Next Article in Journal
Ancient DNA Resolves the History of Tetragnatha (Araneae, Tetragnathidae) Spiders on Rapa Nui
Next Article in Special Issue
Genome-Wide Identification and Expression Analysis of the HD-Zip Gene Family in Wheat (Triticum aestivum L.)
Previous Article in Journal
Structural Characterization and Association of Ovine Dickkopf-1 Gene with Wool Production and Quality Traits in Chinese Merino
Previous Article in Special Issue
Functional Characterization of the Versatile MYB Gene Family Uncovered Their Important Roles in Plant Development and Responses to Drought and Waterlogging in Sesame
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

SlbZIP38, a Tomato bZIP Family Gene Downregulated by Abscisic Acid, Is a Negative Regulator of Drought and Salt Stress Tolerance

1
Key Laboratory of Horticulture Science for Southern Mountainous Regions, Ministry of Education, Southwest University, Chongqing 400715, China
2
College of Horticulture and Landscape Architecture, Southwest University, Chongqing 400715, China
*
Authors to whom correspondence should be addressed.
Genes 2017, 8(12), 402; https://doi.org/10.3390/genes8120402
Submission received: 6 November 2017 / Revised: 7 December 2017 / Accepted: 13 December 2017 / Published: 20 December 2017
(This article belongs to the Special Issue Genetic Regulation of Abiotic Stress Responses)

Abstract

The basic leucine zipper (bZIP) transcription factors have crucial roles in plant stress responses. In this study, the bZIP family gene SlbZIP38 (GenBank accession No: XM004239373) was isolated from a tomato (Solanum lycopersicum cv. Ailsa Craig) mature leaf cDNA library. The DNA sequence of SlbZIP38 encodes a protein of 484 amino acids, including a highly conserved bZIP DNA-binding domain in the C-terminal region. We found that SlbZIP38 was differentially expressed in various organs of the tomato plant and was downregulated by drought, salt stress, and abscisic acid (ABA). However, overexpression of SlbZIP38 significantly decreased drought and salt stress tolerance in tomatoes (Ailsa Craig). The findings that SlbZIP38 overexpression reduced the chlorophyll and free proline content in leaves but increased the malondialdehyde content may explain the reduced drought and salt tolerance observed in these lines. These results suggest that SlbZIP38 is a negative regulator of drought and salt resistance that acts by modulating ABA signaling.

1. Introduction

Plant growth and crop productivity are limited by various adverse environmental stresses, including drought, high-salinity, and low temperature, which were significantly reduced the crop productivity [1]. Extensive functional studies have demonstrated that the plant hormone abscisic acid (ABA) plays a role in the response to biotic and abiotic stress [2,3,4]. The mechanisms through which this hormone works have become increasingly clear since the core signaling pathways of ABA have been identified [5,6,7]. In response to drought, salt, and cold stress, ABA triggers the induction of dehydration resistance genes [8], including the late embryogenesis abundant (LEA) genes and those encoding transcription factors, water transporters such as aquaporin, catalase, protein kinases, and phosphatases [9]. The expression of these genes protects cells and enables the plant to adapt to the stressful environment [10,11].
The basic leucine zipper (bZIP) family of transcription factors is one of the largest transcription factor (TF) families in plants. To date, 75 bZIP genes have been identified in Arabidopsis thaliana [12], 89 in Oryza sativa (rice) [13], 125 in Zea mays (maize) [14], and 131 in Glycine max (soybean) [15]. Members of this family are classified into different subgroups based on the presence of the leucine zipper dimerization motif and the specific DNA-binding domain including the DELAY OF GERMINATION 1 (DOG1) and Multifunctional Mosaic Region (MFMR) conserved areas [13,16]. These transcription factors respond to different abiotic stresses by recognizing and binding to genetic elements containing an ACGT core motif, such as a G box containing a CACGTG core motif, a C box containing a GACGTC core motif, an A box containing a TACGTA core motif, an ABA-responsive element (ABRE) containing a CCACGTGG core motif [17], and an as-1 (activation sequence = 1) core motif [18]. Thus, a series of bZIP genes have been shown to function in the ABA-regulated response to various abiotic stresses, including drought and salt [19,20]. In Arabidopsis, ABF3 [21] and AREB2/ABF4 [22] are involved in ABA regulation, and the overexpression of these genes improves drought tolerance [19]. In addition, transcription factors AREB1, AREB2, and ABF3 involved in multiple stress responses and require ABA for full activation, while AREB1/ABF2 is involved in posttranslational regulation [23,24,25]. AtbZIP2, AtbZIP11, and AtbZIP53 function in developmental processes and stress responses, particularly the response to salt stress [26,27], and AtbZIP1, AtbZIP11, AtbZIP24, and AtbZIP44 function in response to low temperature stress [26,28]. In rice, OsbZIP16 [29], OsbZIP23 [30,31,32], OsbZIP33 [33], OsbZIP45 [32], OsbZIP46 [34], OsbZIP52 [35], OsbZIP71 [36], and OsbZIP72 [37] are involved in the drought stress response; OsbZIP23 and OsbZIP71 have roles in salt stress tolerance [31,36]; and OsbZIP52 and OsbZIP71 function in the cold stress response [35,36]. Intriguingly, the native OsbZIP46 gene, which encodes a constitutively active form of OsbZIP46 (OsbZIP46CA1), increases ABA sensitivity with no positive effect on drought resistance. By contrast, a protein kinase (SAPK6) involved in ABA signaling has been shown significantly enhance drought resistance [34,38]. In Triticum aestivum (wheat), most known bZIPs, i.e., TaABP1 [39], TabZIP60 [40], TaAREB3 [41], and WABI5 [42], are primarily involved in the drought stress response, but also have a role in attenuating salt and cold stress. By contrast, TabZIP14B is only involved in salt stress and cold stress [43]. ABP9, a maize bZIP transcription factor, plays a role in tolerance to drought, salt, and freezing temperatures through ABA signaling and by controlling the accumulation of reactive oxygen species [44]. Maize bZIP60 and bZIP72 increase drought and salt tolerance when heterologously expressed in Arabidopsis [1,45]. Similarly, GmbZIP1, GmbZIP110, and GmFDL19 enhance salt stress tolerance in soybean [46,47,48]. A few bZIPs function in abiotic stress responses in Solanaceae, namely SlAREB1 [49,50], LebZIP2 [51], CabZIP1 [27], and ABZ1 [52]. SlAREB1 was identified in salt- and drought-resistant wild and cultivated tomatoes [50]. LebZIP2 is induced by salt and drought stress and may participate in an abiotic stress signaling pathway by regulating the expression of NbNOA1 or NbNR in Nicotiana benthamiana [51]. In Capsicum annuum, CabZIP1 enhances disease resistance and environmental stress tolerance [27]. ABZ1 proteins are involved in the negative regulation of gene expression under anaerobic conditions [52].
In tomatoes (Solanum lycopersicum), which are both major crops and model systems for fruit development, and a total of 69 members in the SlbZIP family have been characterized to date. Some of these members have been associated with various abiotic and biotic stresses as well as the response to light [16]. In this study, we isolated a gene encoding a bZIP transcription factor, SlbZIP38, from tomatoes, analyzed its expression profiles under different abiotic stress conditions and hormone treatments, and characterized its role in stress tolerance. We found that overexpression of SlbZIP38 substantially reduced drought tolerance of tomatoes (Solanum lycopersicum cv. Ailsa Craig).

2. Materials and Methods

2.1. Plant Materials and Growth Conditions

The seeds of Solanum lycopersicum cv. Ailsa Craig used in this study were grown at Southwest University, Chongqing, China. They were surface-sterilized with 70% ethanol for 3 min and 1% NaClO for 10 min, followed by several rinses with ddH2O, and then sown in the 15 cm diameter pots containing a soil: Perlite mixture (1:1) and grown under standard greenhouse conditions (14 h daylight and 10 h darkness at 25 ± 2 °C). Plants were watered every 3 days.
The Wild type (WT) and SlbZIP38 transgenic seedlings (T2, generation) were pre-grown as described above. One-month-old seedlings were used to perform the stress treatments. The phenotype of WT and SlbZIP38 transgenic tomatoes was observed after 7 days.

2.2. Sequence and Phylogenetic Analysis

Both Basic Local Alignment Search Tool (Bethesda, MD, USA) and hidden Markov model profile searches were obtained from the tomato genome database at the Sol Genomics Network [53]. The sequences were used as queries for searches of the National Center of Biotechnology Information Conserved Domain Database search databases [54] to verify the presence of the bZIP domain. Multiple sequence alignments of the full SlbZIP protein, basic regions, and leucine zipper domains were performed using COBALT of the National Center of Biotechnology Information (Bethesda, MD, USA). Phylogenetic trees were constructed using Molecular Evolutionary Genetics Analysis (MEGA) 6.0 [55], and the neighbor-joining (NJ) method with the default parameters manually adjusted, using the JTT+I+G substitution model and 1000 bootstrap replicates [55].

2.3. Abiotic Treatment Assays

The various abiotic stress treatments were performed as our described formal rules [56]. Firstly, one-month-old seedlings of WT or transgenic plants were transferred to 9-cm pots for further analysis. Then, they were treated with various adverse environmental stresses, including low and high temperatures (4 °C, 22 °C and 37 °C for 4 h, 8 h, and 24 h); flooding (for 2, 4, and 8 days); wilt and recovery (water was withheld for one week and then plants were rewatered until recovery); and salt stress (0, 100, 200, 300, 400 and 500 mM NaCl treatment for 24 h). In addition, the seedlings were treated with abscisic acid (ABA, 100 μM), gibberellic acid (GA, 100 μM), salicylic acid (SA, 100 μM), jasmonic acid (JA, 100 μM), and ethylene (Eth, 1 mM). The light cycle was 24 h calculated from the first day at 8:00 a.m. to the next 8:00 a.m. Finally, all harvested samples were immediately immersed in liquid nitrogen and stored at −80 °C until analysis. In each case, individual plants were used for each treatment with three biological replicates.

2.4. RNA Isolation and Quantitative Real-Time PCR Analysis

Total RNA from the leaves, stems, and roots of tomatoes, isolated using RNAiso Plus (TaKaRa, Dalian, China) as described in the manufacturer’s instructions, were subjected to DNase I (TaKaRa, Dalian, China) treatment. The DNase-treated RNA was reverse-transcribed using a PrimeScriptTM RT Reagent Kit (TaKaRa, Dalian, China). Quantitative real-time PCR (qRT-PCR) was performed on a CFX96 Real-Time PCR system (Bio-Rad Laboratories, Hercules, CA, USA) with Eva Green SMA (Bio-Rad Laboratories, Hercules, CA, USA). The SlELF-α gene (GenBank accession number: X14449) was used as an internal control for normalization [57]. Relative expression of the detected gene was calculated using the 2−ΔΔCt method. The primer sequences for the qRT-PCR assays are as follows: ELF-α and SlbZIP38-Q (Table 1). The expression of key genes in the ABA signaling pathway [49,58,59,60,61,62] was analyzed by RT-qPCR using the primers shown in Table 1.

2.5. Chlorophyll Content Measurement

For chlorophyll measurement, six individual leaf samples were removed from plants with distinct phenotypes, weighed, and extracted with 10 mL 80% aqueous acetone (v/v). The extract was centrifuged at 4000× g for 5 min in the room temperature and the absorbance was recorded at 663 and 646 nm using a Lambda 900 scanning spectrophotometer (PerkinElmer, Waltham, MA, USA). Total chlorophyll content was calculated according to the formula: Total Chlorophyll (µg mL−1) = 20.29 A646 + 8.02 A663 [63].

2.6. SlbZIP38 Overexpression Vector Construction and Tomato Transformation

The full-length cDNA of SlbZIP38 was amplified by polymerase chain reaction (PCR) with the SlbZIP38 primer (Table 1) from a tomato (Solanum lycopersicum cv. Ailsa Craig) mature leaf cDNA library. The primers of SlbZIP38 was designed by primer premier 5 according to the cDNA sequence (GenBank accession No: XM004239373). The PCR fragments were cloned into pESAY-Blunt, then digested by BamHI and Ecl136II and subcloned into the binary expression vector PVCT2024, which was also digested with BamHI and Ecl136II. The constructs were transformed into the Solanum lycopersicum cv. Ailsa Craig plants by Agrobacterium tumefaciens strain LBA4404 [64].

2.7. Measurement of Proline Content

Proline content was measured following a previously reported method with some modification [63]. Briefly, 0.5 g of leaf tissue was treated with 3% (w/v) aqueous sulphosalicylic acid for 10 min, and then the supernatants were collected by pipette following centrifugation at 500× g for 15 min in the room temperature, which were pipetted and subsequently treated with acid-ninhydrin at 90 °C for 1 h. Then, the reaction was terminated in an ice bath and the colored complex extracted in toluene. The absorbance was read at 520 nm. Proline concentration was measured using a calibration curve and expressed as μg proline g−1 fresh weight. The standard curve for proline was prepared by dissolving proline in 3% sulfosalicylic acid to cover the concentration range 0.5–10 μg mL−1 [65,66].

2.8. Malondialdehyde Content Detection

The level of lipid peroxidation was determined in terms of malondialdehyde (MDA) content. Briefly, 0.2 g leaf sample was homogenized in 4 mL of 1.0% trichloroacetic acid (TCA) and centrifuged at 15,000× g for 5 min at room temperature. Then, 4 mL of 20% TCA containing 0.5% thiobarbituric acid (TBA) was added to 1 mL supernatant. The mixture was blended and incubated at 95 °C in water for 30 min, and the reaction was terminated in an ice bath for 10 min. The mixture was centrifuged at 10,000× g for 10 min at room temperature. The absorbance of the supernatant was recorded at 532 and 600 nm. The MDA equivalent was calculated as follows: MDA (nmol/mL fresh weight) = ((A532 − A600)/155,000) × 106 [67].

2.9. Statistical Analysis

The mean values of qRT-PCR, MDA, proline and chlorophyll were taken from the measurements of three independent biological replicates and ‘Standard Error’ of the means was calculated. Data represent the means ± Standard error(SE, n = 3)—significantly different values from the WT at the p < 0.05 and p < 0.01 level, respectively, as determined by Student’s t-test, the expression profiles of SlbZIP38 under abiotic stress treatments, and the untreated samples at the same time point were used as the reference control. For the analysis of SlbZIP38-overexpressing plants under drought and salt stress, the WT was used as a reference control for Student’s t-test statistical analysis.

3. Results

3.1. Structural and Phylogenetic Analysis of SlbZIP38 in Solanum lycopersicum

The 1455-bp full-length cDNA sequence of the SlbZIP38, a basic leucine zipper (bZIP) transcription factor was obtained from a cDNA library prepared from mature tomatoes (Solanum lycopersicum cv. Ailsa Craig) leaves. The largest open reading frame encoded a protein of 484 amino acids and had a predicted molecular weight of 53.7 kDa with a pI of 6.58. We collected forty-two bZIP protein sequences linked to abiotic stress were collected from National Center of Biotechnology Information (NCBI) (Bethesda, MD, USA) for Solanum lycopersicum (tomato), Capsicum annuum (pepper), Arabidopsis thaliana, Gossypium hirsutum (cotton), Zea mays (maize), Glycine max (soybean), and Triticum aestivum (wheat) (Figure 1). Using these sequences, we constructed a phylogenetic tree and found that ZmbZIP72 [1], GmbZIP132 [68], GmbZIP78 [15], and MsbZIP [69] were clustered to the same branch as SlbZIP38 (Figure 1A). Amino acid alignments of these bZIP proteins revealed that SlbZIP38 shared high levels of amino acid sequence similarity with ZmbZIP72, GmbZIP132, GmbZIP78, and MsbZIP had a conserved bZIP DNA-binding domain spanning a 52-amino acid long basic region (N-x7-R/K-x9) and a DOG1 motif composed of 79 amino acid residues (Figure 1B), indicating that the phylogenetic analysis corresponds with the results of Multiple EM for Motif Elicitation (MEME) prediction.

3.2. The Expression Profiles of SlbZIP38 under Abiotic Stress Treatments

We then analyzed the expression pattern of SlbZIP38 to shed light on the functional significance of the gene. Expression levels peaked 6 h after the introduction of abiotic stress or the start of phytohormone treatment and had returned to the control levels after 18 h. SlbZIP38 expression was positively affected by the light cycle; its expression peaked after 6 h (Figure 2A). Real-time quantitative reverse transcription PCR (RT-qPCR) was used to detect the expression of SlbZIP38 in leaves treated with the phytohormones gibberellic acid (GA), jasmonic acid (JA), salicylic acid (SA), abscisic acid (ABA), and ethylene (Eth). SlbZIP38 was always expressed at lower levels in the treatment conditions compared to the control for the SA and ABA treatments (Figure 2B,E). By contrast, SlbZIP38 expression showed different expression tendencies after treatment with GA, JA, and Eth (Figure 2C,D,F), resulting in higher expression compared to the control at some time points, but lower expression at others. These results indicate that SlbZIP38 expression is negatively regulated by SA and ABA, and is also induced by light.

3.3. SlbZIP38 Expression Profiles under Various Abiotic Stresses

Using reverse transcription quantitative PCR (RT-qPCR), we examined SlbZIP38 expression patterns in the roots, stems, and leaves of one-month-old tomato seedlings subjected to various abiotic stressors, as outlined below.

3.3.1. Temperature Treatment

Compared to the control (22 °C), we found that, for short durations of treatment (4 h), SlbZIP38 expression was reduced in leaves after exposure to 4 °C and 37 °C, but it was significantly increased in roots at 37 °C. Expression peaked at 8 h of treatment at 37 °C in the leaves, stems and roots (Figure 3A). However, no significant changes in SlbZIP38 expression were detected in leaves and stems after 24 h of treatment at 4 °C treatment (Figure 3A). These data indicate that expression of SlbZIP38 expression was induced in roots by low (4 °C) and high (37 °C) temperatures. Furthermore, SlbZIP38 expression is readily induced by the high (37 °C) temperature.

3.3.2. Drought Stress

Compared with normally watered plants, SlbZIP38 expression was significantly reduced in the leaves, stems, and roots of wilted plants that had not been watered for one week (Figure 3B, Student’s t-test, p < 0.01). Furthermore, SlbZIP38 transcript was present at normal levels in the roots of these plants by 2 h after rewatering, but not in the leaves and stems (Figure 3B). By contrast, the levels of SlbZIP38 transcript in the leaves peaked 8 h after rewatering, and then dramatically decreased to a minimum again after 24 h (Figure 3B). These data indicate that SlbZIP38 is readily induced by drought.

3.3.3. Flooding

As shown in Figure 3C, SlbZIP38 expression in leaves was not affected by flooding in the leaves, but was significantly reduced in the stems and roots after two days of flooding. After 8 d of flooding, SlbZIP38 expression increased to the higher levels (2-fold that of the untreated control, CK) in the stems and to normal levels in the roots (Figure 3C). Our results showed that SlbZIP38 expression was induced by water stress in the stems and roots, but not in the leaves.

3.3.4. NaCl Stress

To determine the plant’s response to high salt conditions, one-month-old tomato seedlings were placed on various concentrations of NaCl for 24 h. Compared with CK, the expression levels of SlbZIP38 were markedly reduced by exposure to salt stress (Figure 3D, Student’s t-test, p < 0.01). Thus, SlbZIP38 expression is associated with salt treatment.

3.4. Performance Analysis of SlbZIP38-Overexpressing Plants under Drought Stress

We then transgenically overexpressed SlbZIP38 driven by the 35S promoter in tomato plants. Fourteen independent SlbZIP38 transgenic lines were obtained. In 11 of these, SlbZIP38 expression was higher than that in the wild type (WT), but the expression level of three lines (OE-15, OE-16 and OE-35, OE: Overexpression) was significantly lower (Figure 4A). For further analysis, we selected OE-2, OE-3, and OE-5, in these lines, SlbZIP38 expression was approximately 41.5-, 59.5-, and 72.7-fold that of the WT, respectively (Figure 4A).
To examine whether SlbZIP38 overexpression conferred resistance to drought stress, one-month-old OE-2, OE-3, OE-5, and WT plants were not watered for seven days. Before stress treatment, no evident phenotypic differences were identified between the transgenic and WT plants. After the drought stress treatment, the transgenic plants showed more severe wilting and shrinking of the leaves than the WT (Figure 4B). Thus, the transgenic plants were more susceptible to drought stress than the WT plants were. The levels of chlorophyll, malondialdehyde (MDA) and free proline are used as an indicator of tolerance to abiotic stresses, such as drought, salinity, and extreme temperatures [49,70,71,72,73]. To evaluate the effects of drought stress on the performance of SlbZIP38-overexpressing transgenic plants, we thus compared the levels of chlorophyll, malondialdehyde (MDA), and free proline in the leaves of OE-2, OE-3, and OE-5 plants under drought stress with those in the WT. Following drought stress, the total chlorophyll content was significantly decreased in all plants examined (Student’s t-test, p < 0.01); this change was more pronounced in the transgenic plants than in the WT (Figure 4C). Before stress, the physiological levels of MDA and free proline were similar between transgenic and WT plants, whereas they were dramatically increased (Student’s t-test, p < 0.05) in the transgenic plants following drought treatment (Figure 4D). The free proline content of SlbZIP38-overexpressing plants was significantly lower (Student’s t-test, p < 0.01) than that of WT plants (Figure 4E). These results suggest that overexpression of the native SlbZIP38 gene may has a negative effect on drought stress tolerance.

3.5. Performance Analysis of SlbZIP38-Overexpressing Plants under Salt Stress

Homozygous transgenic plants OE-2, OE-3, and OE-5 of the T2 generation were subjected to salt tolerance testing with 400 mM NaCl. Whereas the transgenic plants displayed chlorosis and leaf fall after treatment with 400 mM NaCl, the WT plants were more resistant to salt stress (Figure 5A). We also measured the levels of chlorophyll, MDA, and free proline in plants subjected to salt stress. In contrast to our observations for the drought treatment, the levels of chlorophyll and free proline exhibited a greater decline (Student’s t-test, p < 0.01 or p < 0.05) in the transgenic plants than in the WT plants after salt treatment (Figure 5B,D), but the levels of MDA had significantly increased (Student’s t-test, p < 0.05) (Figure 4). These results suggest that overexpression of the native SlbZIP38 gene reduces salt stress tolerance.

3.6. Expression Analysis of the ABA Signaling Pathway Marker Genes under Drought and Salt Stress

To confirm whether overexpression of SlbZIP38 affected the ABA sensitivity (Figure 2E) of the transgenic plants, we thus analyzed the expression of SlbZIP38 and four marker genes of ABA-responsive genes (SlPP2C2, SlNCED, SlTAS14, and SlAREB1) under drought and salt stress. The results showed that SlbZIP38 expression is higher in transgenic than WT plants under normal and drought stress conditions (Figure 6A). In WT plants, the four ABA-responsive genes showed higher expression levels under dehydration treatment compared to the control, but in transgenic plants, the expression of these genes was decreased by this treatment (Figure 6B–E). No significant differences in SlNCED and SlAREB1 expression were detected in the transgenic plants under normal and drought stress conditions (Figure 6C,E). The relative expression level of SlTAS14 increased in the transgenic plants (Figure 6D), whereas the expression level of SlPP2C2 was not significantly different in the OE-3 line, but was reduced in OE-2 and OE-5 plants (Figure 6B). In addition, SlPP2C2, SlNCED, and SlAREB1 were expressed at lower levels in the transgenic plants than in the WT after drought treatment (Figure 6B–D). These results suggest that SlbZIP38 regulates the expression of genes involved in ABA-related stress signaling pathways in tomatoes. These results support the finding that plants overexpressing SlbZIP38 are less tolerant to drought than WT plants.
In line with the drought stress response, SlbZIP38 expression was higher in transgenic plants than in the WT under normal and salt stress conditions (Figure 7A). The relative expression levels of SlPP2C2, SlNCED, SlTAS14, and SlAREB1 were increased after salt treatment (Figure 7B–E). However, only SlAREB1 displayed the same expression patterns under high salt and drought stress conditions in WT and transgenic plants (Figure 6E and Figure 7E). SlPP2C2 and SlNCED gene were not significantly different between the transgenic plants and WT plants after salt treatment (Figure 7B,C), while the SlTAS14 showed higher levels in transgenic plants than in WT plants after salt treatment (Figure 7D), indicating that the molecular mechanisms underlying SlbZIP38 induction may differ depending on the type of stress or present. These results support the finding that plants overexpressing SlbZIP38 are less tolerant to salt stress than WT plants.

4. Discussion

4.1. SlbZIP38 Is a Member of the Tomato bZIP Family

In the present study, we characterized a bZIP protein from tomatoes (SlbZIP38). Phylogenetic analysis showed that SlbZIP38 formed a monophyletic group with ZmbZIP72 (Figure 1A). Moreover, multiple alignment analysis showed that SlbZIP38 has an amino acid sequence similar to that of ZmbZIP72 (Figure 1B), which was previously shown to enhance drought and salt tolerance when heterologously expressed in Arabidopsis, suggesting that these genes may have similar functions [1]. In addition, the sequence comparison also showed that SlbZIP38 contains the typically conserved DNA-binding domain (N-x7-R/K-x9), and a DOG1 structural domain of 79 amino acids among different plants (Figure 1B), suggesting that the encoded protein has conserved functions [37]. Extensive previous studies showed that numerous bZIP transcription factors could improve the tolerance of drought, cold and salt stress. The ZmbZIP72 played important roles in abscisic acid (ABA) and stress signaling, which is similar to other bZIP proteins (i.e., OsbZIP66 and OsbZIP72). In addition, some SlbZIP genes, SlABZ1, SlAREB1, and LebZIP2 are also responsive to stress treatment [49,51,52]. Here, we found that SlbZIP38 expression was significantly downregulated after ABA treatment (Figure 2E), indicating that this gene is negatively regulated by ABA stress. These data suggests that SlbZIP38 might regulate the response to abiotic stressors through the ABA signaling pathway.

4.2. SlbZIP38-Overexpressing Plants Have a Reduced Tolerance to Drought and Salt Stress

Previous work has shown that bZIP genes are involved in the response to abiotic stressors such as drought, cold and high salinity [19,20]. In this study, we found that SlbZIP38 had no effect or an inverse effect on the ability of a tomato plant to respond to high and low temperature, wilting and recovery, flooding, and salt (Figure 3A–D). In leaves, SlbZIP38 expression was markedly and rapidly induced by exposure to a low temperature (Figure 3A), high temperature, wilting and recovery, and NaCl (Figure 3A,B,D), indicating that SlbZIP38 might play a role in regulating abiotic stress tolerance. In addition, we obtained 11 transgenic plants with significant levels of SlbZIP38 (Figure 4A). Meanwhile, the drought and salt tolerance of the transgenic plants were significantly decreased compared to the WT (Figure 4B and Figure 5A). Moreover, there were no significant differences in chlorophyll, MDA and free proline content between the transgenic and WT plants before exposure to drought and salt stresses, but the MDA and free proline are markedly increased after drought at seven days and salt at five days (Figure 4C–E and Figure 5B–D). In addition, the chlorophyll content and free proline content of transgenic plants were significantly lower than that of the WT after drought and salt stress (Figure 4C,E and Figure 5B,D). Conversely, the higher MDA levels were detected in transgenic plants than in WT (Figure 4D and Figure 5C). These results are consistent with the previous results that the chlorophyll, MDA and free proline levels were used as a protective effect against environmental stressors [71,74,75,76,77]. Our findings suggest that SlbZIP38 expression induces oxidative stress associated with drought and salt, thus making the SlbZIP38-overexpressing plants suffer more from oxidative damage than the WT plants.

4.3. SlbZIP38 Is a Negative Regulator of Drought and Salt Tolerance that Functions via the ABA Signaling Pathway

A number of bZIP genes (e.g., AtbZIP1, OsbZIP23, OsbZIP66, and ZmbZIP72) have been shown to play roles in the ABA signaling pathway [26,30,31,78,79]. In this study, we observed that SlbZIP38, a tomato bZIP family gene downregulated by Abscisic Acid (Figure 2D), and overexpression of SlbZIP38 reduced drought and salt tolerance (Figure 4B and Figure 5A), indicating that SlbZIP38 might be a negative regulator of drought and salt stress tolerance. These findings suggest that SlbZIP38’s response to drought and salt stress is regulated by the ABA signaling pathway.
To understand the molecular mechanism between SlbZIP38 and ABA signaling pathway well, we monitored the expression of four ABA-responsive genes (SlPP2C2, SlNCED, SlTAS14, and SlAREB1) before and after drought stress treatment. The four genes responded in various ways to different stressors and ABA treatment. SlPP2C2 is an important ABA signaling molecule that showed both ABA-independent and ABA-dependent interactions with ABA receptor PYLs (Pyrabactin Riesistance 1-Llike). SlPP2C2 is a putative ortholog of AtPP2XA, which is a negative regulator of the ABA signaling pathway in Arabidopsis [58,62]. SlNCED is the first rate-limiting enzyme in the ABA biosynthesis pathway [59,80,81]. SlTAS14 encodes a dehydrin protein (a type 2 class of LEA protein) known to be induced by ABA and NaCl [61,82]. Furthermore, LEA genes play crucial roles in stabilizing labile enzymes and protecting membrane structures when plants are exposed to abiotic stress [60,83]. SlAREB1 is a member of the AREB (abscisic acid-responsive element binding protein)/ABF (abscisic acid-responsive element binding factor) subfamily of bZIP transcription factors and is involved in abiotic stress-related ABA signaling [49,84]. In the present study, we analyzed the expression of ABA-related genes in the leaves of transgenic SlbZIP38-overexpression lines under drought and salt treatment and compared expression levels with those in the WT. The expression levels of SlPP2C2, SlNCED, SlTAS14, and SlAREB1 in the transgenic plants were significantly decreased (Student’s t-test, p < 0.01) compared with those of WT plants when subjected to drought stress (Figure 6B–E), indicating that SlbZIP38 is a negative regulator for ABA-dependent stress signal transduction. In addition, our results showed that SlNCED and SlAREB1 transcript levels differed between the WT and transgenic plants both before and after exposure to drought stress (Figure 6C,E), suggesting that the expression levels of SlPP2C2 and SlTAS14 were readily induced by drought stress in the transgenic plants. Conversely, the relative expression levels of SlPP2C2, SlNCED, SlTAS14, and SlAREB1 were also increased after salt treatment (Figure 7B–E). The SlAREB1, which is considered a marker of the ABA signaling pathway [49,84], had similar expression patterns under drought and salt stress in WT and transgenic plants (Figure 6E and Figure 7E), implying that SlAREB1 might activate SlbZIP38 expression during exposure to drought and salt stress, and that SlbZIP38 acts by modulating the ABA signaling pathway. For the SlTAS14, which encodes for a dehydrin (a type 2 class of LEA protein) whose expression in tomatoes is known to be induced by ABA, mannitol and NaCl [50]. However, the expression of SlTAS14 exhibited a greater increase under drought stress than salt stress; while expression of this gene was greater than that of the WT under salt stress, it was less than that of the WT under drought (Figure 6D and Figure 7D). These results showed that the molecular mechanism underlying SlbZIP38 expression was different under drought and salt stress conditions. Over-expression of SlbZIP38 only decreased the SlAREB1 expression but induced the SlTAS14 compared with WT during the salt stress, indicating that SlTAS14 may not only be involved in the ABA signal pathway but also be involved in other pathways during the salt stress. Taken together, these data suggest that SlbZIP38 is a negative regulator of drought and salt stress. Therefore, the molecular mechanisms of their action might be interpreted by further studies in the future works.

5. Conclusions

In this study, we cloned and characterized SlbZIP38 from tomatoes. Overexpression of SlbZIP38 resulted in decreased tolerance to drought and salt stress. Our results indicate that SlbZIP38 suppresses the plant’s drought stress response through inducing of the downstream pathway of ABA signaling. The mechanism by which SlbZIP38 functions in the plant’s response to abiotic stress remains to be further investigated.

Acknowledgments

This work was supported by the National Natural Science Foundation of China (NSFC) (31471885, 31772320), “Fundamental Research Funds for the Central Universities” (XDJK2016A005), and the Chongqing Social Enterprise and People’s Livelihood Guarantee Science and Technology Innovation Special Project (cstc2015shms-ztzx80005).

Author Contributions

YangluP. and Y.P. conceived of the study and drafted the manuscript. X.H. and C.L. performed the data mining and bioinformatics analysis. X.X. and J.L. carried out gene expression analysis. C.S. and H.S. carried out reagents and the field experiments. X.Z. and Y.P. contributed to interpretation and modification of the data and manuscript. All authors read and approved the final manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Ying, S.; Zhang, D.F.; Fu, J.; Shi, Y.S.; Song, Y.C.; Wang, T.Y.; Li, Y. Cloning and characterization of a maize bZIP transcription factor, ZmbZIP72, confers drought and salt tolerance in transgenic Arabidopsis. Planta 2012, 235, 253–266. [Google Scholar] [CrossRef] [PubMed]
  2. Zeevaart, J.; Creelman, R. Metabolism and physiology of abscisic acid. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1988, 39, 439–473. [Google Scholar] [CrossRef]
  3. Leung, J.; Giraudat, J. Abscisic Acid Signal Transduction. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1998, 49, 199–222. [Google Scholar] [CrossRef] [PubMed]
  4. Verslues, P.E.; Zhu, J.K. Before and beyond ABA: Upstream sensing and internal signals that determine ABA accumulation and response under abiotic stress. Biochem. Soc. Trans. 2005, 33, 375–379. [Google Scholar] [CrossRef] [PubMed]
  5. Fujita, Y.; Fujita, M.; Shinozaki, K.; Yamaguchi-Shinozaki, K. ABA-mediated transcriptional regulation in response to osmotic stress in plants. J. Plant Res. 2011, 124, 509–525. [Google Scholar] [CrossRef] [PubMed]
  6. Soon, F.F.; Ng, L.M.; Zhou, X.E.; West, G.M.; Kovach, A.; Tan, M.H.E.; Suino-Powell, K.M.; He, Y.; Xu, Y.; Chalmers, M.J.; et al. Molecular mimicry regulates ABA signaling by SnRK2 kinases and PP2C phosphatases. Science 2012, 335, 85–88. [Google Scholar] [CrossRef] [PubMed]
  7. Hanada, K.; Hase, T.; Toyoda, T.; Shinozaki, K.; Okamoto, M. Origin and evolution of genes related to ABA metabolism and its signaling pathways. J. Plant Res. 2011, 124, 455–465. [Google Scholar] [CrossRef] [PubMed]
  8. Xiong, L.; Ishitani, M.; Lee, H.; Zhu, J.K. The Arabidopsis LOS5/ABA3 locus encodes a molybdenum cofactor sulfurase and modulates cold stress- and osmotic stress-responsive gene expression. Plant Cell 2001, 13, 2063–2084. [Google Scholar] [CrossRef] [PubMed]
  9. Seo, M.; Koshiba, T. Complex regulation of ABA biosynthesis in plants. Trends Plant Sci. 2002, 7, 41. [Google Scholar] [CrossRef]
  10. Christmann, A.; Moes, D.; Himmelbach, A.; Yang, Y.; Tang, Y.; Grill, E. Integration of abscisic acid signalling into plant responses. Plant Biol. 2006, 8, 314–325. [Google Scholar] [CrossRef] [PubMed]
  11. Roychoudhury, A.; Paul, S.; Basu, S. Cross-talk between abscisic acid-dependent and abscisic acid-independent pathways during abiotic stress. Plant Cell Rep. 2013, 32, 985–1006. [Google Scholar] [CrossRef] [PubMed]
  12. Jakoby, M.; Weisshaar, B.; Drögelaser, W.; Vicentecarbajosa, J.; Tiedemann, J.; Kroj, T.; Parcy, F. bZIP transcription factors in Arabidopsis. Trends Plant Sci. 2002, 7, 106–111. [Google Scholar] [CrossRef]
  13. Nijhawan, A.; Jain, M.; Tyagi, A.K.; Khurana, J.P. Genomic survey and gene expression analysis of the basic leucine zipper transcription factor family in rice. Plant Physiol. 2008, 146, 333–350. [Google Scholar] [CrossRef] [PubMed]
  14. Wei, K.; Chen, J.; Wang, Y.; Chen, Y.; Chen, S.; Lin, Y.; Pan, S.; Zhong, X.; Xie, D. Genome-wide analysis of bZIP-encoding genes in maize. DNA Res. 2012, 19, 463–476. [Google Scholar] [CrossRef] [PubMed]
  15. Liao, Y.; Zou, H.-F.; Wei, W.; Hao, Y.-J.; Tian, A.G.; Huang, J.; Liu, Y.-F.; Zhang, J.-S.; Chen, S.-Y. Soybean GmbZIP44, GmbZIP62 and GmbZIP78 genes function as negative regulator of ABA signaling and confer salt and freezing tolerance in transgenic Arabidopsis. Planta 2008, 228, 225–240. [Google Scholar] [CrossRef] [PubMed]
  16. Li, D.; Fu, F.; Zhang, H.; Song, F. Genome-wide systematic characterization of the bZIP transcriptional factor family in tomato (Solanum lycopersicum L.). BMC Genom. 2015, 16, 771. [Google Scholar] [CrossRef] [PubMed]
  17. Izawa, T.; Foster, R.; Chua, N.H. Plant bZIP protein DNA binding specificity. J. Mol. Biol. 1993, 230, 1131–1144. [Google Scholar] [CrossRef] [PubMed]
  18. Katagiri, F.; Lam, E.; Chua, N.H. Two tobacco DNA-binding proteins with homology to the nuclear factor CREB. Nature 1989, 340, 727–730. [Google Scholar] [CrossRef] [PubMed]
  19. Kang, J.Y.; Choi, H.I.; Im, M.Y.; Kim, S.Y. Arabidopsis basic leucine zipper proteins that mediate stress-responsive abscisic acid signaling. Plant Cell 2002, 14, 343–357. [Google Scholar] [CrossRef] [PubMed]
  20. Cheong, Y.H.; Yoo, C.M.; Park, J.M.; Ryu, G.R.; Goekjian, V.H.; Nagao, R.T.; Key, J.L.; Cho, M.J.; Hong, J.C. STF1 is a novel TGACG-binding factor with a zinc-finger motif and a bZIP domain which heterodimerizes with GBF proteins. Plant J. 1998, 15, 199–209. [Google Scholar] [CrossRef] [PubMed]
  21. Oh, S.J.; Song, S.I.; Kim, Y.S.; Jang, H.J.; Kim, S.Y.; Kim, M.J.; Kim, Y.K.; Nahm, B.H.; Kim, J.K. Arabidopsis CBF3/DREB1A and ABF3 in transgenic rice increased tolerance to abiotic stress without stunting growth. Plant Physiol. 2005, 138, 341–351. [Google Scholar] [CrossRef] [PubMed]
  22. Uno, Y.; Furihata, T.; Abe, H.; Yoshida, R.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Arabidopsis basic leucine zipper transcription factors involved in an abscisic acid-dependent signal transduction pathway under drought and high-salinity conditions. Proc. Natl. Acad. Sci. USA 2000, 97, 11632–11637. [Google Scholar] [CrossRef] [PubMed]
  23. Yoshida, T.; Fujita, Y.; Sayama, H.; Kidokoro, S.; Maruyama, K.; Mizoi, J.; Shinozaki, K.; Yamaguchi-Shinozaki, K. AREB1, AREB2, and ABF3 are master transcription factors that cooperatively regulate ABRE-dependent ABA signaling involved in drought stress tolerance and require ABA for full activation. Plant J. 2010, 61, 672–685. [Google Scholar] [CrossRef] [PubMed]
  24. Fujita, Y.; Fujita, M.; Satoh, R.; Maruyama, K.; Parvez, M.M.; Seki, M.; Hiratsu, K.; Ohme-Takagi, M.; Shinozaki, K.; Yamaguchi-Shinozaki, K. AREB1 Is a Transcription Activator of Novel ABRE-Dependent ABA Signaling That Enhances Drought Stress Tolerance in Arabidopsis. Plant Cell 2005, 17, 3470–3488. [Google Scholar] [CrossRef] [PubMed]
  25. Furihata, T.; Maruyama, K.; Fujita, Y.; Umezawa, T.; Yoshida, R.; Shinozaki, K.; Yamaguchishinozaki, K. Abscisic acid-dependent multisite phosphorylation regulates the activity of a transcription activator AREB1. Proc. Natl. Acad. Sci. USA 2006, 103, 1988–1993. [Google Scholar] [CrossRef] [PubMed]
  26. Weltmeier, F.; Rahmani, F.; Ehlert, A.; Dietrich, K.; Schütze, K.; Wang, X.; Chaban, C.; Hanson, J.; Teige, M.; Harter, K.; et al. Expression patterns within the Arabidopsis C/S1 bZIP transcription factor network: Availability of heterodimerization partners controls gene expression during stress response and development. Plant Mol. Biol. 2009, 69, 107–119. [Google Scholar] [CrossRef] [PubMed]
  27. Lee, S.C.; Choi, H.W.; Hwang, I.S.; Du, S.C.; Hwang, B.K. Functional roles of the pepper pathogen-induced bZIP transcription factor, CAbZIP1, in enhanced resistance to pathogen infection and environmental stresses. Planta 2006, 224, 1209–1225. [Google Scholar] [CrossRef] [PubMed]
  28. Yang, O.; Popova, O.V.; Süthoff, U.; Lüking, I.; Dietz, K.J.; Golldack, D. The Arabidopsis basic leucine zipper transcription factor AtbZIP24 regulates complex transcriptional networks involved in abiotic stress resistance. Gene 2009, 436, 45–55. [Google Scholar] [CrossRef] [PubMed]
  29. Chen, H.; Chen, W.; Zhou, J.; He, H.; Chen, L.; Deng, X.W. Basic leucine zipper transcription factor OsbZIP16 positively regulates drought resistance in rice. Plant Sci. 2012, 193–194, 8–17. [Google Scholar] [CrossRef] [PubMed]
  30. Avishek, D.; Kumar, S.M.; Srimonta, G.; Sen, S.K.; Maiti, M.K. Enhanced Gene Expression Rather than Natural Polymorphism in Coding Sequence of the OsbZIP23 Determines Drought Tolerance and Yield Improvement in Rice Genotypes. PLoS ONE 2016, 11, e0150763. [Google Scholar] [CrossRef]
  31. Xiang, Y.; Tang, N.; Du, H.; Ye, H.; Xiong, L. Characterization of OsbZIP23 as a key player of the basic leucine zipper transcription factor family for conferring abscisic acid sensitivity and salinity and drought tolerance in rice. Plant Physiol. 2008, 148, 1938. [Google Scholar] [CrossRef] [PubMed]
  32. Park, S.H.; Jin, S.J.; Kang, H.L.; Kim, Y.S.; Yang, D.C.; Kim, J.K. OsbZIP23 and OsbZIP45, members of the rice basic leucine zipper transcription factor family, are involved in drought tolerance. Plant Biotechnol. Rep. 2015, 9, 89–96. [Google Scholar] [CrossRef]
  33. Chen, H.; Dai, X.J.; Gu, Z.Y. OsbZIP33 is an ABA-Dependent Enhancer of Drought Tolerance in Rice. Crop Sci. 2015, 55, 1673. [Google Scholar] [CrossRef]
  34. Tang, N.; Zhang, H.; Li, X.; Xiao, J.; Xiong, L. Constitutive Activation of Transcription Factor OsbZIP46 Improves Drought Tolerance in Rice. Plant Physiol. 2012, 158, 1755–1768. [Google Scholar] [CrossRef] [PubMed]
  35. Liu, C.; Wu, Y.; Wang, X. bZIP transcription factor OsbZIP52/RISBZ5: A potential negative regulator of cold and drought stress response in rice. Planta 2012, 235, 1157–1169. [Google Scholar] [CrossRef] [PubMed]
  36. Liu, C.; Mao, B.; Ou, S.; Wang, W.; Liu, L.; Wu, Y.; Chu, C.; Wang, X. OsbZIP71, a bZIP transcription factor, confers salinity and drought tolerance in rice. Plant Mol. Biol. 2014, 84, 19–36. [Google Scholar] [CrossRef] [PubMed]
  37. Lu, G.; Gao, C.; Zheng, X.; Han, B. Identification of OsbZIP72 as a positive regulator of ABA response and drought tolerance in rice. Planta 2009, 229, 605–615. [Google Scholar] [CrossRef] [PubMed]
  38. Chang, Y.; Nguyen, B.H.; Xie, Y.; Xiao, B.; Tang, N.; Zhu, W.; Mou, T.; Xiong, L. Co-overexpression of the Constitutively Active Form of OsbZIP46 and ABA-Activated Protein Kinase SAPK6 Improves Drought and Temperature Stress Resistance in Rice. Front. Plant Sci. 2017, 8, 1102. [Google Scholar] [CrossRef] [PubMed]
  39. Cao, X.Y.; Chen, M.; Xu, Z.S.; Chen, Y.F.; Li, L.C.; Yu, Y.H.; Liu, Y.N.; Ma, Y.Z. Isolation and Functional Analysis of the bZIP Transcription Factor Gene TaABP1 from a Chinese Wheat Landrace. J. Integr. Agric. 2012, 11, 1580–1591. [Google Scholar] [CrossRef]
  40. Zhang, L.; Xia, C.; Zhao, G.; Liu, J.; Jia, J.; Kong, X. A novel wheat bZIP transcription factor, TabZIP60, confers multiple abiotic stress tolerances in transgenic Arabidopsis. Physiol. Plant. 2015, 153, 538–554. [Google Scholar] [CrossRef] [PubMed]
  41. Wang, J.; Qian, L.; Mao, X.; Li, A.; Jing, R. Wheat transcription factor TaAREB3 participates in drought and freezing tolerances in Arabidopsis. Int. J. Biol. Sci. 2016, 12, 257–269. [Google Scholar] [CrossRef] [PubMed]
  42. Kobayashi, F.; Maeta, E.; Terashima, A.; Takumi, S. Positive role of a wheat HvABI5 ortholog in abiotic stress response of seedlings. Physiol. Plant. 2008, 134, 74–86. [Google Scholar] [CrossRef] [PubMed]
  43. Zhang, L.; Zhang, L.; Xia, C.; Gao, L.; Hao, C.; Zhao, G.; Jia, J.; Kong, X. A novel wheat C-bZIP gene, TabZIP14-B, participates in salt and freezing tolerance in transgenic plants. Front. Plant Sci. 2017, 8, 710. [Google Scholar] [CrossRef] [PubMed]
  44. Xia, Z.; Lei, W.; Hui, M.; Wen, H.; Fan, Y.; Zhao, J. Maize ABP9 enhances tolerance to multiple stresses in transgenic Arabidopsis by modulating ABA signaling and cellular levels of reactive oxygen species. Plant Mol. Biol. 2011, 75, 365–378. [Google Scholar] [CrossRef]
  45. Wang, B.; Zheng, J.; Liu, Y.; Wang, J.; Wang, G. Cloning and characterization of the stress-induced bZIP gene ZmbZIP60 from maize. Mol. Biol. Rep. 2012, 39, 6319–6327. [Google Scholar] [CrossRef] [PubMed]
  46. Gao, S.Q.; Chen, M.; Xu, Z.S.; Zhao, C.P.; Li, L.; Xu, H.J.; Tang, Y.M.; Zhao, X.; Ma, Y.Z. The soybean GmbZIP1 transcription factor enhances multiple abiotic stress tolerances in transgenic plants. Plant Mol. Biol. 2011, 75, 537–553. [Google Scholar] [CrossRef] [PubMed]
  47. Xu, Z.; Ali, Z.; Xu, L.; He, X.; Huang, Y.; Yi, J.; Shao, H.; Ma, H.; Zhang, D. The nuclear protein GmbZIP110 has transcription activation activity and plays important roles in the response to salinity stress in soybean. Sci. Rep. 2016, 6, 20366. [Google Scholar] [CrossRef] [PubMed]
  48. Li, Y.; Chen, Q.; Nan, H.; Li, X.; Lu, S.; Zhao, X.; Liu, B.; Guo, C.; Kong, F.; Dong, C. Overexpression of GmFDL19 enhances tolerance to drought and salt stresses in soybean. PLoS ONE 2017, 12, e0179554. [Google Scholar] [CrossRef] [PubMed]
  49. Orellana, S.; Yanez, M.; Espinoza, A.; Verdugo, I.; González, E.; Ruiz-Lara, S.; Casaretto, J. The transcription factor SlAREB1 confers drought, salt stress tolerance and regulates biotic and abiotic stress-related genes in tomato. Plant Cell Environ. 2010, 33, 2191–2208. [Google Scholar] [CrossRef] [PubMed]
  50. Yáñez, M.; Cáceres, S.; Orellana, S.; Bastías, A.; Verdugo, I.; Ruiz-Lara, S.; Casaretto, J.A. An abiotic stress-responsive bZIP transcription factor from wild and cultivated tomatoes regulates stress-related genes. Plant Cell Rep. 2009, 28, 1497–1507. [Google Scholar] [CrossRef] [PubMed]
  51. Seong, E.S.; Kwon, S.S.; Ghimire, B.K.; Yu, C.Y.; Cho, D.H.; Lim, J.D.; Kim, K.S.; Heo, K.; Lim, E.S.; Chung, I.M. LebZIP2 induced by salt and drought stress and transient overexpression by Agrobacterium. BMB Rep. 2008, 41, 693–698. [Google Scholar] [CrossRef] [PubMed]
  52. Sell, S.; Hehl, R. Functional dissection of a small anaerobically induced bZIP transcription factor from tomato. FEBS J. 2004, 271, 4534–4544. [Google Scholar] [CrossRef] [PubMed]
  53. The Tomato Genome. The tomato genome sequence provides insights into fleshy fruit evolution. Nature 2012, 485, 635. [Google Scholar] [CrossRef]
  54. Marchler-Bauer, A.; Bo, Y.; Han, L.; He, J.; Lanczycki, C.J.; Lu, S.; Chitsaz, F.; Derbyshire, M.K.; Geer, R.C.; Gonzales, N.R.; et al. CDD/ SPARCLE: Functional classification of proteins via subfamily domain architectures. Nucleic Acids Res. 2017, 45. [Google Scholar] [CrossRef] [PubMed]
  55. Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [PubMed]
  56. Pan, Y.; Seymour, G.B.; Lu, C.; Hu, Z.; Chen, X.; Chen, G. An ethylene response factor (ERF5) promoting adaptation to drought and salt tolerance in tomato. Plant Cell Rep. 2012, 31, 349–360. [Google Scholar] [CrossRef] [PubMed]
  57. Nicot, N.; Hausman, J.F.; Hoffmann, L.; Evers, D. Housekeeping gene selection for real-time RT-PCR normalization in potato during biotic and abiotic stress. J. Exp. Bot. 2005, 56, 2907–2914. [Google Scholar] [CrossRef] [PubMed]
  58. Chen, P.; Sun, Y.F.; Kai, W.B.; Liang, B.; Zhang, Y.S.; Zhai, X.W.; Jiang, L.; Du, Y.W.; Leng, P. Interactions of ABA signaling core components (SlPYLs, SlPP2Cs, and SlSnRK2s) in tomato (Solanum lycopersicon). J. Plant Physiol. 2016, 205, 67–74. [Google Scholar] [CrossRef] [PubMed]
  59. Du, M.; Li, C. Closely Related NAC Transcription Factors of Tomato Differentially Regulate Stomatal Closure and Reopening during Pathogen Attack. Plant Cell 2014, 26, 3167–3184. [Google Scholar] [CrossRef] [PubMed]
  60. Liu, H.; Yu, C.; Li, H.; Ouyang, B.; Wang, T.; Zhang, J.; Wang, X.; Ye, Z. Overexpression of ShDHN, a dehydrin gene from Solanum habrochaites enhances tolerance to multiple abiotic stresses in tomato. Plant Sci. 2015, 231, 198–211. [Google Scholar] [CrossRef] [PubMed]
  61. Muñozmayor, A.; Pineda, B.; Garciaabellán, J.O.; Antón, T.; Garciasogo, B.; Sanchezbel, P.; Flores, F.B.; Atarés, A.; Angosto, T.; Pintortoro, J.A. Overexpression of dehydrin tas14 gene improves the osmotic stress imposed by drought and salinity in tomato. J Plant Physiol. 2012, 169, 459–468. [Google Scholar] [CrossRef] [PubMed]
  62. Shen, X.; Guo, X.; Xiao, G.; Di, Z.; Wei, Z.; Chen, J.; Li, T. PacMYBA, a sweet cherry R2R3-MYB transcription factor, is a positive regulator of salt stress tolerance and pathogen resistance. Plant Physiol. Biochem. 2017, 112, 302–311. [Google Scholar] [CrossRef] [PubMed]
  63. Wellburn, A.R. The Spectral Determination of Chlorophylls a and b, as well as Total Carotenoids, Using Various Solvents with Spectrophotometers of Different Resolution. J. Plant Physiol. 1994, 144, 307–313. [Google Scholar] [CrossRef]
  64. An, G. Binary ti vectors for plant transformation and promoter analysis. Methods Enzymol. 1987, 153, 292–305. [Google Scholar] [CrossRef]
  65. Bates, L.S.; Waldren, R.P.; Teare, I.D. Rapid determination of free proline for water-stress studies. Plant Soil 1973, 39, 205–207. [Google Scholar] [CrossRef]
  66. Bačkor, M.; Fahselt, D.; Wu, C.T. Free proline content is positively correlated with copper tolerance of the lichen photobiont Trebouxia erici (Chlorophyta). Plant Sci. 2004, 167, 151–157. [Google Scholar] [CrossRef]
  67. Heath, R.L.; Packer, L. Photoperoxidation in isolated chloroplasts. I. Kinetics and stoichiometry of fatty acid peroxidation. Arch. Biochem. Biophys. 1968, 125, 189–198. [Google Scholar] [CrossRef]
  68. Liao, Y.; Zhang, J.S.; Chen, S.Y.; Zhang, W.K. Role of Soybean GmbZIP132 under Abscisic Acid and Salt Stresses. J. Integr. Plant Biol. 2008, 50, 221–230. [Google Scholar] [CrossRef] [PubMed]
  69. Li, Y.; Sun, Y.; Kang, J.M.; Zhang, T.J.; Yang, Q.C.; Fang, F. Construction of RNAi Expression Vector of MsZIP Gene from Medicago sativa L. and Genetic Transformation in Alfalfa. Chin. J. Grassl. 2012, 3, 26–30. [Google Scholar]
  70. Yamauchi, Y.; Ai, F.; Seki, K.; Toyoda, Y.; Tanaka, K.; Sugimoto, Y. Malondialdehyde generated from peroxidized linolenic acid causes protein modification in heat-stressed plants. Plant Physiol. Biochem. 2008, 46, 786–793. [Google Scholar] [CrossRef] [PubMed]
  71. Hu, T.; Zhu, S.; Tan, L.; Qi, W.; He, S.; Wang, G. Overexpression of OsLEA4 enhances drought, high salt and heavy metal stress tolerance in transgenic rice (Oryza sativa L.). Environ. Exp. Bot. 2016, 123, 68–77. [Google Scholar] [CrossRef]
  72. Liu, J.; Zhu, J.K. Proline accumulation and salt-stress-induced gene expression in a salt-hypersensitive mutant of Arabidopsis. Plant Physiol. 1997, 114, 591–596. [Google Scholar] [CrossRef] [PubMed]
  73. Armengaud, P.; Thiery, L.; Buhot, N.; Grenier-De March, G.; Savouré, A. Transcriptional regulation of proline biosynthesis in Medicago truncatula reveals developmental and environmental specific features. Physiol. Plant. 2004, 120, 442–450. [Google Scholar] [CrossRef] [PubMed]
  74. Szabados, L.; Savouré, A. Proline: A multifunctional amino acid. Trends Plant Sci. 2010, 15, 89–97. [Google Scholar] [CrossRef]
  75. Nayyar, H.; Walia, D.P. Water stress induced proline accumulation in contrasting wheat genotypes as affected by calcium and abscisic acid. Biol. Plant. 2003, 46, 275–279. [Google Scholar] [CrossRef]
  76. Su, J.; Wu, R. Stress-inducible synthesis of proline in transgenic rice confers faster growth under stress conditions than that with constitutive synthesis. Plant Sci. 2004, 166, 941–948. [Google Scholar] [CrossRef]
  77. Zou, J.; Liu, C.; Liu, A.; Zou, D.; Chen, X. Overexpression of OsHsp17.0 and OsHsp23.7 enhances drought and salt tolerance in rice. J. Plant Physiol. 2012, 169, 628–635. [Google Scholar] [CrossRef] [PubMed]
  78. Yoon, S.; Lee, D.K.; Yu, I.J.; Kim, Y.S.; Yang, D.C.; Kim, J.K. Overexpression of the OsbZIP66 transcription factor enhances drought tolerance of rice plants. Plant Biotechnol. Rep. 2017, 11, 53–62. [Google Scholar] [CrossRef]
  79. Sun, X.; Li, Y.; Cai, H.; Bai, X.; Ji, W.; Ding, X.; Zhu, Y. The Arabidopsis AtbZIP1 transcription factor is a positive regulator of plant tolerance to salt, osmotic and drought stresses. J. Plant Res. 2012, 125, 429–438. [Google Scholar] [CrossRef] [PubMed]
  80. Tan, B.C.; Schwartz, S.H.; Zeevaart, J.A.; Mccarty, D.R. Genetic control of abscisic acid biosynthesis in maize. Proc. Natl. Acad. Sci. USA 1997, 94, 12235. [Google Scholar] [CrossRef] [PubMed]
  81. Li, J.B.; Luan, Y.S.; Liu, Z. SpWRKY1 mediates resistance to Phytophthora infestans and tolerance to salt and drought stress by modulating reactive oxygen species homeostasis and expression of defense-related genes in tomato. Plant Cell Tissue Organ Cult. 2015, 123, 67–81. [Google Scholar] [CrossRef]
  82. Godoy, J.A.; Lunar, R.; Torresschumann, S.; Moreno, J.; Rodrigo, R.M.; Pintortoro, J.A. Expression, tissue distribution and subcellular localization of dehydrin TAS14 in salt-stressed tomato plants. Plant Mol. Biol. 1994, 26, 1921–1934. [Google Scholar] [CrossRef] [PubMed]
  83. Hundertmark, M.; Hincha, D.K. LEA (late embryogenesis abundant) proteins and their encoding genes in Arabidopsis thaliana. BMC Genom. 2008, 9, 118. [Google Scholar] [CrossRef] [PubMed]
  84. Hsieh, T.H.; Li, C.W.; Su, R.C.; Cheng, C.P.; Tsai, Y.C.; Chan, M.T. A tomato bZIP transcription factor, SlAREB, is involved in water deficit and salt stress response. Planta 2010, 231, 1459–1473. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Characterization of SlbZIP38. (A) the amino acid sequences of SlbZIP38 and of 42 bZIP transcription factors from different plant species were aligned using ClustalW2. The phylogenetic relationship was constructed using MEGA6 software (Version 6.06.) with the neighbor-joining tree method with 1000 bootstrap replicates. The scale bar indicates 0.01 amino acid substitutions per site; (B) comparison of conserved bZIP domains of SlbZIP38. Sequences were aligned using COBALT of the National Center of Biotechnology Information (Bethesda, MD, USA). Conserved amino acids are highlighted in light gray (identity rate > 65%) and dark gray (identity rate > 85%); At (Arabidopsis thaliana), Bna (Brassica napus), Ca (Capsicum annuum), Gh (Gossypium hirsutum), Gm (Glycine max), Ms (Medicago sativa Linn), Os (Oryza sativa), Ptr (Poncirus trifoliata), Sl (Solanum lycopersicum), Ta (Triticum aestivum), Th (Tamarix hispida), Zm (Zea mays).
Figure 1. Characterization of SlbZIP38. (A) the amino acid sequences of SlbZIP38 and of 42 bZIP transcription factors from different plant species were aligned using ClustalW2. The phylogenetic relationship was constructed using MEGA6 software (Version 6.06.) with the neighbor-joining tree method with 1000 bootstrap replicates. The scale bar indicates 0.01 amino acid substitutions per site; (B) comparison of conserved bZIP domains of SlbZIP38. Sequences were aligned using COBALT of the National Center of Biotechnology Information (Bethesda, MD, USA). Conserved amino acids are highlighted in light gray (identity rate > 65%) and dark gray (identity rate > 85%); At (Arabidopsis thaliana), Bna (Brassica napus), Ca (Capsicum annuum), Gh (Gossypium hirsutum), Gm (Glycine max), Ms (Medicago sativa Linn), Os (Oryza sativa), Ptr (Poncirus trifoliata), Sl (Solanum lycopersicum), Ta (Triticum aestivum), Th (Tamarix hispida), Zm (Zea mays).
Genes 08 00402 g001
Figure 2. Expression profiles of SlbZIP38 in the leaves of Ailsa Craig under exogenous hormone treatments. (A) light cycle treatment; (B) 100 μM salicylic acid (SA) treatment; (C) 100 μM gibberellic acid (GA) treatment; (D) 100 μM jasmonic acid (JA) treatment; (E) 100 μM exogenous abscisic acid (ABA) treatment; (F) 1 mM ethylene (Eth) treatment. CK, the Wild type (WT) plant treated with water which equal volume to hormone serving as the control. Gene expression analyses were examined by RT-qPCR and the expression values were calculated using the 2−ΔΔCt method and normalized to expression of the ELF-α housekeeping gene. Data represent the means ± SE (n = 3). Significantly different values from CK at the * p < 0.05 and ** p < 0.01 level, respectively, as determined by Student’s t-test.
Figure 2. Expression profiles of SlbZIP38 in the leaves of Ailsa Craig under exogenous hormone treatments. (A) light cycle treatment; (B) 100 μM salicylic acid (SA) treatment; (C) 100 μM gibberellic acid (GA) treatment; (D) 100 μM jasmonic acid (JA) treatment; (E) 100 μM exogenous abscisic acid (ABA) treatment; (F) 1 mM ethylene (Eth) treatment. CK, the Wild type (WT) plant treated with water which equal volume to hormone serving as the control. Gene expression analyses were examined by RT-qPCR and the expression values were calculated using the 2−ΔΔCt method and normalized to expression of the ELF-α housekeeping gene. Data represent the means ± SE (n = 3). Significantly different values from CK at the * p < 0.05 and ** p < 0.01 level, respectively, as determined by Student’s t-test.
Genes 08 00402 g002
Figure 3. Quantitative Real-time-PCR (qRT-PCR) analysis of SlbZIP38 expression under different abiotic stressors. SlbZIP38 expression in Ailsa Craig tomato plants (A) with exposure to different temperatures; plants under 22 °C serving as the control (CK); (B) wilting and recovery from water stress; CK, samples from untreated plants serving as the control; (C) under flooding; CK, samples from untreated plants serving as the control; and (D) exposure to different concentration of NaCl; Plants under 0 mM NaCl serving as the control. Data represent the means ± SE (n = 3). Significantly different values from the control at the * p < 0.05 and ** p < 0.01 level, respectively, as determined by Student’s t-test.
Figure 3. Quantitative Real-time-PCR (qRT-PCR) analysis of SlbZIP38 expression under different abiotic stressors. SlbZIP38 expression in Ailsa Craig tomato plants (A) with exposure to different temperatures; plants under 22 °C serving as the control (CK); (B) wilting and recovery from water stress; CK, samples from untreated plants serving as the control; (C) under flooding; CK, samples from untreated plants serving as the control; and (D) exposure to different concentration of NaCl; Plants under 0 mM NaCl serving as the control. Data represent the means ± SE (n = 3). Significantly different values from the control at the * p < 0.05 and ** p < 0.01 level, respectively, as determined by Student’s t-test.
Genes 08 00402 g003
Figure 4. Drought tolerance of SlbZIP38-overexpressing and Wild type (WT) plants. (A) SlbZIP38 expression in Wild type (WT) and transgenic plants (OE-2, OE-3, OE-5), as determined by qRT-PCR; (B) the performance of SlbZIP38-overexpressing and WT plants under drought stress. One-month-old transgenic (T2 generation) and WT plants were not watered for seven days (CE); comparisons of chlorophll (C), malondialdehyde (MDA) (D), and free proline (E) content in the transgenic and WT plants after 7 d of dehydration. CK, samples from untreated plants serving as the control. Data represent the means ± SE (n = 3). Significantly different values from WT at * p < 0.05 and ** p < 0.01 level, respectively, as determined by Student’s t-test.
Figure 4. Drought tolerance of SlbZIP38-overexpressing and Wild type (WT) plants. (A) SlbZIP38 expression in Wild type (WT) and transgenic plants (OE-2, OE-3, OE-5), as determined by qRT-PCR; (B) the performance of SlbZIP38-overexpressing and WT plants under drought stress. One-month-old transgenic (T2 generation) and WT plants were not watered for seven days (CE); comparisons of chlorophll (C), malondialdehyde (MDA) (D), and free proline (E) content in the transgenic and WT plants after 7 d of dehydration. CK, samples from untreated plants serving as the control. Data represent the means ± SE (n = 3). Significantly different values from WT at * p < 0.05 and ** p < 0.01 level, respectively, as determined by Student’s t-test.
Genes 08 00402 g004
Figure 5. Salt tolerance of SlbZIP38-overexpressing and WT plants. (A) the performance of SlbZIP38-overexpressing and WT plants under salt stress. One-month-old transgenic (T2 generation) and WT plants were treated with 400 mM NaCl for five days; (BD) comparisons of chlorophll (B), malondialdehyde (MDA) (C), and free proline (D) content of transgenic and WT plants. CK, samples from untreated plants serving as the control. Data represent the means ± SE (n = 3). Significantly different values from WT at * p < 0.05 and ** p < 0.01 level, respectively, as determined by Student’s t-test.
Figure 5. Salt tolerance of SlbZIP38-overexpressing and WT plants. (A) the performance of SlbZIP38-overexpressing and WT plants under salt stress. One-month-old transgenic (T2 generation) and WT plants were treated with 400 mM NaCl for five days; (BD) comparisons of chlorophll (B), malondialdehyde (MDA) (C), and free proline (D) content of transgenic and WT plants. CK, samples from untreated plants serving as the control. Data represent the means ± SE (n = 3). Significantly different values from WT at * p < 0.05 and ** p < 0.01 level, respectively, as determined by Student’s t-test.
Genes 08 00402 g005
Figure 6. Relative mRNA transcript levels of SlbZIP38 and ABA-responsive genes in WT and SlbZIP38-overexpressing lines under control and drought stress conditions. (A) SlbZIP38, (B) SIPP2C2, (C) SlNCED, (D) SITAS14, (E) SlAREB1. One-month-old WT and SlbZIP38-overexpressing plants were grown under drought conditions for seven days. The leaves were harvested and total RNA was isolated and subjected to RT-qPCR analysis. CK, samples from untreated plants serving as the control. Data represent the means ± SE (n = 3). Significantly different values from WT at * p < 0.05 and ** p < 0.01 level, respectively, as determined by Student’s t-test.
Figure 6. Relative mRNA transcript levels of SlbZIP38 and ABA-responsive genes in WT and SlbZIP38-overexpressing lines under control and drought stress conditions. (A) SlbZIP38, (B) SIPP2C2, (C) SlNCED, (D) SITAS14, (E) SlAREB1. One-month-old WT and SlbZIP38-overexpressing plants were grown under drought conditions for seven days. The leaves were harvested and total RNA was isolated and subjected to RT-qPCR analysis. CK, samples from untreated plants serving as the control. Data represent the means ± SE (n = 3). Significantly different values from WT at * p < 0.05 and ** p < 0.01 level, respectively, as determined by Student’s t-test.
Genes 08 00402 g006
Figure 7. The relative mRNA transcript levels of SlbZIP38 and ABA-responsive genes in WT and SlbZIP38-overexpressing lines in response to salt stress. (A) SlbZIP38, (B) SIPP2C2, (C) SlNCED, (D) SITAS14, (E) SlAREB1. One-month-old WT and SlbZIP38-overexpressing plants were treated with 400 mM NaCl for five days. The leaves were harvested and total RNA was isolated and subjected to RT-qPCR analysis. CK, samples from untreated plants serving as the control. Data represent the means ± SE (n = 3). Significantly different values from WT at * p < 0.05 and ** p < 0.01 level, respectively, as determined by Student’s t-test.
Figure 7. The relative mRNA transcript levels of SlbZIP38 and ABA-responsive genes in WT and SlbZIP38-overexpressing lines in response to salt stress. (A) SlbZIP38, (B) SIPP2C2, (C) SlNCED, (D) SITAS14, (E) SlAREB1. One-month-old WT and SlbZIP38-overexpressing plants were treated with 400 mM NaCl for five days. The leaves were harvested and total RNA was isolated and subjected to RT-qPCR analysis. CK, samples from untreated plants serving as the control. Data represent the means ± SE (n = 3). Significantly different values from WT at * p < 0.05 and ** p < 0.01 level, respectively, as determined by Student’s t-test.
Genes 08 00402 g007
Table 1. Information of primers for this manuscript.
Table 1. Information of primers for this manuscript.
Gene NamePrimer Sequences (5′-3′)
SlbZIP38CCATGCAAGCTTTCAAAGAAGCAGCTGTGAGATGAATACGACGTACTAGAGTTGG
SlbZIP38-QGAGGTGTTTCATGTGGTTAGGTGGATCGGCTTGCTGAGAAGACTGTTGC
SlTAS14-QAGAAGGTGGGAGGAGAAAGAAGATGGAGATGAAAACAAAGGTGTT
SlNCED-QCCGGTGGTTTACGACAAGAATCCAGAGGTGGAAACAGAAAC
SlPP2C-QCAGTGATGGATTATGGGACGTGGTACCTAGCCAAGGCTAATTTCGTCAA
SlAREB1-QCAGGTGAGGGTGGAAGTGGTGGTGGTGTTTGATTCTCCTCAGCATTCCAT
SlELF-αACCTTTGCTGAATACCCTCCATTGCACACTTCACTTCCCCTTCTTCTG

Share and Cite

MDPI and ACS Style

Pan, Y.; Hu, X.; Li, C.; Xu, X.; Su, C.; Li, J.; Song, H.; Zhang, X.; Pan, Y. SlbZIP38, a Tomato bZIP Family Gene Downregulated by Abscisic Acid, Is a Negative Regulator of Drought and Salt Stress Tolerance. Genes 2017, 8, 402. https://doi.org/10.3390/genes8120402

AMA Style

Pan Y, Hu X, Li C, Xu X, Su C, Li J, Song H, Zhang X, Pan Y. SlbZIP38, a Tomato bZIP Family Gene Downregulated by Abscisic Acid, Is a Negative Regulator of Drought and Salt Stress Tolerance. Genes. 2017; 8(12):402. https://doi.org/10.3390/genes8120402

Chicago/Turabian Style

Pan, Yanglu, Xin Hu, Chunyan Li, Xing Xu, Chenggang Su, Jinhua Li, Hongyuan Song, Xingguo Zhang, and Yu Pan. 2017. "SlbZIP38, a Tomato bZIP Family Gene Downregulated by Abscisic Acid, Is a Negative Regulator of Drought and Salt Stress Tolerance" Genes 8, no. 12: 402. https://doi.org/10.3390/genes8120402

APA Style

Pan, Y., Hu, X., Li, C., Xu, X., Su, C., Li, J., Song, H., Zhang, X., & Pan, Y. (2017). SlbZIP38, a Tomato bZIP Family Gene Downregulated by Abscisic Acid, Is a Negative Regulator of Drought and Salt Stress Tolerance. Genes, 8(12), 402. https://doi.org/10.3390/genes8120402

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop