Molecular Cytogenetics in Trough Shells (Mactridae, Bivalvia): Divergent GC-Rich Heterochromatin Content
Abstract
:1. Introduction
2. Experimental Section
2.1. Trough Shell Specimens
2.2. Chromosome Preparation, Fluorochrome Staining and C-Banding
2.3. DNA Extraction, PCR Amplification and Probe Labeling
2.4. Fluorescent in Situ Hybridization (FISH)
3. Results
4. Discussion
Supplementary Materials
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Huber, M. Compendium of Bivalves. A Full-Color Guide to 3300 of the World’s Marine Bivalves. A Status on Bivalvia after 250 Years of Research; ConchBooks: Hackenheim, Germany, 2010. [Google Scholar]
- Kong, L.; Li, Q. Genetic evidence for the existence of cryptic species in an endangered clam Coelomactra antiquata. Mar. Biol. 2009, 156, 1507–1515. [Google Scholar] [CrossRef]
- Guarniero, I.; Plazzi, F.; Bonfitto, A.; Rinaldi, A.; Trentini, M.; Passamonti, M. The bivalve mollusc Mactra corallina: Genetic evidence of existing sibling species. J. Mar. Biol. Assoc. 2010, 90, 633–644. [Google Scholar] [CrossRef]
- Ni, L.; Li, Q.; Kong, L.; Huang, S.; Li, L. DNA barcoding and phylogeny in the family Mactridae (Bivalvia: Heterodonta): Evidence for cryptic species. Biochem. Syst. Ecol. 2012, 44, 164–172. [Google Scholar] [CrossRef]
- Chetoui, I.; Denis, F.; Boussaid, M.; Telahigue, K.; el Cafsi, M. Genetic diversity and phylogenetic analysis of two Tunisian bivalves (Mactridae) Mactra corallina (Linnaeus, 1758) and Eastonia rugosa (Helbling, 1799) based on COI gene sequences. C. R. Biol. 2016, 339, 115–122. [Google Scholar] [CrossRef] [PubMed]
- Pérez-García, C.; Morán, P.; Pasantes, J.J. Karyotypic diversification in Mytilus mussels (Bivalvia: Mytilidae) inferred from chromosomal mapping of rRNA and histone gene clusters. BMC Genet. 2014. [Google Scholar] [CrossRef] [PubMed]
- García-Souto, D.; Pérez-García, C.; Morán, P.; Pasantes, J.J. Divergent evolutionary behavior of H3 histone gene and rDNA clusters in venerid clams. Mol. Cytogenet. 2015. [Google Scholar] [CrossRef] [PubMed]
- Menzel, R.W. Chromosome number in nine families of marine pellecypod mollusks. Nautilus 1968, 82, 45–50. [Google Scholar]
- Ieyama, H. Chromosome number in two species of Mactridae (Bivalvia, Heterodonta). Chromosome Inf. Serv. 1982, 33, 3. [Google Scholar]
- Corni, M.G.; Trentini, M. A chromosomic study of Mactra stultorum and Spisula subtruncata (Bivalvia, Mactridae). Biol. Zent. 1987, 106, 461–464. [Google Scholar]
- Wada, K.T.; Komaru, A. Karyotype of the Chinese mactra clam, Mactra chinensis (Bivalvia: Mactridae). Venus 1993, 52, 63–68. [Google Scholar]
- Xiang, J.H.; Desrosiers, R.R.; Dubé, F. Studies on the chromosomes of the giant scallop Placopecten magellanicus (Gmelin) and the surf clam Spisula solidissima (Dillwyn). Cytologia 1993, 58, 125–132. [Google Scholar] [CrossRef]
- Wada, K.T.; Scarpa, J.; Allen, S.K., Jr. Karyotype of the dwarf surfclam Mulinia lateralis (Say 1822) (Mactridae, Bivalvia). J. Shellfish Res. 1990, 9, 279–281. [Google Scholar]
- González-Tizón, A.M.; Martínez-Lage, A.; Rego, I.; Ausió, J.; Méndez, J. DNA content, karyotypes, and chromosomal location of 18S-5.8S-28S ribosomal loci in some species of bivalve molluscs from the Pacific Canadian coast. Genome 2000, 43, 1065–1072. [Google Scholar] [PubMed]
- Pan, Y.; Su, Y. The karyotype of Lutraria maxima Jonas. Mar. Sci. 2007, 31, 87–90. [Google Scholar]
- Sun, Z.; Shao, Y.; Guo, S.; Qin, Y.; Yang, A. Karyotypes of three species of the marine Veneroida molluscs. Acta Oceanol. Sin. 2003, 22, 671–678. [Google Scholar]
- Wang, Y.; Guo, X. Chromosomal mapping of the vertebrate telomeric sequence (TTAGGG)n in four bivalve molluscs by fluorescence in situ hybridization. J. Shellfish Res. 2001, 20, 1187–1190. [Google Scholar]
- Wang, Y.; Guo, X. Chromosomal mapping of the major ribosomal RNA genes in the dwarf surfclam (Mulinia lateralis Say). J. Shellfish Res. 2008, 27, 307–311. [Google Scholar] [CrossRef]
- Pasantes, J.; Martínez-Expósito, M.J.; Martínez-Lage, A.; Méndez, J. Chromosomes of Galician mussels. J. Moll. Stud. 1990, 56, 123–126. [Google Scholar] [CrossRef]
- Martínez-Expósito, M.J.; Pasantes, J.J.; Méndez, J. Proliferation kinetics of mussel (Mytilus galloprovincialis) gill cells. Mar. Biol. 1994, 120, 41–45. [Google Scholar]
- Pérez-García, C.; Cambeiro, J.M.; Morán, P.; Pasantes, J.J. Chromosomal mapping of rDNAs, core histone genes and telomeric sequences in Perumytilus purpuratus (Bivalvia: Mytilidae). J. Exp. Mar. Biol. Ecol. 2010, 395, 199–205. [Google Scholar] [CrossRef]
- Carrilho, J.; Pérez-García, C.; Leitão, A.; Malheiro, I.; Pasantes, J.J. Cytogenetic characterization and mapping of rDNAs, core histone genes and telomeric sequences in Venerupis aurea and Tapes rhomboides (Bivalvia: Veneridae). Genetica 2011, 139, 823–830. [Google Scholar] [CrossRef] [PubMed]
- Sumner, A.T. A simple technique for demonstrating centromeric heterochromatin. Exp. Cell Res. 1972, 75, 304–306. [Google Scholar] [CrossRef]
- Winnepenninckx, B.; Backeljau, T.; de Wachter, R. Extraction of high molecular weight DNA from molluscs. Trends Genet. 1993. [Google Scholar] [CrossRef]
- Pérez-García, C.; Hurtado, N.S.; Morán, P.; Pasantes, J.J. Evolutionary dynamics of rDNA clusters in chromosomes of five clam species belonging to the family Veneridae (Mollusca, Bivalvia). Biomed. Res. Int. 2014. [Google Scholar] [CrossRef]
- Vilgalys, R. Conserved primer sequences for PCR amplification and sequencing from nuclear ribosomal RNA. Available online: http://www.biology.duke.edu/fungi/mycolab/primers.htm (accessed on 25 January 2016).
- Pérez-García, C.; Guerra-Varela, J.; Morán, P.; Pasantes, J.J. Chromosomal mapping of rRNA genes, core histone genes and telomeric sequences in Brachidontes puniceus and Brachidontes rodriguezi (Bivalvia: Mytilidae). BMC Genet. 2010. [Google Scholar] [CrossRef] [PubMed]
- Giribet, G.; Distel, D. Bivalve phylogeny and molecular data. In Systematics and Phylogeography of Mollusks; Lydeard, C., Lindberg, D.R., Eds.; Smithsonian Books: Washington, DC, USA, 2003; pp. 45–90. [Google Scholar]
- Pérez-García, C.; Morán, P.; Pasantes, J.J. Cytogenetic characterization of the invasive mussel species Xenostrobus securis Lmk. (Bivalvia: Mytilidae). Genome 2011, 54, 771–778. [Google Scholar] [PubMed]
- Martínez–Expósito, M.J.; Méndez, J.; Pasantes, J.J. Analysis of NORs and NOR-associated heterochromatin in the mussel Mytilus galloprovincialis Lmk. Chromosome Res. 1997, 5, 268–273. [Google Scholar] [CrossRef] [PubMed]
- Torreiro, A.; Martínez-Expósito, M.J.; Trucco, M.I.; Pasantes, J.J. Cytogenetics in Brachidontes rodriguezi d’Orb (Bivalvia, Mytilidae). Chromosome Res. 1999, 7, 49–55. [Google Scholar] [CrossRef] [PubMed]
- Martínez, A.; Marinas, L.; González-Tizón, A.; Méndez, J. Cytogenetic characterization of Donax trunculus (Bivalvia: Donacidae) by means of karyotyping, fluorochrome banding and fluorescent in situ hybridization. J. Moll. Stud. 2002, 68, 393–396. [Google Scholar] [CrossRef]
- Petrović, V.; Pérez-García, C.; Pasantes, J.J.; Šatović, E.; Prats, E.; Plohl, M. A GC-rich satellite DNA and karyology of the bivalve mollusk Donax trunculus: A dominance of GC-rich heterochromatin. Cytogenet. Genome Res. 2009, 124, 63–71. [Google Scholar] [CrossRef] [PubMed]
- Woznicki, P.; Boron, A. Banding chromosome patterns of zebra mussel Dreissena polymorpha (Pallas) from the heated Konin lakes system (Poland). Caryologia 2003, 56, 427–430. [Google Scholar] [CrossRef]
- Boron, A.; Woznicki, P.; Skuza, L.; Zielinski, R. Cytogenetic characterization of the zebra mussel Dreissena polymorpha (Pallas) from Miedwie Lake, Poland. Folia Biol. 2004, 52, 33–38. [Google Scholar]
- Leitão, A.; Chaves, R. Banding for chromosomal identification in bivalves: A 20-year history. In Aquaculture 1. Dynamic Biochemistry, Process Biotechnology and Molecular Biology 2 (Special Issue 1); Russo, R., Ed.; Global Science Books: Ikenobe, Japan, 2008; pp. 44–49. [Google Scholar]
- González-Tizón, A.; Rojo, V.; Vierna, J.; Jensen, K.T.; Egea, E.; Martínez-Lage, A. Cytogenetic characterisation of the razor shells Ensis directus (Conrad, 1843) and E. minor (Chenu, 1843) (Mollusca: Bivalvia). Helgol. Mar. Res. 2013, 67, 73–82. [Google Scholar]
- Plohl, M.; Prats, E.; Martínez-Lage, A.; González-Tizón, A.; Méndez, J.; Cornudella, L. Telomeric localization of the vertebrate-type hexamer repeat (TTAGGG)n in the wedgeshell clam Donax trunculus and other marine invertebrate genomes. J. Biol. Chem. 2002, 277, 19839–19846. [Google Scholar] [CrossRef] [PubMed]




| Probe | Sequences of the Primers | Denaturation | Annealing | Elongation |
|---|---|---|---|---|
| 28S rDNA | LR10R: 5′GACCCTGTTGAGCTTGA3′ LR12: 5′GACTTAGAGGCGTTCAG3′ | 95 °C, 20 s | 48 °C, 20 s | 72 °C, 30 s |
| 5S rDNA | F: 5′CAACGTGATATGGTCGTAGAC3′ R: 5′AACACCGGTTCTCGTCCGATC3′ | 95 °C, 20 s | 44 °C, 20 s | 72 °C, 20 s |
| H3 histone gene | F: 5′ATGGCTCGTACCAAGCAGACVGC3′ R: 5′ATATCCTTRGGCATRATRGTGAC3′ | 95 °C, 15 s | 48 °C, 15 s | 72 °C, 15 s |
| Species | 2n | Karyotype | 28S rDNA | 5S rDNA | Histone Genes | Telomeric Sequences | References |
|---|---|---|---|---|---|---|---|
| Mactra chinensis | 38 | 10 sm, 9 st | [11] | ||||
| 38 | 10 m, 8 sm, 1 st/t | [16] | |||||
| Mactra stultorum | 38 | [10] | |||||
| 38 | 5 m, 3 m/sm, 4 sm, 4 sm/st, 3 st | 3q ter (st), 4q ter (st) | 15p cen (sm) | 12q ic (st) | terminal | This study | |
| Mactra sp. | 36 | [8] | |||||
| Mulinia lateralis | 36 | [8] | |||||
| 38 | 19 t | [13] | |||||
| 38 | 19 t | terminal | [17] | ||||
| 38 | 19 t | 15q ter (t), 19q ter (t) | [18] | ||||
| Raeta (Labiosa) plicatella | 36 | [8] | |||||
| Spisula solida | 38 | 5 m, 4 m/sm, 3 sm, 3 sm/st, 4 st | 17p ter (sm), 19p ter (st) | 5p ter (sm) | 8q ic (st) | terminal | This study |
| Spisula solidissima | 38 | 4 m, 5 sm, 10 st/t | [12] | ||||
| Spisula subtruncata | 38 | 8 m, 1 m/sm, 2 sm, 3 sm/st, 4 st, 1 t | 18q ter (m) | 3q ter (m) | 14q cen (m) | terminal | This study |
| Tresus capax | 34 | 10 m, 7 sm | no signals | [14] | |||
| (Lutraria maxima) | 34 | 10 m, 6 sm, 1 st/t | [15] |
© 2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
García-Souto, D.; Pérez-García, C.; Kendall, J.; Pasantes, J.J. Molecular Cytogenetics in Trough Shells (Mactridae, Bivalvia): Divergent GC-Rich Heterochromatin Content. Genes 2016, 7, 47. https://doi.org/10.3390/genes7080047
García-Souto D, Pérez-García C, Kendall J, Pasantes JJ. Molecular Cytogenetics in Trough Shells (Mactridae, Bivalvia): Divergent GC-Rich Heterochromatin Content. Genes. 2016; 7(8):47. https://doi.org/10.3390/genes7080047
Chicago/Turabian StyleGarcía-Souto, Daniel, Concepción Pérez-García, Jack Kendall, and Juan J. Pasantes. 2016. "Molecular Cytogenetics in Trough Shells (Mactridae, Bivalvia): Divergent GC-Rich Heterochromatin Content" Genes 7, no. 8: 47. https://doi.org/10.3390/genes7080047
APA StyleGarcía-Souto, D., Pérez-García, C., Kendall, J., & Pasantes, J. J. (2016). Molecular Cytogenetics in Trough Shells (Mactridae, Bivalvia): Divergent GC-Rich Heterochromatin Content. Genes, 7(8), 47. https://doi.org/10.3390/genes7080047

