Next Article in Journal
Gene Expression-Guided Drug Repurposing in Oncology: Insights from Antiretroviral Agents in Prostate and Bladder Cancer
Previous Article in Journal
Identification of Upland Rice Genotypes Resistant to Neck Blast Disease: A Systematic Review of Field and Greenhouse Studies
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Genes
Volume 17
Issue 2
10.3390/genes17020182
genes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Disorganization of Transcriptional Regulation and Alteration of Keratin Family Gene Expression in Hairy Ear Mice

by
Byeongyong Ahn
1,
Hojun Choi
1,
Joori Yum
1,
Dayoung Kim
1,
Harris Lewin
2 and
Chankyu Park
1,*
1
Department of Stem Cells and Regenerative Biology, Konkuk University, Hwayang-dong, Seoul 05029, Republic of Korea
2
Julie Ann Wrigley Global Futures Laboratory, Arizona State University, Tempe, AZ 85281, USA
*
Author to whom correspondence should be addressed.
Genes 2026, 17(2), 182; https://doi.org/10.3390/genes17020182
Submission received: 19 December 2025 / Revised: 22 January 2026 / Accepted: 29 January 2026 / Published: 31 January 2026
(This article belongs to the Section Molecular Genetics and Genomics)
Browse Figures
Versions Notes

Abstract

Background: The hairy ear (Eh) mutation in heterozygous mice (Eh/+) results in elongated and additional ear hairs, along with altered pinna morphology compared to wild-type (+/+) mice. Previous studies suggest that disruption of the Hoxc gene cluster caused by the Eh inversion influences the hair growth cycle. Methods: To elucidate the molecular basis of this phenotype, we performed RNA-seq analysis on ear tissues from four-week-old Eh/+ and +/+ mice and compared their transcriptomic profiles. Results: Differential expression analysis identified 2092 genes, and subsequent Gene Ontology (GO) and overrepresentation analysis revealed significant alterations in hair growth-related processes, including the hair cycle and canonical keratinization in Eh/+ ears. Notably, numerous hair keratin and keratin-associated protein (Krtap) genes were markedly upregulated in Eh/+ mice. Validation by quantitative real-time PCR confirmed increased expression of randomly selected keratin genes (Krt34, Krt39, Krt71, Krt81, Krt84) and keratin-associated proteins (Krtap4-16 and Krtap22-2). In contrast, epithelial keratin genes such as Krt2 and Krt14 were downregulated in Eh/+ ears. In addition, genes associated with hair follicle growth, Car6 and Gprc5d, showed elevated expression, while Dab2, a telogen–anagen transition marker linked to hair follicle stem cell activation, was slightly increased at the telogen stage in Eh/+ compared with +/+ mice. Conclusions: These findings provide new insights into the role of Hoxc cluster genes in orchestrating the expression of hair keratin and Krtap genes and highlight potential regulatory mechanisms underlying the hairy ear phenotype.

Graphical Abstract

1. Introduction

The hairy ear (Eh) mutation was first identified in the 1960s among the progeny of a neutron-irradiated male mouse [1]. Homozygous Eh/Eh mice exhibit perinatal lethality due to cleft palate formation, which results from impaired growth of the palatal shelves [2]. In contrast, heterozygous Eh/+ mice display no overt developmental abnormalities except for a smaller pinna and longer, denser hair compared to wild-type littermates [1]. The Eh mutation is caused by a paracentric inversion of the distal half of chromosome 15, with the proximal breakpoint located between Sntb1 (syntrophin basic 1) and Has2 (hyaluronan synthase 2), and the distal breakpoint between Hoxc4 (homeobox C4) and Smug1 (single-strand selective monofunctional uracil DNA glycosylase), without disrupting any coding sequences [1].
Another chromosomal inversion mutation, Koala (Koa), shares similarities with Eh, involving the distal half of chromosome 15, although the inverted region in Koa (51 Mb) is slightly larger than that in Eh (47 Mb) [3]. Koa heterozygotes (Koa/+) exhibit a hairy pinna phenotype similar to Eh/+ mice [4]. Increased expression of Hoxc cluster genes has been associated with hair follicle stem cell regeneration in Koa ear skin [5]. While changes in the expression of genes near inversion breakpoints have been reported [1], a comprehensive genome-wide transcriptomic analysis of Eh mutants has not yet been reported.
Hair follicles undergo cyclic phases collectively known as the hair cycle, which includes anagen (growth), catagen (regression), telogen (resting), and exogen (shedding), although exogen does not occur in every cycle [6]. Previous studies have reported altered expression of Hoxc cluster genes and an extended anagen phase in the ear hair follicles of Eh/+ mice compared to wild-type controls [1,2]. Multiple signaling pathways, including WNT, BMP, FGF, PDGF, TGF-β, and TNF-α, have been implicated in hair growth regulation [7,8,9,10,11], and defects in these pathways profoundly affect hair cycle progression [12,13,14,15].
Keratins (Krt) expressed in the skin can be broadly classified into epidermal keratins and hair (trichocyte) keratins, which differ in both their spatial expression patterns and biological functions. Epidermal keratins are predominantly expressed in basal and suprabasal layers of the interfollicular epidermis, where they provide mechanical stability and contribute to epidermal barrier function. In contrast, hair keratins are specifically expressed in differentiated trichocytes of the hair follicle and form the core intermediate filament network of the hair shaft [16,17].
In addition to keratins, keratin-associated proteins (KRTAP) represent a major structural component of hair. Krtap genes are expressed in hair follicle-derived cells and form an interfilamentous matrix that embeds and cross-links hair keratin intermediate filaments through extensive disulfide bonding. Rather than constituting intermediate filaments themselves, KRTAP contributes to the mechanical strength, rigidity, and resilience of the hair shaft by organizing keratin filaments into higher-order structures [18,19,20].
The coordinated and stage-specific regulation of hair keratin and Krtap gene families is essential for proper hair follicle differentiation and hair shaft formation, and alterations in their expression have been associated with diverse hair phenotypes across mammalian species. Given these well-established distinctions between epidermal and hair-specific keratin systems, differential regulation of these gene classes provides an important framework for interpreting transcriptomic changes associated with altered hair growth [21,22].
In this study, we conducted RNA-seq analysis to compare gene expression profiles between Eh/+ and wild-type ear tissues, aiming to elucidate the genome-wide impact of chromosomal inversion. Our findings reveal that the Eh/+ mutation alters the expression of numerous hair growth-related genes, including most hair Krt and Krtap. Furthermore, we demonstrate that hair Krt genes and epithelial Krt genes are subject to distinct regulatory mechanisms.

2. Materials and Methods

2.1. Animal and Sample Preparation

Eh/+ mice (B6By.Cg-Eh/J, RRID: IMSR_JAX:000523) were obtained from the Jackson Laboratory (Bar Harbor, ME, USA) and maintained under specific pathogen-free conditions at the Laboratory Animal Research Center of Konkuk University (KULARC). Animals were housed under a 12 h light/dark cycle with sterilized food and water provided ad libitum. Environmental conditions were controlled at 24 ± 1 °C and 55 ± 5% relative humidity. All experimental procedures were approved by the Konkuk University Animal Care and Use Committee (protocol number KU19224). Ear tissues were collected from four-week-old Eh/+ and wild-type (WT) mice and stored at −70 °C until further analysis.

2.2. Genotyping

Tail tips (5 mm) were excised using a sterile razor blade and incubated in 100 µL tail lysis buffer (Viagen Biotech Inc., Los Angeles, CA, USA) containing 25 mM proteinase K (Sigma-Aldrich, St. Louis, MO, USA) at 55 °C overnight. Lysates were heat-inactivated at 90 °C for 1 h. Genotyping PCR was performed using 50 ng genomic DNA, 0.5 µM of each primer, and the following primer sets: wild-type allele—WT-L (5′-ATGGGAGGCAAGAAGAACCT-3′) and WT-R (5′-ACTGCCCAGTGGTCCTTAAA-3′); hairy ear allele (Eh)—HE-L (5′-GGTGGGCCATATGGAGATTA-3′) and WT-R. The reaction mixture contained 100 µM dNTPs, 4× loading dye, 10× e-Taq Reaction Buffer (25 mM MgCl2), and 0.5 U Solg™ e-Taq DNA Polymerase (SolGent, Seoul, Republic of Korea). PCR was carried out on a Veriti 96-Well Thermal Cycler (Thermo Fisher Scientific, Waltham, MA, USA) under the following conditions: 95 °C for 5 min; 35 cycles of 95 °C for 30 s, 57 °C for 30 s, and 72 °C for 30 s; final extension at 72 °C for 5 min. PCR products were resolved on 1% agarose gels and visualized under UV illumination.

2.3. RNA Isolation and RNA-Seq

Ear tissues from Eh/+ and +/+ mice of both sexes were homogenized in liquid nitrogen, followed by the addition of 1 mL RNA extraction buffer (R&A-BLUE Total RNA Extraction Kit; iNtRON Biotechnology, Seongnam, Republic of Korea). Lysates were transferred to RNase-free tubes on ice, and total RNA was purified using the RNeasy Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s protocol. RNA integrity was assessed using an Agilent Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA), and samples with RNA integrity number (RIN) > 8.0 were used for sequencing. RNA-seq libraries were prepared using the TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA, USA) and sequenced on HiSeq 2000 or NovaSeq 6000 platforms (Illumina) to generate paired-end reads (151 bp). Library preparation and sequencing were performed by Macrogen (Seoul, Republic of Korea). The RNA-seq data was submitted to NCBI SRA under the accession number of PRJNA1390433.

2.4. Identification of Differentially Expressed Genes (DEGs) from RNA-Seq

Raw RNA-seq reads were processed using Trimmomatic (v0.39) to remove adapter sequences and low-quality bases (LEADING:3, TRAILING:3, SLIDINGWINDOW:4:15) [23]. Reads shorter than 101 bp were discarded. Trimmed reads were aligned to the mouse reference genome GRCm39 (RefSeq: GCF_000001635.27) using the STAR aligner (v2.7.11b) with ENCODE standard options and the following adjustments: maximum number of loci per read set to 20 (--outFilterMultimapNmax 20) and minimum overhang for novel splice junction detection set to 8 bp (--alignSJoverhangMin 8) [24]. GENCODE M37 (Ensembl 114) annotation was provided for junction guidance and downstream quantification.
Read counts mapped to gene exons were quantified using featureCounts (v2.0.6) with reverse-stranded mode (-s 2) [25]. Differential expression analysis was generated using edgeR (v4.40) [26,27]. Samples were grouped by genotype (Eh/+ and wild type (+/+)), pooling sexes as biological replicates. Genes with counts per million (CPM) > 1 in at least one genotype were retained. Library sizes were normalized using the trimmed mean of M-values (TMM) method, and statistical significance for two-group comparisons was assessed using the exact test. DEGs were defined as those with ≥2-fold change (FC) and a Benjamini–Hochberg false discovery rate (FDR) < 0.01.

2.5. Statistical Overrepresentation Analysis

Gene Ontology (GO) overrepresentation analysis of differentially expressed genes (DEGs) was performed using PANTHER (v19.0) (http://www.pantherdb.org) [28]. Statistical significance was assessed using Fisher’s exact test with false discovery rate (FDR) correction. Analyses were conducted against the GO Biological Process (BP) Complete dataset, and terms with fold enrichment greater than 2 and FDR < 0.01 were considered significant.

2.6. Real-Time Quantitative PCR (RT-qPCR)

Reverse transcription was carried out in 20 µL reactions using 2 µg of total RNA, oligo(dT)15 primer (Santa Cruz Biotechnology, Dallas, TX, USA), 10 µM dNTPs, and the SuperiorScript III cDNA Synthesis Kit (Enzynomics, Daejeon, Republic of Korea) at 50 °C for 50 min, followed by enzyme inactivation at 72 °C for 15 min. Genomic DNA contamination was evaluated by end-point PCR for Gapdh using exon–exon junction primers (5′-CTCACTCAAGATTGTCAGCA-3′ and 5′-GTCATCATACTTGGCAGGTT-3′) and intron-specific primers (5′-GCATCCTGACCTATGGCGTA-3′ and 5′-GCATCATCGAACCTCTCCCC-3′). PCR cycling conditions included initial denaturation at 95 °C for 5 min, followed by 40 cycles of 95 °C for 30 s, annealing at 57 °C (exon–exon primers) or 60 °C (intronic primers) for 40 s, and extension at 72 °C for 30 s, with a final extension at 72 °C for 5 min.
Real-time quantitative PCR (qPCR) was performed using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA, USA) with 100 ng cDNA and gene-specific primers (Table 1) whose primer efficiencies range between 82.6–106.6% (Table S1) on a Bio-Rad CFX Connect system, following the manufacturer’s protocol. The thermal profile consisted of 95 °C for 30 s (initial denaturation), followed by 45 cycles of 95 °C for 10 s and 60 °C for 30 s. Melt curve analysis was conducted by stepwise temperature increases from 65 °C to 90 °C in 0.5 °C increments, with a 5 s hold at each step. All reactions were performed in triplicate, and data were analyzed using Bio-Rad CFX Manager software (v3.1). Relative expression was calculated as −ΔCq, where ΔCq = Cq(target) − Cq(Gapdh). For each gene, time point, and sex, qPCR was performed on three biological replicates (independent animals), with three technical replicates per sample. Group mean −ΔCq values were compared between sexes using Welch’s two-sample t-test. Because no significant sex effect was detected (p > 0.01), data from males and females were pooled and treated as biological replicates for each genotype. All plots were generated using R (v4.4.2).

3. Results

3.1. Development of a Genotyping Protocol for the Hairy Ear Mutation (Eh)

We designed primers flanking the distal breakpoint region of both the Eh and wild-type alleles, based on their published sequences (GenBank accession numbers: wild-type—NC_000081.6; Eh—AY757367.1) [1]. Using a region-specific common primer, we developed a PCR-based genotyping assay capable of distinguishing between the Eh and wild-type alleles (Figure 1A). The resulting amplicon sizes were 440 base pairs (bp) for the wild-type allele and 230 bp for the Eh allele (Figure 1B). In heterozygous mice (Eh/+), both bands were consistently detected. Genotyping results aligned precisely with phenotypic observations (Figure 1C); all Eh/+ mice exhibited the characteristic hairy ear phenotype (Figure 1C). No Eh/Eh homozygous mice were recovered in surviving litters, consistent with the known postnatal lethality associated with homozygosity for the Eh allele.

3.2. Genome-Wide Transcriptomic Alterations in Eh/+ Ear Tissues Revealed by RNA-Seq

To compare gene expression profiles between Eh/+ and +/+ mouse ear tissues, we performed RNA sequencing (RNA-seq) on postnatal day 28 (P28) samples from four animals (one male and one female per genotype). Sequencing generated 157.96 million paired-end reads (151 bp each), totaling approximately 44.75 Gb of data. Reads were aligned to the mouse reference genome (GRCm39; RefSeq: GCF_000001635.27) with an average mapping rate of 89.5 ± 1.7% (Table S2).
Gene expression was normalized as counts per million (CPM) using the trimmed mean of M-values (TMM) method (Figure S1). Principal component analysis (PCA) revealed genotype as the major source of transcriptional variation, with PC1 explaining 70.0% of total variance and clearly separating Eh/+ from +/+ samples (Figure S2). Based on this clustering, male and female samples within each genotype were treated as biological replicates for differential expression analysis.
We identified 2092 differentially expressed genes (DEGs) between Eh/+ and +/+ ears (fold change (FC) > 2; FDR < 0.01), including 1175 upregulated and 917 downregulated genes among 16,082 expressed genes (CPM > 1; Figure S3A and Table S3). Of these, 108 DEGs mapped to chromosome 15 (Figure 2A–C and Table S4), with 83.3% (90/108) clustered within the Eh inversion region, suggesting direct transcriptional effects of the chromosomal rearrangement. The remaining 18 DEGs outside the inversion were all upregulated.
Gene Ontology (GO) Biological Process (BP) overrepresentation analysis of chromosome 15 DEGs highlighted processes such as keratinization (GO:0031424), intermediate filament organization (GO:0045109), intermediate filament cytoskeleton organization (GO:0045104), and keratinocyte differentiation (GO:0030216) (fold-enrichment > 2 & Fisher’s exact test, FDR < 0.01; Figure 2D and Table S5). These enrichments were largely driven by the strong upregulation of hair keratin genes. When the analysis was extended to all DEGs (n = 2092), additional hair-related processes emerged, including hair cycle (GO:0042633), hair follicle development (GO:0001942), and molting cycle (GO:0042303), while keratinization- and intermediate filament-associated terms remained significantly enriched (FDR < 0.01; Figure S3B and Table S6), consistent with the chromosome 15-specific profile. Furthermore, other BPs such as epidermis development (GO:0008544), skin development (GO:0043588), and transmembrane transport processes (organic anion transport, GO:0015711; inorganic anion transport, GO:0015698) were also significantly represented.
Given that the GO BP overrepresentation analysis identified keratinization as a significantly affected pathway, we next examined the expression profiles of all detected keratin (Krt) and keratin-associated protein (Krtap) genes in our dataset. A total of 52 keratin genes were expressed, including 29 epithelial keratins, 23 hair keratins, and one unclassified keratin (Krt222) (Figure 3A; Table S7). Remarkably, all 23 hair keratin genes were significantly upregulated in Eh/+ ear tissues, regardless of chromosomal location (Figure 3A).
In contrast, epithelial keratin genes displayed heterogeneous expression patterns. On chromosome 11, most epithelial keratins were modestly upregulated, with fold changes (FCs) lower than those observed for hair keratins. Notably, Krt14, Krt19, and Krt24 were significantly downregulated (FC < 0.5). On chromosome 15, epithelial keratins such as Krt18, Krt87, and Krt90 were strongly upregulated, whereas Krt2, Krt4, and Krt8 were significantly downregulated. Additionally, several epithelial keratins, including Krt76 and Krt88, were not expressed in both Eh/+ and +/+ samples. We also observed robust upregulation of 78 Krtap genes in Eh/+ samples, with no Krtap genes showing significant downregulation (Figure 3B and Table S7). Chromosome 11 contained the largest number of differentially expressed Krtap genes (35 of 78), followed by chromosome 16 (26 of 78).

3.3. Upregulation of Hoxc4, Hoxc5, and Hoxc13 in Eh/+ Ear Transcriptome of 4-Week-Old Mice

The Hoxc gene cluster within the inversion contains nine genes: Hoxc4, Hoxc5, Hoxc6, Hoxc8, Hoxc9, Hoxc10, Hoxc11, Hoxc12, and Hoxc13. Among these, we observed significant upregulation of Hoxc4 (FC = 42.88 & FDR = 2.34 × 10−11), Hoxc5 (FC = 7.38 & FDR = 1.67 × 10−4), and Hoxc13 (FC = 6.96 & FDR = 1.24 × 10−16) in the P28 Eh/+ ear transcriptome compared to +/+ controls (Figure 4 and Table S3), whereas the remaining cluster genes were not expressed at detectable levels (Table S4). These findings are consistent with the notion that increased expression of Hoxc genes contributes to the extended anagen phase in the hair cycle, although their expression appears to be developmentally regulated [1,29,30].

3.4. Hair Cycle Marker and Keratin Gene Expression Dynamics in Eh/+ and Wild-Type Mice

An extended anagen phase has been proposed as a key factor contributing to the increased hair length observed in Eh/+ ears compared to wild-type ears. To investigate this, we measured the expression of hair cycle stage marker genes [31,32]—Car6 (anagen), Gprc5d (mid- to late anagen), and Dab2 (telogen–anagen transition)—at three developmental time points (P10, P14, and P28) using real-time quantitative PCR (RT-qPCR) (Figure 5).
In both genotypes, all three genes showed increased expression from P10 (anagen) to P14 (transition to catagen), followed by a decline at P28 (telogen), with peak expression at P14. Notably, Car6 and Gprc5d levels were significantly higher in Eh/+ samples than in +/+ at P10 (p < 0.01). In contrast, Dab2 showed an opposing expression pattern during anagen and catagen, with slightly reduced expression in Eh/+ samples, followed by a modest increase at the telogen stage, which may contribute to the denser hair phenotype in mutant ears.
We further analyzed the expression of three hair keratin genes (Krt34, Krt71), two keratin-associated protein genes (Krtap4-16, Krtap22-2), and two epithelial keratin genes (Krt2, Krt14) across the same stages. All hair keratin and keratin-associated protein genes were upregulated in Eh/+ samples, peaking at P14 (Figure 5). Conversely, epithelial keratin genes showed lower expression in Eh/+ compared to wild-type mice.

4. Discussion

In this study, we performed differential expression analyses of Eh/+ and +/+ ear transcriptomes and identified a substantial upregulation of hair keratin (Krt) and keratin-associated protein (Krtap) genes in Eh/+ samples. Gene Ontology (GO) and pathway enrichment analyses indicated that these differentially expressed genes are primarily involved in biological processes such as intermediate filament organization, keratinization, and hair cycle. While Krt and Krtap genes are the major components of hair fibers and are important in hair follicle morphogenesis and the hair cycle [33], the causal relationship between their overexpression and the observed hairy ear phenotype remains unclear. Our findings suggest a potential link between elevated expression of these genes and hair growth, but whether this represents a driving mechanism or a secondary outcome of the phenotype requires further investigation. GO analysis revealed enrichment of DEGs associated with intermediate filament organization, keratinocyte differentiation, and hair cycle in Eh/+ ears (Table S6).
To conduct transcriptome analysis, a total of four animals with one biological replicate per genotype were used. Comparative analysis of ear transcriptomes from 4-week-old Eh/+ and wild-type mice identified 2092 DEGs. Principal component analysis (PCA) showed that PC1 accounted for approximately 70.0% of the variance, primarily reflecting genotype differences likely driven by the chromosomal inversion, whereas PC2 captured residual variation associated with sex differences within each group. This observation aligns with previous reports indicating that hair phenotypes are also influenced by sex [34]. To validate the RNA-seq findings, the expression patterns of selected DEGs were examined using real-time quantitative PCR. The qPCR results were largely consistent with RNA-seq data, supporting the robustness and reliability of our transcriptomic analysis despite the limited sample size (Figure S4).
The mouse genome contains more than 50 Krt genes, which can be classified into hair keratins and epithelial keratins [35]. Krtap genes are expressed in cell populations within hair follicles, nails, and cornified parts of filiform papillae on the tongue [22,36,37]. Several Krt and Krtap genes are not only structural components of hair but also play roles in regulating keratinocyte differentiation and the hair cycle [38,39,40].
Unlike hair keratins, which act as effector molecules for hair growth, epithelial keratins primarily function in keratinocyte migration and differentiation. Therefore, precise regulation of Krt and Krtap expression is essential for normal hair development [35]. Interestingly, the hairy ear mutation selectively upregulates hair keratin genes rather than epithelial keratins, suggesting distinct regulatory mechanisms governing these two keratin classes.
Krt2 was the most strongly downregulated keratin in the Eh/+ ear skin compared with wild-type controls (Figure 3 and Figure 5). The high basal expression of Krt2 and its distinct association with the ear phenotype are consistent with the tissue-specific expression pattern of Krt2 in mice, as it is predominantly expressed in ear epidermis but not in more densely haired skin regions such as the dorsal skin [41]. Furthermore, the restricted expression of Krt2 and the inverse correlation between Krt2 expression levels and hair growth observed in this study support a functional role for Krt2 in tissue-specific regulation of ear hair growth, alongside the upregulation of hair-type keratin genes.
Furthermore, the observation that hair keratin genes located on both the inversion-associated chromosome (MMU15) and a non-inverted chromosome (MMU11) were upregulated indicates the involvement of both cis- and trans-acting factors in this process, although the underlying mechanism remains unclear. In contrast, epithelial keratin genes exhibited inconsistent changes, with some upregulated and others downregulated. This variability suggests that epithelial keratin expression is also affected in Eh/+ ears, albeit without a clear directional pattern. Given this inconsistency, the altered expression of epithelial keratins is unlikely to be directly driven by Hoxc dysregulation.
Current knowledge on the regulatory mechanisms controlling keratin and Krtap gene expression remains limited. Previous studies suggest that Hoxc promotes hair follicle cycling, potentially through WNT signaling pathways [5,42,43]. In particular, Hoxc13 and WNT signaling have been identified as key regulators of hair keratin gene expression [36]. In contrast, epithelial keratin genes are primarily regulated by transcription factors such as AP1, AP2, SP1, POU domain proteins, C/EBP, glucocorticoid receptor, and NF-κB [44]. These distinct regulatory networks between hair keratin and epithelial keratin genes are consistent with our observation of robust upregulation of hair keratin genes in Eh/+ ears. Moreover, NF-κB has also been implicated in the transcriptional control of Krtap [45]. The concurrent upregulation of hair keratin and Krtap genes in the Eh/+ ear transcriptome suggests the involvement of a shared regulatory mechanism driving their coordinated expression.
Previous studies have shown that the expression of Hoxc cluster genes differs across developmental stages in Eh/+ and wild-type mice [1]. In our analysis, only Hoxc4, Hoxc5, and Hoxc13 were significantly upregulated at four weeks of age, corresponding to the telogen stage of the hair cycle, whereas other Hoxc genes were expressed at undetectable levels. We also observed age-dependent differences in hair keratin and Krtap expression between Eh/+ and wild-type mice (P10, P14, and P28; Figure 4). Consistent with previous findings in cashmere goats [36], Hoxc13 appears to regulate the expression of multiple hair keratin genes in mice. Because the entire Hoxc cluster gene is inverted in the Eh mutation, the observed upregulation of hair Krt and Krtap in Eh/+ ears may result from altered regulatory mechanisms affecting Hoxc expression.
A previous study reported that hair follicles in Eh/+ mice remained in the anagen (growth) phase for approximately three days longer (postnatal days 12–15) compared to +/+ littermates [1]. This observation is consistent with the higher expression of Car6 and Gprc5d, markers of anagen and mid- to late anagen, respectively, in Eh/+ ears compared to wild-type ears. Gprc5d has been implicated in hair cycle regulation and keratinization [46,47]. The increased expression of Dab2, a marker of the telogen–anagen transition, observed at the telogen stage in Eh/+ ears may facilitate subsequent hair follicle stem cell activation during anagen. This effect is potentially linked to dysregulation of Hoxc cluster genes, as Hoxc-dependent regulation of hair follicle stem cell regeneration has previously been demonstrated in the ear skin of Koa mutant mice [5].
It has also been shown that the hair cycle of mouse ear follicles remains in an extended telogen phase for at least three months, whereas dorsal hair follicles complete three cycles during the same period. This prolonged telogen phase has been suggested as a reason why the hairy phenotype is restricted to ear hair rather than extending to other body regions [48].
Chromosomal inversions are known to suppress genetic recombination and maintain haplotype linkages in natural populations, contributing to divergence in multiple traits [49,50,51]. Evaluating whether the Eh inversion suppresses recombination would provide valuable insight into its evolutionary implications.
Animal models have long been used in hair research to elucidate physiological and pathological processes underlying hair loss and regeneration [52]. In vivo studies have been conducted in various species, including mice, rats, hamsters, rabbits, sheep, and monkeys [53]. Eh/+ mice, together with Koa mutants, may serve as informative models for investigating the regulatory mechanisms of hair Krt and Krtap genes.
This study demonstrates that the Eh chromosomal inversion in mice profoundly alters ear transcriptomes, leading to significant upregulation of hair Krt and keratin-associated protein (Krtap) genes. Our findings suggest that Hoxc cluster dysregulation may contribute to the hairy ear phenotype through complex regulatory mechanisms. A limitation of this study is the small sample size used for RNA-seq analysis (n = 2 per genotype). However, the robustness of the transcriptomic findings was supported by validation using RT-qPCR with a larger number of biological replicates for selected genes. Although the precise causal relationship remains unclear, this work provides a foundation for future studies to elucidate cis- and trans-acting factors involved in keratin gene regulation and to explore the evolutionary implications of chromosomal inversions.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/genes17020182/s1: Figure S1. Effect of TMM normalization on RNA-seq sample expression profiles. Boxplots show the distribution of log10-transformed gene expression levels for each sample before (A) and after (B) normalization. Raw mapped read counts (A) were normalized to Counts Per Million (CPM) using the Trimmed Mean of M-values (TMM) method (B). The alignment of the median expression levels across samples in panel (B) indicates that the normalization successfully corrected for differences in library size; Figure S2. Principal component analysis (PCA) of protein-coding gene expression in Eh/+ and wild-type mice. The plot of the first two principal components is based on normalized expression values (CPM) of protein-coding genes. PC1 separates the samples by genotype (70.0% of variance), while PC2 distinguishes them by sex (15.9% of variance). Together, these two components account for 85.9% of the total variation. Each point represents a single biological replicate; Figure S3. Differential expression landscape and GO Biological Process overrepresentation for 2092 DEGs. (A) Volcano plot of all expressed protein-coding genes from ear tissues, showing the magnitude of change (log2 fold change (log2FC) of expression in Eh/+) and statistical significance (−log10 FDR; exact-test with Benjamini–Hochberg correction). Up-regulated (red) and down-regulated (blue) genes meet the study-wide DEG criteria (|log2FC| ≥ 1, FDR < 0.01); non-significant genes are gray. Vertical dashed lines mark |log2FC| = 1 (two-fold). The horizontal dashed line indicates FDR = 0.05 as a visual reference. Selected genes with large effect sizes or significance are labeled. (B) Bubble plot of Gene Ontology Biological Process (GO BP) terms enriched among the 2092 DEGs (PANTHER, Fisher’s exact test with FDR correction). The x-axis shows enrichment significance (−log10 FDR). Bubble size and color both reflect the number of DEGs annotated to each term (“Gene Count”). The strip (“−/+”) denotes enrichment computed separately for down-regulated (−) and up-regulated (+) subsets, respectively. Representative enriched terms include intermediate filament-based process and intermediate filament organization; Figure S4. Concordance of differential expression estimates between RNA-seq and RT-qPCR. Each log2 fold change (log2FC) represents expression in Eh mice relative to wild-type mice. RNA-seq log2FC values were obtained from differential expression analysis, whereas qPCR log2FC values were computed as the difference between group-mean −ΔCq values (normalized to Gapdh) for Eh/+ and wild-type mice; Table S1. Efficiency of primers used for RT-qPCR; Table S2. RNA-seq read generation and the mapping rate to the mouse reference genome; Table S3. Differentially expressed protein-coding genes (n = 2092) in Eh/+ ear tissue compared with +/+ controls; Table S4. Differentially expressed protein-coding genes (n = 108) on chromosome 15 in Eh/+ ear tissue compared with +/+ controls; Table S5. Overrepresentation analysis of DEGs on chromosome 15 in Eh/+ ear tissue; Table S6. Overrepresentation analysis of 2092 DEGs in Eh/+ ear tissue; Table S7. Expression pattern of keratin genes from RNA-seq of Eh/+ ear tissue.

Author Contributions

Conceptualization, H.C., H.L. and C.P.; methodology, B.A., J.Y. and H.C.; validation, B.A., J.Y. and D.K.; formal analysis, B.A. and J.Y.; investigation, J.Y., D.K. and B.A.; resources, J.Y., D.K. and H.C.; data curation, B.A.; writing—original draft preparation, J.Y., B.A. and C.P.; writing—review and editing, B.A. and C.P.; visualization, B.A.; supervision, C.P. and H.L.; project administration, C.P. and H.L.; funding acquisition, C.P. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The animal study protocol was approved by the Animal Care and Use Committee of Konkuk University on 4 March 2020 (protocol code KU19224).

Informed Consent Statement

Not applicable.

Data Availability Statement

The RNA-seq data have been deposited in the NCBI Sequence Read Archive (SRA) under BioProject accession PRJNA1390433.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
NCBINational Center for Biotechnology Information
SRASequence Read Archive
DEGDifferentially expressed gene
CPMcounts per million
TMMTrimmed mean of M-values
FCFold change
FDRFalse Discovery Rate
GOGene Ontology
BPBiological Process
PCAprincipal component analysis

References

  1. Mentzer, S.E.; Sundberg, J.P.; Awgulewitsch, A.; Chao, H.H.J.; Carpenter, D.A.; Zhang, W.-D.; Rinchik, E.M.; You, Y. The mouse hairy ears mutation exhibits an extended growth (anagen) phase in hair follicles and altered Hoxc gene expression in the ears. Vet. Dermatol. 2008, 19, 358–367. [Google Scholar] [CrossRef]
  2. Katayama, K.; Furuno, A.; Akiyama, K.; Tsuji, T.; Kunieda, T. Characterization of chromosomal inversion of the mouse hairy ears (Eh) mutation associated with cleft palate. Mamm. Genome 2007, 18, 246–254. [Google Scholar] [CrossRef]
  3. Davisson, M.T.; Roderick, T.H.; Akeson, E.C.; Hawes, N.L.; Sweet, H.O. The Hairy Ears (Eh) Mutation Is Closely Associated with a Chromosomal Rearrangement in Mouse Chromosome-15. Genet. Res. 1990, 56, 167–178. [Google Scholar] [CrossRef]
  4. Katayama, K.; Furuno, A.; Miyamoto, S.; Nakamura, M.; Ojika, I.; Shinkai, Y.; Akiyama, K.; Tsuji, T.; Kunieda, T. Suppressed recombination on mouse chromosome 15 defined regions of chromosomal inversions associated with koala (koa) and hairy ears (eh) mutations. Exp. Anim. 2008, 57, 73–77. [Google Scholar] [CrossRef][Green Version]
  5. Yu, Z.; Jiang, K.; Xu, Z.; Huang, H.; Qian, N.; Lu, Z.; Chen, D.; Di, R.; Yuan, T.; Du, Z.; et al. Hoxc-Dependent Mesenchymal Niche Heterogeneity Drives Regional Hair Follicle Regeneration. Cell Stem Cell 2018, 23, 487–500.e486. [Google Scholar] [CrossRef]
  6. Alonso, L.; Fuchs, E. The hair cycle. J. Cell Sci. 2006, 119, 391–393. [Google Scholar] [CrossRef]
  7. Festa, E.; Fretz, J.; Berry, R.; Schmidt, B.; Rodeheffer, M.; Horowitz, M.; Horsley, V. Adipocyte Lineage Cells Contribute to the Skin Stem Cell Niche to Drive Hair Cycling. Cell 2011, 146, 761–771. [Google Scholar] [CrossRef] [PubMed]
  8. Higgins, C.A.; Petukhova, L.; Harel, S.; Ho, Y.Y.; Drill, E.; Shapiro, L.; Wajid, M.; Christiano, A.M. FGF5 is a crucial regulator of hair length in humans. Proc. Natl. Acad. Sci. USA 2014, 111, 10648–10653. [Google Scholar] [CrossRef] [PubMed]
  9. Ito, C.; Saitoh, Y.; Fujita, Y.; Yamazaki, Y.; Imamura, T.; Oka, S.; Suzuki, S. Decapeptide with fibroblast growth factor (FGF)-5 partial sequence inhibits hair growth suppressing activity of FGF-5. J. Cell. Physiol. 2003, 197, 272–283. [Google Scholar] [CrossRef]
  10. Oshimori, N.; Fuchs, E. Paracrine TGF-β Signaling Counterbalances BMP-Mediated Repression in Hair Follicle Stem Cell Activation. Cell Stem Cell 2012, 10, 63–75. [Google Scholar] [CrossRef] [PubMed]
  11. Rivera-Gonzalez, G.C.; Shook, B.A.; Andrae, J.; Holtrup, B.; Bollag, K.; Betsholtz, C.; Rodeheffer, M.S.; Horsley, V. Skin Adipocyte Stem Cell Self-Renewal Is Regulated by a PDGFA/AKT-Signaling Axis. Cell Stem Cell 2016, 19, 738–751. [Google Scholar] [CrossRef]
  12. Botchkarev, V.A.; Sharov, A.A. BMP signaling in the control of skin development and hair follicle growth. Differentiation 2004, 72, 512–526. [Google Scholar] [CrossRef] [PubMed]
  13. Choi, Y.S.; Zhang, Y.H.; Xu, M.G.; Yang, Y.G.; Ito, M.; Peng, T.; Cui, Z.; Nagy, A.; Hadjantonakis, A.K.; Lang, R.A.; et al. Distinct Functions for Wnt/β-Catenin in Hair Follicle Stem Cell Proliferation and Survival and Interfollicular Epidermal Homeostasis. Cell Stem Cell 2013, 13, 720–733. [Google Scholar] [CrossRef]
  14. Kandyba, E.; Kobielak, K. Wnt7b Is an Important Intrinsic Regulator of Hair Follicle Stem Cell Homeostasis and Hair Follicle Cycling. Stem Cells 2014, 32, 886–901. [Google Scholar] [CrossRef]
  15. Kobielak, K.; Stokes, N.; de la Cruz, J.; Polak, L.; Fuchs, E. Loss of a quiescent niche but not follicle stem cells in the absence of bone morphogenetic protein signaling. Proc. Natl. Acad. Sci. USA 2007, 104, 10063–10068. [Google Scholar] [CrossRef]
  16. Zhang, L. Keratins in Skin Epidermal Development and Diseases. In Keratin; Blumenberg, M., Ed.; IntechOpen: London, UK, 2018. [Google Scholar]
  17. Langbein, L.; Schweizer, J. Keratins of the human hair follicle. Int. Rev. Cytol. 2005, 243, 1–78. [Google Scholar] [CrossRef]
  18. Rogers, M.A.; Langbein, L.; Praetzel-Wunder, S.; Winter, H.; Schweizer, J. Human hair keratin-associated proteins (KAPs). Int. Rev. Cytol. 2006, 251, 209–263. [Google Scholar] [CrossRef] [PubMed]
  19. Shimomura, Y.; Ito, M. Human hair keratin-associated proteins. J. Investig. Dermatol. Symp. Proc. 2005, 10, 230–233. [Google Scholar] [CrossRef] [PubMed]
  20. Marshall, R.C.; Orwin, D.F.; Gillespie, J.M. Structure and biochemistry of mammalian hard keratin. Electron. Microsc. Rev. 1991, 4, 47–83. [Google Scholar] [CrossRef]
  21. Wu, D.D.; Irwin, D.M. Evolution of Trichocyte Keratin Associated Proteins. Adv. Exp. Med. Biol. 2018, 1054, 47–56. [Google Scholar] [CrossRef]
  22. Khan, I.; Maldonado, E.; Vasconcelos, V.; O’Brien, S.J.; Johnson, W.E.; Antunes, A. Mammalian keratin associated proteins (KRTAPs) subgenomes: Disentangling hair diversity and adaptation to terrestrial and aquatic environments. BMC Genom. 2014, 15, 779. [Google Scholar] [CrossRef]
  23. Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef]
  24. Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef]
  25. Liao, Y.; Smyth, G.K.; Shi, W. featureCounts: An efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 2014, 30, 923–930. [Google Scholar] [CrossRef]
  26. Chen, Y.; Chen, L.; Lun, A.T.L.; Baldoni, P.L.; Smyth, G.K. edgeR v4: Powerful differential analysis of sequencing data with expanded functionality and improved support for small counts and larger datasets. Nucleic Acids Res. 2025, 53, gkaf018. [Google Scholar] [CrossRef] [PubMed]
  27. Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef] [PubMed]
  28. Mi, H.; Muruganujan, A.; Huang, X.; Ebert, D.; Mills, C.; Guo, X.; Thomas, P.D. Protocol Update for large-scale genome and gene function analysis with the PANTHER classification system (v.14.0). Nat. Protoc. 2019, 14, 703–721. [Google Scholar] [CrossRef]
  29. Fernandez-Guerrero, M.; Yakushiji-Kaminatsui, N.; Lopez-Delisle, L.; Zdral, S.; Darbellay, F.; Perez-Gomez, R.; Bolt, C.C.; Sanchez-Martin, M.A.; Duboule, D.; Ros, M.A. Mammalian-specific ectodermal enhancers control the expression of Hoxc genes in developing nails and hair follicles. Proc. Natl. Acad. Sci. USA 2020, 117, 30509–30519. [Google Scholar] [CrossRef] [PubMed]
  30. Qiu, W.; Lei, M.; Tang, H.; Yan, H.; Wen, X.; Zhang, W.; Tan, R.; Wang, D.; Wu, J. Hoxc13 is a crucial regulator of murine hair cycle. Cell Tissue Res. 2016, 364, 149–158. [Google Scholar] [CrossRef]
  31. Roy, S.; Mehta, D.; Paradkar, A.; Chovatiya, G.; Waghmare, S.K. Dab2 (Disabled-2), an adaptor protein, regulates self-renewal of hair follicle stem cells. Commun. Biol. 2024, 7, 525. [Google Scholar] [CrossRef]
  32. Lin, K.K.; Chudova, D.; Hatfield, G.W.; Smyth, P.; Andersen, B. Identification of hair cycle-associated genes from time-course gene expression profile data by using replicate variance. Proc. Natl. Acad. Sci. USA 2004, 101, 15955–15960. [Google Scholar] [CrossRef]
  33. Wang, X.; Xu, H.R.; Li, T.; Qu, L.; Zhao, Z.D.; Zhang, Z.Y. Expression analysis of KAP9.2 and Hoxc13 genes during different cashmere growth stages by qRT-PCR method. Mol. Biol. Rep. 2014, 41, 5665–5668. [Google Scholar] [CrossRef]
  34. Azzi, L.; El-Alfy, M.; Martel, C.; Labrie, F. Gender differences in mouse skin morphology and specific effects of sex steroids and dehydroepiandrosterone. J. Investig. Dermatol. 2005, 124, 22–27. [Google Scholar] [CrossRef]
  35. Plowman, J.E.; Harland, D.P.; Deb-Choudhury, S. The Hair Fibre: Proteins, Structure and Development; Springer: Singapore, 2018; Volume 1054, pp. V–Vi. [Google Scholar] [CrossRef]
  36. Wang, S.H.; Luo, Z.X.; Zhang, Y.L.; Yuan, D.; Ge, W.; Wang, X. The inconsistent regulation of HOXC13 on different keratins and the regulation mechanism on HOXC13 in cashmere goat (Capra hircus). BMC Genom. 2018, 19, 630. [Google Scholar] [CrossRef]
  37. Jonker, L.; Kist, R.; Aw, A.; Wappler, I.; Peters, H. Pax9 is required for filiform papilla development and suppresses skin-specific differentiation of the mammalian tongue epithelium. Mech. Dev. 2004, 121, 1313–1322. [Google Scholar] [CrossRef] [PubMed]
  38. Guo, Y.; Redmond, C.J.; Leacock, K.A.; Brovkina, M.V.; Ji, S.; Jaskula-Ranga, V.; Coulombe, P.A. Keratin 14-dependent disulfides regulate epidermal homeostasis and barrier function via 14-3-3sigma and YAP1. elife 2020, 9, e53165. [Google Scholar] [CrossRef]
  39. Pruett, N.D.; Tkatchenko, T.V.; Jave-Suarez, L.; Jacobs, D.F.; Potter, C.S.; Tkatchenko, A.V.; Schweizer, J.; Awgulewitsch, A. Krtap16, characterization of a new hair keratin-associated protein (KAP) gene complex on mouse chromosome 16 and evidence for regulation by Hoxc13. J. Biol. Chem. 2004, 279, 51524–51533. [Google Scholar] [CrossRef] [PubMed]
  40. Tong, X.; Coulombe, P.A. Keratin 17 modulates hair follicle cycling in a TNFalpha-dependent fashion. Genes Dev. 2006, 20, 1353–1364. [Google Scholar] [CrossRef] [PubMed]
  41. Fischer, H.; Langbein, L.; Reichelt, J.; Praetzel-Wunder, S.; Buchberger, M.; Ghannadan, M.; Tschachler, E.; Eckhart, L. Loss of keratin K2 expression causes aberrant aggregation of K10, hyperkeratosis, and inflammation. J. Investig. Dermatol. 2014, 134, 2579–2588. [Google Scholar] [CrossRef]
  42. Kishimoto, J.; Burgeson, R.E.; Morgan, B.A. Wnt signaling maintains the hair-inducing activity of the dermal papilla. Genes Dev. 2000, 14, 1181–1185. [Google Scholar] [CrossRef]
  43. Enshell-Seijffers, D.; Lindon, C.; Kashiwagi, M.; Morgan, B.A. Beta-catenin activity in the dermal papilla regulates morphogenesis and regeneration of hair. Dev. Cell 2010, 18, 633–642. [Google Scholar] [CrossRef]
  44. Yang, Z.; Cui, K.; Zhang, Y.Y.; Deng, X.M. Transcriptional regulation analysis and the potential transcription regulator site in the extended KAP6.1 promoter in sheep. Mol. Biol. Rep. 2014, 41, 6089–6096. [Google Scholar] [CrossRef] [PubMed]
  45. Zhao, Z.C.; Liu, G.B.; Li, X.Y.; Huang, J.; Xiao, Y.J.; Du, X.Y.; Yu, M. Characterization of the Promoter Regions of Two Sheep Keratin-Associated Protein Genes for Hair Cortex-Specific Expression. PLoS ONE 2016, 11, e0153936. [Google Scholar] [CrossRef] [PubMed]
  46. Inoue, S.; Nambu, T.; Shimomura, T. The RAIG family member, GPRC5D, is associated with hard-keratinized structures. J. Investig. Dermatol. 2004, 122, 565–573. [Google Scholar] [CrossRef]
  47. Gao, Y.; Wang, X.; Yan, H.; Zeng, J.; Ma, S.; Niu, Y.; Zhou, G.; Jiang, Y.; Chen, Y. Comparative Transcriptome Analysis of Fetal Skin Reveals Key Genes Related to Hair Follicle Morphogenesis in Cashmere Goats. PLoS ONE 2016, 11, e0151118. [Google Scholar] [CrossRef]
  48. Wang, Q.X.; Oh, J.W.; Lee, H.L.; Dhar, A.; Peng, T.; Ramos, R.; Guerrero-Juarez, C.F.; Wang, X.J.; Zhao, R.; Cao, X.L.; et al. A multi-scale model for hair follicles reveals heterogeneous domains driving rapid spatiotemporal hair growth patterning. elife 2017, 6, e22772. [Google Scholar] [CrossRef] [PubMed]
  49. Kirkpatrick, M.; Barton, N. Chromosome inversions, local adaptation and speciation. Genetics 2006, 173, 419–434. [Google Scholar] [CrossRef]
  50. Hager, E.R.; Harringmeyer, O.S.; Wooldridge, T.B.; Theingi, S.; Gable, J.T.; McFadden, S.; Neugeboren, B.; Turner, K.M.; Jensen, J.D.; Hoekstra, H.E. A chromosomal inversion contributes to divergence in multiple traits between deer mouse ecotypes. Science 2022, 377, 399–405. [Google Scholar] [CrossRef]
  51. Harringmeyer, O.S.; Hoekstra, H.E. Chromosomal inversion polymorphisms shape the genomic landscape of deer mice. Nat. Ecol. Evol. 2022, 6, 1965–1979. [Google Scholar] [CrossRef]
  52. Ebling, F.J.G. The Biology of Hair. Dermatol. Clin. 1987, 5, 467–481. [Google Scholar] [CrossRef]
  53. Orasan, M.S.; Roman, I.I.; Coneac, A.; Muresan, A.; Orasan, R.I. Hair loss and regeneration performed on animal models. Clujul Med. 2016, 89, 327–334. [Google Scholar] [CrossRef] [PubMed]
Genes 17 00182 g001
Figure 1. Description of Eh mutation and genotyping method development. (A) Breakpoint-spanning primer design for wild-type and Eh alleles. White arrows denote genes, whereas blue and black arrows indicate primer-binding sites. (B) +/+ yields a single 440 bp amplicon, whereas Eh/+ shows both 440- and 230 bp amplicons. (C) Eh/+ mice show elongated and denser ear hair compared with +/+ littermates.
Figure 1. Description of Eh mutation and genotyping method development. (A) Breakpoint-spanning primer design for wild-type and Eh alleles. White arrows denote genes, whereas blue and black arrows indicate primer-binding sites. (B) +/+ yields a single 440 bp amplicon, whereas Eh/+ shows both 440- and 230 bp amplicons. (C) Eh/+ mice show elongated and denser ear hair compared with +/+ littermates.
Genes 17 00182 g001
Genes 17 00182 g002
Figure 2. Differentially expressed genes (DEGs) and functional enrichment analysis in Eh/+ mice from RNA-seq. RNA-seq was performed on P28 ear tissues from four animals (one male and one female per genotype: Eh/+ and wild-type; n = 2 per genotype). Male and female samples within each genotype were pooled and treated as biological replicates for differential expression analysis. (A) A Manhattan plot showing the distribution and expression changes (log2 fold change (log2FC), FDR < 0.01) of differentially expressed genes across chromosome 15. Red and blue dots represent up-regulated and down-regulated genes, respectively. The gray shaded area highlights the region of the Eh inversion mutation. (B) A magnified view of the Eh inversion region (60–100 Mb) on chromosome 15, with prominent DEGs labeled by their gene names. (C) A volcano plot visualizing the relationship between statistical significance (−log10FDR) and the magnitude of expression change (log2FC) for all expressed genes. Significantly up-regulated genes are shown in red, and down-regulated genes are in blue. The dashed lines indicate the thresholds for significance (FDR < 0.01) and fold change (∣log2FC∣ > 1). (D) Results of Gene Ontology (GO) overrepresentation analysis for Biological Process (BP) terms associated with the identified DEGs. The x-axis represents the enrichment significance, and the color of each point corresponds to the number of genes included in that term.
Figure 2. Differentially expressed genes (DEGs) and functional enrichment analysis in Eh/+ mice from RNA-seq. RNA-seq was performed on P28 ear tissues from four animals (one male and one female per genotype: Eh/+ and wild-type; n = 2 per genotype). Male and female samples within each genotype were pooled and treated as biological replicates for differential expression analysis. (A) A Manhattan plot showing the distribution and expression changes (log2 fold change (log2FC), FDR < 0.01) of differentially expressed genes across chromosome 15. Red and blue dots represent up-regulated and down-regulated genes, respectively. The gray shaded area highlights the region of the Eh inversion mutation. (B) A magnified view of the Eh inversion region (60–100 Mb) on chromosome 15, with prominent DEGs labeled by their gene names. (C) A volcano plot visualizing the relationship between statistical significance (−log10FDR) and the magnitude of expression change (log2FC) for all expressed genes. Significantly up-regulated genes are shown in red, and down-regulated genes are in blue. The dashed lines indicate the thresholds for significance (FDR < 0.01) and fold change (∣log2FC∣ > 1). (D) Results of Gene Ontology (GO) overrepresentation analysis for Biological Process (BP) terms associated with the identified DEGs. The x-axis represents the enrichment significance, and the color of each point corresponds to the number of genes included in that term.
Genes 17 00182 g002
Genes 17 00182 g003
Figure 3. Differential expressions of keratin (Krt) and keratin-associated protein (Krtap) genes from RNA-seq. RNA-seq was performed on P28 ear tissue from four animals (one male and one female per genotype: Eh/+ and +/+). Krt and Krtap genes shown here represent a subset of the transcriptome-wide analysis in Figure 2. (A) Log2 fold change (Log2FC) between Eh/+ and +/+ ear tissues for Krt genes in chromosomes 11 and 15, colored by functional class (hair or epithelial keratins). Positive values denote higher expression in Eh/+, and negative ones vice versa. (B) Log2FC for Krtap genes grouped by chromosome. Horizontal dashed lines indicate twofold difference (|log2FC| = 1), which was determined as non-differential expression.
Figure 3. Differential expressions of keratin (Krt) and keratin-associated protein (Krtap) genes from RNA-seq. RNA-seq was performed on P28 ear tissue from four animals (one male and one female per genotype: Eh/+ and +/+). Krt and Krtap genes shown here represent a subset of the transcriptome-wide analysis in Figure 2. (A) Log2 fold change (Log2FC) between Eh/+ and +/+ ear tissues for Krt genes in chromosomes 11 and 15, colored by functional class (hair or epithelial keratins). Positive values denote higher expression in Eh/+, and negative ones vice versa. (B) Log2FC for Krtap genes grouped by chromosome. Horizontal dashed lines indicate twofold difference (|log2FC| = 1), which was determined as non-differential expression.
Genes 17 00182 g003
Genes 17 00182 g004
Figure 4. Differentially expressed Hoxc genes from RNA-seq. Hoxc gene expression is summarized using the same P28 ear RNA-seq cohort as in Figure 2 (four animals; one male and one female per genotype). Hoxc4, Hoxc5, and Hoxc13 were more highly expressed in Eh/+ mice compared to wild-type ones (*** FDR < 0.001).
Figure 4. Differentially expressed Hoxc genes from RNA-seq. Hoxc gene expression is summarized using the same P28 ear RNA-seq cohort as in Figure 2 (four animals; one male and one female per genotype). Hoxc4, Hoxc5, and Hoxc13 were more highly expressed in Eh/+ mice compared to wild-type ones (*** FDR < 0.001).
Genes 17 00182 g004
Genes 17 00182 g005
Figure 5. Gene expression across the hair cycle of ear hair follicles in ears from RT-qPCR. Anagen (growth phase, ~P15), catagen (regression phase, ~P15–P17), and telogen (resting phase, ~P17–) stages were analyzed at postnatal days P10 (anagen), P14 (catagen), and P28 (telogen). Lines represent group mean −ΔCq values, where ΔCq = Cq(gene) − Cq(Gapdh); larger (less negative) values indicate higher expression. Male and female data were pooled within each genotype. Error bars denote standard deviation across biological replicates. Sample sizes varied by gene and time point (minimum n = 3 per sex). Statistical significance between Eh and WT at each stage is indicated as *** p < 0.001, ** p < 0.01, * p < 0.05, or ns (not significant).
Figure 5. Gene expression across the hair cycle of ear hair follicles in ears from RT-qPCR. Anagen (growth phase, ~P15), catagen (regression phase, ~P15–P17), and telogen (resting phase, ~P17–) stages were analyzed at postnatal days P10 (anagen), P14 (catagen), and P28 (telogen). Lines represent group mean −ΔCq values, where ΔCq = Cq(gene) − Cq(Gapdh); larger (less negative) values indicate higher expression. Male and female data were pooled within each genotype. Error bars denote standard deviation across biological replicates. Sample sizes varied by gene and time point (minimum n = 3 per sex). Statistical significance between Eh and WT at each stage is indicated as *** p < 0.001, ** p < 0.01, * p < 0.05, or ns (not significant).
Genes 17 00182 g005
Table 1. Primer information used to validate DEGs using RT-qPCR.
Table 1. Primer information used to validate DEGs using RT-qPCR.
GeneForward Primer (5′-3′)Reverse Primer (5′-3′)
Car6TGGAGCTATTCAGGGGATGATGCCGTCTTCACGTCGATGGG
Dab2TCATTGCTCGTGATGTGACAGGATCGACGACTAATGGTTCAGC
GapdhTGACCTCAACTACATGGTCTACACTTCCCATTCTCGGCCTTG
Gprc5dTACCATATTGCTACTCCTGGCAAGGCAAAAGTAAGTCCGAAGAG
Krt2GGGCTTCAGTAGCGGTTCAGACTAGAGATGCTCTTGTACCCG
Krt14AGCGGCAAGAGTGAGATTTCTCCTCCAGGTTATTCTCCAGGG
Krt34CTGGAGTGTGAGATCAACACGTATCCACAGCAACTGCCACT
Krt39ATTCACAAGCCCTGCCGTACATGCTCGTAAGAAGAAATGACC
Krt71ATGAGCCGCCAATTCACCTGCTGCCCGGTAGGAGGATGA
Krt81GAACAGAGACTGTGTGAAGGTGTCCCCACATACGACTCCTCC
Krt84GCAGATGTGGAGTCGTGGTAGTTCATTGATCTCGTCCCGT
Krtap4-16CTAACTACCAATCCCGAGGCATCAGGACAACAAAGGTAGGAGG
Krtap22-2ATGTGCTACGGAAACTACTTTGGCTGTAGGCATAGCGAGAGCC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ahn, B.; Choi, H.; Yum, J.; Kim, D.; Lewin, H.; Park, C. Disorganization of Transcriptional Regulation and Alteration of Keratin Family Gene Expression in Hairy Ear Mice. Genes 2026, 17, 182. https://doi.org/10.3390/genes17020182

AMA Style

Ahn B, Choi H, Yum J, Kim D, Lewin H, Park C. Disorganization of Transcriptional Regulation and Alteration of Keratin Family Gene Expression in Hairy Ear Mice. Genes. 2026; 17(2):182. https://doi.org/10.3390/genes17020182

Chicago/Turabian Style

Ahn, Byeongyong, Hojun Choi, Joori Yum, Dayoung Kim, Harris Lewin, and Chankyu Park. 2026. "Disorganization of Transcriptional Regulation and Alteration of Keratin Family Gene Expression in Hairy Ear Mice" Genes 17, no. 2: 182. https://doi.org/10.3390/genes17020182

APA Style

Ahn, B., Choi, H., Yum, J., Kim, D., Lewin, H., & Park, C. (2026). Disorganization of Transcriptional Regulation and Alteration of Keratin Family Gene Expression in Hairy Ear Mice. Genes, 17(2), 182. https://doi.org/10.3390/genes17020182

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop