100 mL in river water | [177] |
| qPCR array | No | Yes | All | 285 ARGs and nine transposase genes | Wastewater | - | [166] |
| No | Yes | All | 229 ARGs and 25 mobile genetic elements | Wastewater | - | [178] | |
| Microfluidic qPCR | No | Yes | All | ARGs, heavy metal resistance genes, genes encoding the integrase, and 16S rRNA genes | Wastewater, drinking water | - | [92] |
| LAMP | Yes | Yes | Listeria monocytogenes | lmo0753 gene | Wastewater | 65 fg/µL of DNA and 38 CFU/mL in cell culture | [179] |
| FISH | Yes | No | Salmonella spp. | 23S rRNA | Wastewater | 102, 10, and 1 CFU/mL for 0 h, 6 h, and 24 h of enrichment in Rappaport-Vassiliadis broth, respectively. | [137] |
| Biosensor-based device | No | No | ARG | mecA gene | ARG-spiked wastewater effluent | 70 pM (4 × 107 gc/μL) by bootstrapping | [180] |
| Paper-based device | No | No | Salmonella typhimurium | fimA | Spiked wastewater | 102 CFU/mL | [181] |
| Yes | No | β-lactamase-expressing bacteria | β-lactamase | Wastewater | 3.8 × 106 CFU/mL | [157] | |
| Sequencing | No | Yes | All | ARGs | Sludge | - | [182] |
| No | Yes | Shotgun metagenomic for microbial community analysis and pathogen detection | Wastewater | Detected 87 pathogenic/opportunistic Bacteria, with most having <1% abundance. | [183] | ||
| Yes | Yes | Nanopore and Illumina metagenomics analysis for mobile antibiotic resistome | Wastewater | - | [25] | ||
| No | Yes | Full-length 16S rRNA | Wastewater | - | [184] | ||
| No | Yes | 16S-rRNA | Wastewater | - | [185] | ||
| Pathogenic Bacteria | Available PCR Primers and Probes (5′—3′) | Sensitivity | Reference |
|---|---|---|---|
| E. coliO157:H7 | RFBEO157-F GGATGACAAATATCTGCGCTGC RFBEO157-R GGTGATTCCTTAATTCCTCTCTTTCC RFBEO157-P HEX-TACAAGTCCACAAGGAAAG-BHQ1 | 1 CFU/g of seeded meat products after 4 h enrichment period at 37 °C | [188] |
| Rfb-F GTGTCCATTTATACGGACATCCATG Rfb-R CCTATAACGTCATGCCAATATTGCC | 2 CFU/100 mL of raw sewage | [173] | |
| Campylobacter spp. | 16S-F CCTGAMGCAGCAACGCC 16S-R CGGAGTTAGCCGGTGCTTATT 16S-P FAM-CTCCGAAAAGTGTCATCCT –MGB | 3.2 gene copies/reaction | [19,40] |
| C. jejuni | hipO-F CTTGCGGTCATGCTGGACATAC hipO-R AGCACCACCCAAACCCTCTTCA hipO-P VIC-ATTGCTTGCTGCAAAGT- MGB | 2.0 × 102 CFU/g of feces | [31] |
| C. coli | glyA-F AAACCAAAGCTTATCGTGTGC glyA-R AGTGCAGCAATGTGTGCAATG glyA-P FAM-CAACTTCATCCGCAAT- MGB | 2.5 × 102 CFU/g of feces | |
| C. lari | glyA-F CAGGCTTGGTTGTAGCAGGTG glyA-R ACCCCTTGGACCTCTTAAAGTTTT glyA-P TET-CATCCTAGTCCATTCCCTTATGCTC ATGTT-TAMRA | 2.1 gene copies/reaction | [19] |
| Shigellaspp. | ipaH-F CGCAATACCTCCGGATTCC ipaH-R TCCGCAGAGGCACTGAGTT ipaH-P FAM- AACAGGTCGCTGCATGGCTGGAA-BHQ1 | 10−5 ng/μL for genomic DNA templates, 10−1 CFU/mL for Shigella bacteria culture | [113] |
| Salmonellaspp. | invA-F AACGTGTTTCCGTGCGTAAT invA-R TCCATCAAATTAGCGGAGGC invA-P TGGAAGCGCTCGCATTGTGG | 9–15 CFU/25 g food sample | [189] |
| S. Typhi | stgA-F TATCGGCAACCCTGCTAATG stgA-R TATCCGCGCGG TTGTAAAT stgA-P FAM-CCATTACAG CATCTGGCGTAGCGA-BHQ1 | 0.05–0.005 CFU/mL of wastewater | [176] |
| S. entericaserovarParatyphi A | SSPAI-F ACCATCCGCAGGACAAATC SSPAI-R GGGAGATTACTGATGGAGAGATTAC SSPAI-P Cy5-AGAGTGCAAGTGGAGTGCCTCAAA-BHQ2 | ||
| C. difficile | tpi-F AAAGAAGCTACTAAGGGTACAAA tpi-R CATAATATTGGGTCTATTCCTAC | For simultaneous identification and toxigenic type characterization (fecal and urban water samples) | [59,66] |
| tcdB-F GGAAAAGAGAATGGTTTTATTAA tcdB-R ATCTTTAGTTATAACTTTGACATCTTT | |||
| tcdA-F AGATTCCTATATTTACATGACAATAT tcdA-R GTATCAGGCATAAAGTAATATACTTT | |||
| Legionellaspp. | PanLeg-F GGCGACCTGGCTTC PanLeg-R1 GGTCATCGTTTGCATTTATATTTA PanLeg-P1 FAM-ACGTGGGTTGCAA-MGBNFQ | 5 genome units (GU)/reaction with water sample | [190] |
| L. pneumophila | Lp-F TTGTCTTATAGCATTGGTGCCG Lp-R CCAATTGAGCGCCACTCATAG Lp-P Quasar670-CGGAAGCAATGGCTAAAGGCATGCA-BHQ3 | ||
| L. pneumophila sg1 | Lp1-F TGCCTCTGGCTTTGCAGTTA Lp1-R CACACAGGCACAGCAGAAACA Lp1-P VIC-TTTATTACTCCACTCCAGCGAT-MGBNFQ | ||
| Mycobacteriumspp. | 16S rRNA-F: ATGCACCACCTGCACACAGG 16S rRNA-R: GGTGGTTTGTCGCGTTGTTC | 10–100 copies of template plasmid/reaction (raw wastewater) | [191] |
| Molecular Method | Biomarkers | Advantages | Limitations | Reference |
|---|---|---|---|---|
| Nucleic acid targeting methods | DNA/RNA | - High sensitivity - High specificity - Multiple targets detection and quantification - Fast community profiling | - Require sample storage and processing - Require DNA/RNA extraction, which can cause DNA/RNA loss - Sensitive to inhibitors - High cost for large number of samples - Usually need specialized instruments | [11,212] |
| Immunology-based methods | Proteins | - Low cost - Can be automated - Can detect bacterial toxins | - Require pre-enrichment - Low sensitivity - Require labeling of antibodies and antigens | [9] |
| Biosensor-based methods | DNA/RNA, proteins, chemicals | - High sensitivity - Real-time detection - Label free | - High cost - Require specialized instruments - Low specificity - Not suitable for simultaneous detection of various organisms - Low reproducibility and insufficient stability | [197] |
| Paper-based device | DNA/RNA, proteins, chemicals | - Cost effective - Instrument free | - Detection limit (LoD) is usually high due to the traditional colorimetry - Limitations of the structure and material of paper device | [13,154,156] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, S.; Li, X.; Wu, J.; Coin, L.; O’Brien, J.; Hai, F.; Jiang, G. Molecular Methods for Pathogenic Bacteria Detection and Recent Advances in Wastewater Analysis. Water 2021, 13, 3551. https://doi.org/10.3390/w13243551
Zhang S, Li X, Wu J, Coin L, O’Brien J, Hai F, Jiang G. Molecular Methods for Pathogenic Bacteria Detection and Recent Advances in Wastewater Analysis. Water. 2021; 13(24):3551. https://doi.org/10.3390/w13243551
Chicago/Turabian StyleZhang, Shuxin, Xuan Li, Jiangping Wu, Lachlan Coin, Jake O’Brien, Faisal Hai, and Guangming Jiang. 2021. "Molecular Methods for Pathogenic Bacteria Detection and Recent Advances in Wastewater Analysis" Water 13, no. 24: 3551. https://doi.org/10.3390/w13243551
APA StyleZhang, S., Li, X., Wu, J., Coin, L., O’Brien, J., Hai, F., & Jiang, G. (2021). Molecular Methods for Pathogenic Bacteria Detection and Recent Advances in Wastewater Analysis. Water, 13(24), 3551. https://doi.org/10.3390/w13243551

