Next Article in Journal
Transcriptomic Dynamics of Rice Varieties with Differential Cold Tolerance Under Low-Temperature Stress During Grain-Filling Stage
Previous Article in Journal
Muscle Aging Heterogeneity: Genetic and Structural Basis of Sarcopenia Resistance
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Genes
Volume 16
Issue 8
10.3390/genes16080949
genes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Oxidative Stress and Intestinal Transcriptome Changes in Clostridium perfringens Type A-Caused Enteritis in Deer

by
Meihui Wang
1,†,
Qingyun Guo
2,3,†,
Zhenyu Zhong
2,3,
Qingxun Zhang
2,3,
Yunfang Shan
2,3,
Zhibin Cheng
2,3,
Xiao Wang
4,
Yuping Meng
5,
Yulan Dong
1,* and
Jiade Bai
2,3,*
1
Laboratory of Veterinary Anatomy, College of Veterinary Medicine, China Agricultural University, Beijing 100193, China
2
Beijing Milu Ecological Research Center, Beijing 100076, China
3
National Conservation and Research Center for Milu, Beijing 100076, China
4
Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China
5
Beijing Acadamy of Science and Technology, Beijing 100089, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Genes 2025, 16(8), 949; https://doi.org/10.3390/genes16080949
Submission received: 9 July 2025 / Revised: 29 July 2025 / Accepted: 6 August 2025 / Published: 11 August 2025
(This article belongs to the Section Animal Genetics and Genomics)
Browse Figures
Versions Notes

Abstract

Background: Clostridium perfringens (C. perfringens) type A is a major cause of enteritis in farmed and wild deer populations, leading to significant economic losses in the deer industry. This bacterium produces toxins that damage the intestine. Methods: In this study, we performed transcriptome analysis by establishing an intestinal circulation model of the intestines of fallow deer (Dama Dama) inoculated with C. perfringens type A versus those not inoculated with C. perfringens type A. In a further step, we determined the protein content of immunoinflammation-related molecules by ELISA and the antioxidant capacity of the intestine to investigate the molecular mechanisms of C. perfringens type A-induced enteritis. Results: Transcriptome analysis revealed significant enrichment of pathways related to the haematopoietic system, oxidative stress, the immune system and intestinal tight junctions. Additionally, C. perfringens α-toxin enters the intestine and may be recognized by TLR6, activating the immune system, increasing the secretion of various cytokines and inflammasome components, inducing oxidative stress and damaging the intestine. Conclusions: This study provides a comprehensive transcriptomic basis for understanding the selective differential expression of genes in deer enteritis induced by C. perfringens type A and provides a broader guide for finding therapeutic approaches to deer enteritis.

Graphical Abstract

1. Introduction

In deer breeding production, Clostridium perfringens (C. perfringens) enteritis is of concern due to its rapid onset, high mortality rate and economic losses. Infections are more frequent in the intestines of fit young and strong deer, and the incidence is higher in males than in females [1]. Clinical studies revealed that C. perfringens infections are very common in deer, and the isolates are mainly type A, C, D and E [2,3,4]. Deer haemorrhagic enteritis, also known as deer enteritis, is caused by the proliferation of C. perfringens in the intestinal tract. C. perfringens spreads through the intestinal tract of the deer, leading to acute toxaemia, with clinical signs of diarrhoea, convulsions, paralysis and sudden death [5,6,7]. As ruminant livestock, deer are an important part of the agricultural sector in terms of food, hunting and other products [8]. Therefore, deer health, with a specific focus on enteritis caused by C. perfringens, requires additional research attention.
C. perfringens is a gram-positive, anaerobic bacterium that is widely distributed nature, especially in the gastrointestinal tracts of humans and animals [9]. It is an important pathogen that causes different forms of tissue damage through its ability to secrete a wide variety of toxins and enzymes. It is characterized by low incidence (2–8%) but high case fatality rates (up to 100%) [10]. As a result, it can cause a broad array of diseases in various vertebrates. Based on the type of toxin production and pathogenicity, C. perfringens can be classified into seven types from A to G [11]. In general, α-toxin is present in all bacteria, and some bacteria produce enterotoxins that can cause food poisoning. Type B is defined by the production of β-toxin and ε-toxin. In addition, type C produce β-toxin, type D produces ε-toxin, type E produces ι-toxin, type F produces C. perfringens enterotoxin and type G produces necrotic enteritis B-like toxin [9]. These bacteria are capable of causing intestinal diseases in humans and animals, including food poisoning, necrotizing enterocolitis and enteritis [12]. Even though C. perfringens is generally present in the intestine as part of the gut microbiome, in pathological situations, this bacterium can proliferate abnormally, releasing toxins that either act locally or are absorbed into the bloodstream with severe effects on the host [13,14].
C. perfringens acts through the production of toxins, and the study of the effect of C. perfringens toxins is of particular importance to clarify the enteritis caused by C. perfringens in deer. C. perfringens α-toxin (CPA) is a major virulence factor during C. perfringens infection [15] and induces erythrocyte haemolysis in various species by inhibiting erythrocyte differentiation and impairing erythropoiesis [16]. The CPA is a zinc metalloenzyme composed of 370 amino acids that can traverse the cell membrane into the host in the presence of calcium ions [17]. It first hydrolyses phosphatidylcholine (PC) and sphingomyelin (SM) in the plasma membrane and triggers different pathways depending on the cell type involved. For example, in equine erythrocytes, PC cleavage is mainly performed by the intrinsic CPA phospholipase activity [18], whereas sheep erythrocytes containing only trace amounts of PC mainly activate SM metabolism after being affected by CPA [19]. In neutrophils, CPA activates endogenous phospholipase C and phosphorylates PI3K, which in turn phosphorylates PKCθ, MEK1/2, ERK1/2 system and NF-κB, resulting in inflammation and oxidative stress [16]. In other words, the toxin cause further damage to the intestinal barrier and promotes acute exacerbation of inflammation, oxidative stress and apoptosis. This damage leads to a loss of normal intestinal function, resulting in fluid and electrolyte excretion. However, there are huge genetic variations behind this complex process that require additional analysis.
In this study, we aimed to construct an intestinal loop model using milu as a model to investigate the structural and functional changes caused by intestinal inflammation induced by C. perfringens type A infection in milu. Additionally, transcriptomic analysis was used to reveal the molecular mechanisms underlying C. perfringens type A-induced intestinal inflammation in deer, with a focus on its regulatory effects on intestinal barrier function, immune inflammatory pathways and the oxidative stress system, thereby identifying new targets for clinical intervention.

2. Materials and Methods

2.1. Bacterial Strain and Growth Media

C. perfringens type A strain, isolated from milu (Elaphurus davidianus), was obtained from the Beijing Milu Ecological Research Center, and PCR detection of the virulence factors they carried only allowed the CPA gene (Forward: GCTAATGTTACTGCCGTTGA; Reverse: CCTCTGATACATCGTGTAAG) to be detected. It was grown overnight in Fluid Thioglycollate (FTG) medium (Solarbio, Beijing, China) at 37 °C in an anaerobic cabinet (Boxun Industrial Co., Ltd., Shanghai, China). The C. perfringens culture was incubated anaerobically overnight at 37 °C in 10 mL of FTG; then, the bacterial pellets were resuspended in 1 mL of culture supernatant and set aside.

2.2. Animal and Preparation of Loops

The animal experiments were carried out with approval from the Ethics Review Committee of Experimental Animal Welfare and Animal Experimentation of China Agricultural University (approval no. CAU202208112). One 2-month-old male fallow deer was used for the trial. The deer had not been vaccinated against C. perfringens type A and no previous cases of enteritis had been diagnosed in the herd. To establish haemorrhagic enteritis caused by C. perfringens type A, the deer was transferred to a separate animal experimental unit on the day before the experiment and deprived of food and water.
Anaesthesia was performed with xylazine hydrochloride injection (Huamu Animal Health Products Co., Ltd., Jilin, China), and subsequently, a dissection was performed via the linea mediana ventralis and the small intestine was exposed. The intestinal loops were about 3 cm in length and were securely ligated with medical sutures (Jinhuan, Shanghai, China). And a 5 cm gap was left between each of the two intestinal loops to avoid interfering with the blood supply. The intestine was rinsed with saline prior to injection, and 1 mL of FTG or C. perfringens type A (logarithmic growth period, approximately 1.5 × 108 CFU/mL) culture was prepared as specified in Section 2.1 and injected in equal amounts into each intestinal loop (Figure 1). The three intestinal loops injected with FTG were named as controls. The three intestinal loops injected with C. perfringens type A were labelled as the CP group. When injecting the loops, care was taken to avoid over-distension of the loops. Then, the abdominal wall incisions were sutured to the muscle and skin separately to prevent the loss of body temperature, and the animal was deeply anaesthetized throughout the experiment. Seven hours after inoculation, anaesthesia was administered to the animals using xylazine hydrochloride injection, the abdominal cavity was reopened and the small intestine was removed in the order of inoculation. Finally, the deer was euthanized.
After gross analysis, the intestinal tissues were rapidly dissected and rinsed in PBS. Then, part of each loop of intestinal tissues was stored in a −80 °C refrigerator for transcriptional analysis, mRNA analysis and protein analysis. Another part of each loop was transferred to 10% formalin for histological examination.

2.3. Morphologic Analysis

Tissues were removed after 24 h of fixation in 10% formalin solution, rinsed and subjected to histopathological analysis. Intestinal tissue samples after dehydration with ethanol were embedded in paraffin and cut into 5 μm slices. The slices were then stained with a haematoxylin and eosin staining kit (Lab-Test Biotechnology, Beijing, China) and sealed with neutral gum. Finally, photomicrographs were taken using an Aperio CS2 scanner (Leica Biosystems, Wetzlar, Germany).

2.4. RNA Sequencing

Total RNA was isolated from the intestinal segments using Trizol. The intestinal segments were three duplicate samples from the control group and C. perfringens group. The samples of transcription analysis were sequenced by Biomarker Technologies, China (Beijing). After sequencing with Illumina NovaSeq 6000 (Illumina, San Diego, CA, USA), the Clean Data of each sample reached 5.78 GB, and the percentage of Q30 bases was 93.75% and above. Sequence assembly of the Clean Data was performed to obtain the unigene library of the species in Trinity software (version 2.15.0). Complete unigene splicing and functional annotation followed as well as unigene expression quantification, differential analysis and functional enrichment analysis in Diamond software (version 3.12). The relevant RNAseq data is accessed in NCBI and the sample was submitted under accession number PRJNA946184.

2.5. RNA-Seq Data Analysis

The criteria for screening the DEGs were FDR < 0.05 and Fold Change ≥ 2 in the biomarker cloud platform. Then, GO enrichment and KEGG pathway analyses were performed with the “clusterProfiler”, “cowplot” and “org. Hs.eg.db” packages (p-Value < 0.05 and q-Value < 0.05). Furthermore, heatmaps were generated using “pheatmap” package.

2.6. Protein–Protein Interaction (PPI) Network Construction

The PPI network of identified DEGs was constructed using the STRING online database (http://string-db.org, accessed on 8 August 2024). Functional modules in interaction networks were identified using the Markov clustering algorithm. The most stringent protein interaction screening criteria were applied (confidence > 0.9).

2.7. qPCR Validation

To quantify the expression of each mRNA in the intestine, real-time SYBR-Green PCR analysis was performed. Total RNA was isolated with TRIzon Reagent (Thermo Fisher Scientific, Waltham, MA, USA) to remove DNA contamination. The RNA concentration and purity were measured with a NanoDrop One (Thermo Fisher Scientific, Waltham, MA, USA). Afterwards, the total RNA was mixed with HiScript QRTsupermix for qPCR (+gDNA wiper) (Vazyme, Nanjing, China) to synthesize cDNA. The synthetic cDNA was diluted 10-fold and PCR was performed on an ABI SimpliAmp PCR instrument (Applied Biosystems, Foster City, CA, USA). Primers were synthesized by Sangon Biotech (Shanghai, China) Co., Ltd. qPCR was performed with SYBR green master mix (Vazyme, Nanjing, China) using the primers in Table 1. Changes in fluorescence were monitored on an ABI 7500 instrument (Applied Biosystems, Foster City, CA, USA).

2.8. ELISA

First of all, fresh lysis buffer (Cloud-Clone Crop., Wuhan, China) was used to measure the total protein extracted according to the kit instructions. Then the concentrations of IL-1β, IL-4, IL-6, IL-8, IL-22 and TNF-α (Cloud-Clone Crop., Wuhan, China) in the intestine were determined with the kit. The monitoring range of ELISA kit is 15.6~1000 pg/mL for IL-1β, 15.6~1000 pg/mL for IL-4, 7.8~500 pg/mL for IL-6, 15.6~1000 pg/mL for IL-8, 15.6~1000 pg/mL for IL-22 and 7.8~500 pg/mL for TNF-α.

2.9. Intestinal Antioxidant Capacity Test

CAT was detected in the intestine of the deer according to the kits provided by Nanjing Jiancheng Bioengineering Institute (Nanjing, China). GSH, T-AOC and MDA were detected in the intestine of the deer according to the kits provided by Beyotime Biotechnology Co. (Shanghai, China). According to the instructions of the kit, the intestinal proteins were extracted, and added to the assay working solution system, and then the absorbance of the samples was measured by an enzyme marker to calculate the CAT, GSH, T-AOC and MDA contents based on the corresponding equations.

2.10. Statistical Analyses

All experimental results were analyzed in SPSS 20.0 and presented in the form of mean ± standard error of mean (SEM). Figures were generated by GraphPad Prism 8.1 (San Diego, CA, USA) and R Studio (version 4.0.3). The differences between the experimental values of the two groups were assessed using Student’s t-test with the following statistical significance: * p < 0.05; ** p < 0.01; and *** p < 0.001.

3. Results

3.1. Histological Damage of C. perfringens Type A-Infected Intestine

Seven hours after inoculation with C. perfringens type A, the infected intestinal tissue was removed and using histological staining, we were able to visually detect pathological changes in the intestinal loop tissue. Macroscopically, the intestinal loop injected with C. perfringens type A was markedly distended, with thinning of the intestinal wall and a medium amount of gas in the intestinal lumen, which could be palpable and fluctuating in the intestinal tract. In addition, there was a small amount of reddish-brown viscous fluid in the intestine. Histologically, in the control group the intestinal villi were structurally intact (Figure 2A–D) and the intestinal tissue structure was clearly layered, with the mucosal layer, submucosal layer and muscular layer clearly visible (Figure 2I–L). In contrast, the loops of the C. perfringens-treated group (CP group) showed multiple apical epithelial cells of the villi were shed and necrotic (Figure 2E,F), with marked capillary dilation and haemorrhage, which are distinctive features of enteritis caused by C. perfringens type A infection (Figure 2G,H). In addition, we observed a proliferation of connective tissue in the submucosa (Figure 2M,N), with varying numbers of inflammatory cell infiltrates in between (Figure 2O,P). Collectively, these results demonstrate that the normal physiological structure of the intestine of deer is severely disrupted after inoculation with C. perfringens type A and that signs of enteritis, such as haemorrhage and inflammation, are evident.

3.2. C. perfringens Type A Destroys the Related Gene of Intestinal Barrier Immune System and Haematopoietic System

To investigate the molecular mechanisms of C. perfringens type A enteritis, we performed large-scale RNA sequencing of intestinal tissues from control and CP group. First of all, in the principal component analysis (PCA) scatter plot, we found that similar samples grouped, suggesting that the intra-group repeatability was relatively good, while there is a clear differentiation between the two groups (Figure 3A). By comparing the intestinal transcripts of the two groups, 5066 differentially expressed genes (DEGs) were identified, of which 2813 were upregulating DEGs and 2253 were downregulating DEGs (fold change > 2, q < 0.05) (Figure 3B).
To gain a comprehensive understanding of the effect of C. perfringens type A on intestinal genes, we performed gene ontology (GO) enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis of the DEGs (Figure 3C,D). Notably, the tight junction pathway was significantly enriched (p < 0.05) in the comparison of intestines inoculated with or without C. perfringens type A, including bicellular tight junctions and regulation of cell adhesion in the GO analysis and tight junctions in the KEGG analysis. Tight junctions regulate paracellular permeability and have a crucial role in preventing bacterial entry into the intestine by intracellular or paracellular means as well as promoting the composition of the intestinal epithelial barrier [20]. The significant enrichment of tight junctions reaffirmed that C. perfringens type A disrupts the fallow deer intestinal barrier and causes damage to the intestine of deer.
The results showed that these DEGs were also predominantly enriched in several biological processes and related pathways associated with immunity, oxidative stress and haematopoiesis, as revealed by the GO analysis. Among them, IL-8 secretion, immunological synaptic and chemokine activity are immune-related signalling pathways; oxidoreductase activity and scavenger receptor activity are signalling pathways associated with oxidative stress, regulation of haematopoiesis and blood coagulation; and thrombin-activated receptor activity is a signalling pathway associated with the haematopoietic system. In addition, GO analysis revealed that the pathways associated with C. perfringens type A infection such as response to bacterium, NLRP3 and TLR pathways were also found to be predicted to be activated (p < 0.05) (Figure 3C). Interestingly, the results of the KEGG analysis corresponded to the GO analysis, with DEGs enriched in the pathways of natural killer cell-mediated cytotoxicity, chemokine signalling pathways, peroxisome and haematopoietic cell lineages (Figure 3D).
The above results collectively suggest that enteritis induced by C. perfringens type A promotes intestinal barrier damage through multiple pathways, including suppression of the immune system, disruption of the haematopoietic system, promotion of intestinal oxidative stress and disruption of intestinal tight junctions.

3.3. C. perfringens Type A Affects the Intestinal Barrier Function by Reducing Intestinal Tight Junction Protein Expression

To further investigate how C. perfringens type A disrupts the intestinal barrier of deer, we next performed further analysis of the transcriptome results. We found in the GO analysis that the PI3K pathway was enriched, whereas previous studies have shown that PI3K/AKT is further activated by tight junction proteins [21]. Furthermore, among the tight junction pathways activated by the GO analysis and KEGG analysis, the tight junction pathway was significantly enriched in both the GO and KEGG enrichment analysis. Therefore, we used a heatmap to further reveal possible pairs of DEGs in the tight junction pathway (Figure 4A). The results showed that the Claudin family showed a significant decrease in the CP group compared to the control group. Simultaneously, the genes obtained from differential gene heatmap analysis were subjected to protein interactions in STRING. And after hiding the disconnected nodes in the protein network, we found that all claudins, which are mainly distributed in the intestine, were altered and showed significant clustering (Figure 4B). This suggests that C. perfringens type A enters the intestine of deer via PI3K/AKT, disrupting the intestinal barrier by reducing the expression of tight junction proteins, which in turn promotes intestinal injury. To verify the correctness of the transcriptome results, we analyzed the mRNA levels of Claudin3, Claudin8 and Occludin in the transcriptome and found that Claudin3 and Claudin8 expression both decreased, while Occludin increased (Figure 4C). These results were verified by quantitative real-time PCR (qPCR) and were consistent with the trends observed in the transcriptomic analysis.

3.4. C. perfringens Type A Can Be Recognized by TLR6 in the Intestinal Barrier of Deer

To investigate how C. perfringens type A enters the intestine of deer, we analyzed the generated transcriptome data. We performed heatmap enrichment of genes related to the response to bacteria from the GO analysis to further reveal genes that may potentially be specifically responsive to C. perfringens type A (Figure 5A). Afterwards, the genes obtained from the differential gene heatmap analysis were subjected to protein interactions in STRING. And after removing the proteins with a lesser degree of interactions, the results reveal that Tlr6 plays a key role in protein interactions in addition to being elevated in the heatmap (Figure 5B). Previous studies have shown that the ability of toll-like receptors (TLRs) to recognize bacterial cell wall components is thought to play an important role in bacterial–host interactions. And similarly, TLR6 is one of the TLRs capable of recognizing bacteria [22]. Therefore, we propose that C. perfringens type A is initially recognized by Tlr6 upon intestinal entry. Conversely, we found that Tlr4 showed a trend of decrease in the heatmap. In addition, the elevation of the TLR downstream gene Myd88, accompanied by downregulation of Nfκbia and Nfκbib, collectively demonstrate TLR6-mediated induction of inflammatory responses following pathogen recognition (Figure 5A). Analysis of the mRNA levels of related genes also showed a decrease in Tlr4 and an increase in Tlr6 in the intestine in the CP group (Figure 5C).

3.5. Enteritis Caused by C. perfringens Type A Promotes the Expression of Immunoinflammation-Related Proteins

Pathogens trigger an inflammatory process that damages the tight junctions, thereby disrupting the intestinal barrier [23]. Based on the results of the histological and transcriptomic analyses, it was known that C. perfringens type A inoculation triggered an inflammatory and immune response in the deer intestine after enteritis. To investigate, we performed mRNA and protein-level assays of immunoinflammation-related pathways by the Enzyme-linked Immunosorbent Assay (ELISA). The study showed that the TLR signalling pathway leads to activation of NF-κB, which in turn leads to upregulation of pro-inflammatory factors, such as IL-1β, 6 and TNF-α [24]. Therefore, we found that both genes and proteins of the interleukin family (IL-1β, IL-4, IL-6 and IL-22) were significantly upregulated in the CP group and that protein levels of IL-8 tended to increase in the CP group (Figure 6). In addition, the mRNA levels of both Nf-κb and Nlrp3 inflammasome were significantly elevated, demonstrating that C. perfringens type A triggers intestinal inflammation. The results suggest that C. perfringens type A damages the intestine and induces enteritis mainly by promoting immunoinflammation-related proteins.

3.6. Effect of C. perfringens Type A Infection on the Intestinal Antioxidant Capacity of Deer

Studies have shown that C. perfringens type A mediated an increase in reactive oxygen species (ROS) content and a decrease in cellular antioxidant capacity in intestinal epithelial cells [25]. This is supported by our transcriptome results for significant enrichment of oxidoreductase activity and scavenger receptor activity in the GO analysis and peroxisome pathway in the KEGG analysis. To assess the level of intestinal antioxidant capacity and to validate the results of transcriptome analysis, total antioxidant capacity (T-AOC), catalase (CAT), malondialdehyde (MDA) and glutathione (GSH) were measured in the intestine before and after C. perfringens type A infection using antioxidant kits. The T-AOC is widely used to assess the total antioxidant capacity of all antioxidants in a sample and reflects, to some extent, the total ability of the body to scavenge reactive oxygen species/nitric oxide synthase (ROS/NOS). Also, CAT and GSH both have antioxidant activity of substances, and conversely, MDA reflects the level of lipid oxidation. We found that T-AOC, CAT and GSH levels were significantly lower (Figure 7A–C) and MDA levels were significantly higher (Figure 7D) in the intestine inoculated with C. perfringens type A compared to the control intestine. The results indicated that the deer intestinal antioxidant enzyme activity was reduced and lipid oxidation was increased, and the total antioxidant capacity of the intestine was significantly decreased after inoculation with C. perfringens.

4. Discussion

C. perfringens type A is one of the main pathogens causing enteritis in various animals [26,27]. However, the network of genetic changes in the intestines of animals caused by C. perfringens type A is poorly understood due to the complexity of the intestinal transcriptome in pathological states [28]. This is a major obstacle to identifying the molecular mechanisms associated with C. perfringens type A-induced enteritis in deer. Here, we explored the structural and functional changes in the intestine caused by enteritis in deer intestinal infections of C. perfringens type A, by constructing an intestinal loop model. The results revealed that the normal structure of the deer intestine is strongly affected by C. perfringens type A infection, with significant downregulation of intestinal tight junction protein expression, contributing to inflammation and loss of intestinal epithelial barrier integrity. As shown in previous studies, TLR6 was activated in the intestinal tissues in response to bacteria in this experimental infection, promoting increased release of immune inflammatory markers [29]. In our study, the intestine of the deer also showed haemorrhage, consistent with enrichment of pathways associated with the haematopoietic system. Additionally, the upregulation of oxidative stress markers in the intestine and the downregulation of antioxidant capacity, along with decreased immune function and impaired barrier function, further confirm the negative effects of C. perfringens type A on intestinal health. By comparing C. perfringens type A-induced enteritis with the normal intestinal transcriptome, this experiment reveals how C. perfringens type A induces enteritis in deer through the immune system, the haematopoietic system, intestinal tight junction proteins and oxidative stress, providing a new target for the treatment of the disease.
Firstly, we replicated enteritis in deer by inoculating C. perfringens type A strains isolated from cases of deer enteritis into the intestinal loop. This model has been used extensively in the laboratory because of its ability to preserve the intact neural and vascular system of the intestinal environment [30,31,32]. Compared to the introduction of C. perfringens into the intestine by oral administration or enteral instillation [33], the enterocyclic model in ruminants can be studied in a single animal, thus reducing the number of experimental animals and facilitating experimenter handling. Nevertheless, all intestinal treatments were performed on the same deer, which limits the generalizability of the results and statistical inference. To address this limitation, our approach was guided by two key considerations: (1) given that deer are large animals, subject to stringent ethical constraints and resource acquisition challenges, this protocol specifically aimed to minimize animal use; and (2) the core objective was to directly compare the effects and potential interactions of different treatments on the intestines in real time within the same, strictly controlled physiological system. This design was essential to eliminate confounding effects arising from significant inter-individual variability.
Previous clinical trials have shown that C. perfringens type A is capable of causing intestinal disease in ruminants, rabbits and chicks. Infection of ruminants with C. perfringens type A may lead to diseases such as enteritis. The pathological changes in the intestinal tract are relatively complex, as follows: mild cicatricial inflammation in the small intestine, or haemorrhagic enteritis changes where the intestine is filled with fresh blood-like material, and in severe cases, lesions such as congestion and oedema in the large intestine may occur [1,34]. In addition, infection of ruminants with C. perfringens type A may cause acute or most acute cases with a short course and rapid death [5,35]. Compared to C. perfringens type A, the pathological signs of infection in the intestine with other types of C. perfringens can differ between different animals. When post-infected with C. perfringens type C, necrotic or necrohaemorrhagic lesions were observed in the small intestine and colon of horses [36], while in sheep and cattle, infection of sheep with C perfringens types B and C can lead to similar intestinal lesions, with enteritis manifesting as diffuse or multifocal haemorrhagic and necrotic enteritis, mainly in the ileum [37]. When piglets are infected with C. perfringens type C, pathological changes such as tissue necrosis and haemorrhage occur in the intestines, mainly in the jejunum, and in some cases in the ileum [38]. In the present study, deer intestines showed the hallmark pathological signs of enteritis, such as haemorrhage and necrosis (Figure 1). In addition, our results are consistent with previous reports that acute bacterial infections are primarily characterized by neutrophil infiltration [39]. In contrast, pathological analysis in this experiment revealed that C. perfringens type A infection of the intestine disrupts the original structure of the intestine, causing a large number of neutrophil aggregates and promoting an inflammatory response (Figure 1). It should be noted that the use of FTG medium as a control group rather than bacteria in this study may produce confounding effects.
As we all know, the tight junctions of the intestinal epithelial cells are an important part of the intestinal epithelial barrier, which limits paracellular permeability and is the front line of defence against bacterial invasion [40]. However, pathogenic microorganisms inhibit the expression of tight junction proteins such as claudins and occludins and disrupt the integrity of intestinal tight junctions to facilitate the entry of bacterial toxins into internal organs [41,42]. It is known that enterotoxins produced by C. perfringens type A act mainly through Claudin3 and Claudin4 due to the structural match of their binding domains [43]. Similarly, other tight junction proteins were altered directly or indirectly, affecting the normal state of the intestinal barrier [25,44]. In our study, Claudin3 and Claudin8 decreased and Occludin increased after C. perfringens treatment, suggesting that C. perfringens-induced enteritis can partially disrupt intestinal tight junction proteins and increase intestinal permeability (Figure 3A,C). Studies have shown that bacteria induce changes in tight junction proteins through PI3K/AKT, disrupting the integrity of the intestinal barrier and promoting further bacterial infection of the host, resulting in inflammatory responses [21]. In the same way, the significant enrichment of the PI3K binding pathway in the transcriptome results analysis in this study also indicated that C. perfringens disrupts tight junction proteins through the PI3K/AKT pathway and promotes intestinal damage (Figure 3B). Our data confirmed that deer intestinal infection with C. perfringens resulted in a significant reduction in intestinal tight junction proteins, leading to damage of the intestinal barrier, entry of bacterial toxins into the bloodstream and activation of the inflammatory response.
Research has shown that TLRs are critical for bacterial binding to intestinal epithelial cells and that C. perfringens toxins can amplify inflammatory responses and enhance virulence via TLR4 [45,46]. In addition, a study on the host immune response induced by C. perfringens infection in pig ileum indicated that, unlike the jejunum, C. perfringens was able to activate the TLR4/MyD88/NF-κB signalling pathway in the ileum, activating downstream immune-related cytokines [35,47]. However, our results revealed that TLR4 was significantly reduced in the CP group, while TLR6 was significantly increased (Figure 4A,C), possibly as a result of the specific differences between pigs and deer. Although the purpose and efficacy of TLR6 in the C. perfringens-infected jejunum remains to be determined, evidence suggests that TLR6 contributes to the maintenance of a balanced immune environment in intestinal diseases, including aiding the repair of damaged epithelial mucosa, managing intestinal inflammation and intestinal barrier integrity [48]. Dysregulation of TLR6 signalling has also been widely implicated in a range of diseases, such as ulcerative colitis and mild malaria [49]. It was shown that C. perfringens induces monocytes to produce TNF-α, which contributes to epithelial cell detachment [50,51]. Because of their pro-inflammatory and immunomodulatory functions, TNF-α and IL-8 play a key role in the pathogenesis of C. perfringens-induced enteritis [52,53]. Moreover, NLRP3 can also be upregulated by TLRs-induced NF-κB activation and leads to activation of the inflammatory response [54]. Our results demonstrated that C. perfringens can activate TLR6 to induce the synthesis of cytokines such as TNF-α, NLRP3 and interleukins through the MYD88/NF-κB pathway, promoting the development of intestinal inflammation and the activation of the immune system (Figure 4).
Oxidative stress is defined as the result of excessive production and accumulation of ROS in living organisms [55], which leads to structural cellular damage and results in irreparable oxidative damage and cell death [56]. Specifically, ROS targets the intestine and its cell membranes, causing lipid peroxidation, cell membrane disintegration and endothelial cell damage [57,58]. As mentioned earlier, the C. perfringens α-toxin is the most potent extracellular enzyme produced by C. perfringens and is capable of inducing ROS production and cytotoxicity [59]. In particular, it has been reported that after exposure to this toxin, a large amount of mitochondrial ROS was produced, leading to changes in the mitochondrial genome and function, further initiating immune patho-physiological mechanisms [60]. In experiments with LPS-induced intestinal epithelial cells, other studies have indicated that the NF-κB pathway is involved in promoting pro-inflammatory cytokine release and exacerbating oxidative damage [61]. For this reason, animals will scavenge the generated ROS to prevent oxidative stress through a variety of antioxidants, of which the intracellular CAT and GSH are key [62]. Similarly, we observed a decrease in T-AOC, CAT and GSH levels and an increase in MDA levels in the intestine infected with C. perfringens, which indicated that the intestinal antioxidant capacity was reduced (Figure 6).
Our GO and KEGG analysis showed significant activation of oxidative stress pathways, such as oxidoreductase activity and scavenger receptor activity and peroxisome (Figure 4C). Scavenger receptors are involved in the recognition and clearance of pathogens and serve multiple functions in lipid metabolism and oxidative stress, resisting elevated oxidative stress in cells due to lipid peroxidation [63]. This validates the antioxidant assay results and reveals oxidative stress in the intestine due to the damaged defence mechanisms of the antioxidant system. Thus, it is shown that there is a combination of multiple factors that directly or indirectly accelerate the disruption of intestinal tight junctions and C. perfringens type A-induced enteritis in the present study. However, the effects of different C. perfringens toxins on deer are not addressed in the study, which may affect the generalizability of this work. Future work should focus on the effect of different C. perfringens typing on deer intestine and further verify their molecular mechanisms.

5. Conclusions

The present study provides a basis for elucidating a series of responses in the deer intestine following C. perfringens type A inoculation. Here, TLR6 was activated in intestinal tissues in response to bacteria, promoting the increased release of immune markers. At the same time, upregulation of oxidative stress markers and downregulation of antioxidant capacity in the intestine led to decreased immune function and impaired barrier function. Infection also leads to downregulate tight junction proteins via the PI3K/AKT pathway, contributing to inflammation and loss of intestinal epithelial barrier integrity and intestinal haemorrhaging. Our study provides mechanistic insights for the molecular mechanisms of C. perfringens type A-induced enteritis in deer at the transcriptome level and provides a broader guide for exploring C. perfringens type A-induced enteritis and other intestinal diseases.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/genes16080949/s1.

Author Contributions

Q.G., Y.D., J.B. and M.W. designed this study. J.B., Y.D., Q.G., Y.M., X.W., Z.C., Y.S., Z.Z. and Q.Z. provided the resources. Q.G., Y.D. and M.W. wrote the initial draft of the manuscript. Y.D. and Q.G. performed writing reviews and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by Beijing Academy of Science and Technology (grant number BGS202108), Beijing Natural Science Foundation (grant number 6194031) and Beijing Municipal Financial Project (grant number 11000022T000000440845).

Institutional Review Board Statement

The animal experiments were carried out with approval by the Ethics Review Committee of Experimental Animal Welfare and Animal Experimentation of China Agricultural University (approval no. CAU202208112).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this manuscript and its Supplementary Materials are available from the corresponding author upon request.

Acknowledgments

The finalization of this paper is dependent on the comments of all the paper’s authors. We are very appreciative of their contributions to this paper. In addition, transcriptome analysis was performed using BMKCloud (accessed on 8 August 2024).

Conflicts of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Abbreviations

The following abbreviations are used in this manuscript:
C. perfringensClostridium perfringens
CATCatalase
CPAC. perfringens α-toxin
DEG(s)Differentially expressed gene(s)
ELISAEnzyme-linked immunosorbent assay
FTGFluid thioglycollate
GOGene ontology
GSHGlutathione
KEGGKyoto Encyclopedia of Genes and Genomes
MDAMalondialdehyde
PCPhosphatidylcholine
PPIProtein–protein interaction
qPCRQuantitative real-time PCR
ROS/NOSReactive oxygen species/nitric oxide synthase
SMSphingomyelin
T-AOCTotal antioxidant capacity
TLRsToll-like receptors

References

  1. Mohiuddin, M.; Iqbal, Z.; Siddique, A.; Liao, S.; Salamat, M.K.F.; Qi, N.; Din, A.M.; Sun, M. Prevalence, Genotypic and Phenotypic characterization and antibiotic resistance profile of type A and D isolated from feces of sheep (Ovis aries) and goats (Capra hircus) in Punjab, Pakistan. Toxins 2020, 12, 657. [Google Scholar] [CrossRef] [PubMed]
  2. Zhu, Z. Comprehensive Diagnosis and Pathogenicity of Deer Intestinal Toxemia Shandong Area. Master’s Thesis, Qingdao Agricultural University, Qingdao, China, 2019. [Google Scholar]
  3. Qiu, H.; Chen, F.; Leng, X.; Fei, R.; Wang, L. Toxinotyping of Clostridium perfringens fecal isolates of reintroduced Père David’s deer (Elaphurus davidianus) in China. J. Wildl. Dis. 2014, 50, 942–945. [Google Scholar] [CrossRef]
  4. Li, C.X.; Wang, W.H.; Bai, Z.J.; Wang, Z.Y. The enterotoxemia of wild animal ruminant and its prevention and cure. Chin. J. Vet. Med. 2007, 5, 32. [Google Scholar]
  5. Zhong, Z.; Zhang, L.; Xia, J.; Tang, B.; Chen, G. Epidemiological investigation of sudden death of Père David’s deer in the South China Sea in 1999. In Proceedings of the Père David’s Deer Home 20th Anniversary International Academic Symposium, Beijing, China, 17–18 October 2005; Beijing Press: Beijing, China, 2007; pp. 34–37. [Google Scholar]
  6. English, A.W. Enterotoxaemia caused by Clostridium perfringens type D in farmed fallow deer. Aust. Vet. J. 1985, 62, 320. [Google Scholar] [CrossRef] [PubMed]
  7. Zhang, M.; Shi, M.; Fan, M.; Xu, S.; Li, Y.; Zhang, T.; Cha, M.; Liu, Y.; Guo, X.; Chen, Q.; et al. Comparative analysis of gut microbiota ghanges in Père David’s deer populations in Beijing milu park and Shishou, Hubei Province in China. Front. Microbiol. 2018, 9, 1258. [Google Scholar]
  8. Sun, C.H.; Liu, H.Y.; Liu, B.; Yuan, B.D.; Lu, C.H. Analysis of the gut microbiome of wild and captive Père David’s deer. Front. Microbiol. 2019, 10, 2331. [Google Scholar] [CrossRef]
  9. Uzal, F.A.; Freedman, J.C.; Shrestha, A.; Theoret, J.R.; Garcia, J.; Awad, M.M.; Adams, V.; Moore, R.J.; Rood, J.I.; McClane, B.A. Towards an understanding of the role of Clostridium perfringens toxins in human and animal disease. Future Microbiol. 2014, 9, 361–377. [Google Scholar] [CrossRef]
  10. Stevens, D.L.; Aldape, M.J.; Bryant, A.E. Life-threatening clostridial infections. Anaerobe 2012, 18, 254–259. [Google Scholar] [CrossRef]
  11. Hill, K.K.; Smith, T.J. Genetic diversity within Clostridium botulinum serotypes, botulinum neurotoxin gene clusters and toxin subtypes. Curr. Top. Microbiol. Immunol. 2013, 364, 1–20. [Google Scholar]
  12. Freedman, J.C.; Shrestha, A.; McClane, B.A. Clostridium perfringens enterotoxin: Action, genetics, and translational applications. Toxins 2016, 8, 73. [Google Scholar] [CrossRef]
  13. Kiu, R.; Hall, L.J. An update on the human and animal enteric pathogen Clostridium perfringens. Emerg. Microbes Infect. 2018, 7, 141. [Google Scholar] [CrossRef]
  14. Eisler, M.C.; Lee, M.R.; Tarlton, J.F.; Martin, G.B.; Beddington, J.; Dungait, J.A.; Greathead, H.; Liu, J.; Mathew, S.; Miller, H.; et al. Agriculture: Steps to sustainable livestock. Nature 2014, 507, 32–34. [Google Scholar] [CrossRef]
  15. Bryant, A.E. Biology and pathogenesis of thrombosis and procoagulant activity in invasive infections caused by group A streptococci and Clostridium perfringens. Clin. Microbiol. Rev. 2003, 16, 451–462. [Google Scholar] [CrossRef]
  16. Takagishi, T.; Takehara, M.; Seike, S.; Miyamoto, K.; Kobayashi, K.; Nagahama, M. Clostridium perfringens α-toxin impairs erythropoiesis by inhibition of erythroid differentiation. Sci. Rep. 2017, 7, 5217. [Google Scholar] [CrossRef]
  17. Jewell, S.A.; Titball, R.W.; Huyet, J.; Naylor, C.E.; Basak, A.K.; Gologan, P.; Winlove, C.P.; Petrov, P.G. Clostridium perfringens α-toxin interaction with red cells and model membranes. Soft Matter 2015, 11, 7748–7761. [Google Scholar] [CrossRef]
  18. Ochi, S.; Oda, M.; Nagahama, M.; Sakurai, J. Clostridium perfringens α-toxin-induced hemolysis of horse erythrocytes is dependent on Ca2+ uptake. Biochim. Biophys. Acta 2003, 1613, 79–86. [Google Scholar] [CrossRef]
  19. Oda, M.; Matsuno, T.; Shiihara, R.; Ochi, S.; Yamauchi, R.; Saito, Y.; Imagawa, H.; Nagahama, M.; Nishizawa, M.; Sakurai, J. The relationship between the metabolism of sphingomyelin species and the hemolysis of sheep erythrocytes induced by Clostridium perfringens alpha-toxin. J. Lipid Res. 2008, 49, 1039–1047. [Google Scholar] [CrossRef]
  20. Ogbu, C.P.; Roy, S.; Vecchio, A.J. Disruption of claudin-made tight junction barriers by Clostridium perfringens enterotoxin: Insights from structural biology. Cells 2022, 11, 903. [Google Scholar] [CrossRef] [PubMed]
  21. Zhuang, Y.; Wu, H.; Wang, X.; He, J.; He, S.; Yin, Y. Resveratrol attenuates oxidative stress-induced intestinal barrier injury through PI3K/Akt-mediated Nrf2 signaling pathway. Oxid. Med. Cell. Longev. 2019, 2019, 7591840. [Google Scholar] [CrossRef] [PubMed]
  22. Ren, C.; Zhang, Q.; de Haan, B.J.; Zhang, H.; Faas, M.M.; de Vos, P. Identification of TLR2/TLR6 signalling lactic acid bacteria for supporting immune regulation. Sci. Rep. 2016, 6, 34561. [Google Scholar] [CrossRef] [PubMed]
  23. John, L.J.; Fromm, M.; Schulzke, J.D. Epithelial barriers in intestinal inflammation. Antioxid. Redox Signal. 2011, 15, 1255–1270. [Google Scholar] [CrossRef] [PubMed]
  24. Patel, H.; Yong, C.; Navi, A.; Shaw, S.G.; Shiwen, X.; Abraham, D.; Baker, D.M.; Tsui, J.C. Toll-like receptors 2 and 6 mediate apoptosis and inflammation in ischemic skeletal myotubes. Vasc. Med. 2019, 24, 295–305. [Google Scholar] [CrossRef]
  25. Luo, R.; Yang, Q.; Huang, X.; Yan, Z.; Gao, X.; Wang, W.; Xie, K.; Wang, P.; Gun, S. Clostridium perfringens beta2 toxin induced in vitro oxidative damage and its toxic assessment in porcine small intestinal epithelial cell lines. Gene 2020, 759, 144999. [Google Scholar] [CrossRef]
  26. Songer, J.G. Clostridial enteric diseases of domestic animals. Clin. Microbiol. Rev. 1996, 9, 216–234. [Google Scholar] [CrossRef]
  27. Uzal, F.A.; Navarro, M.A.; Li, J.; Freedman, J.C.; Shrestha, A.; McClane, B.A. Comparative pathogenesis of enteric clostridial infections in humans and animals. Anaerobe 2018, 53, 11–20. [Google Scholar] [CrossRef]
  28. Mackintosh, C.G.; Griffin, J.F.; Scott, I.C.; O’Brien, R.; Stanton, J.L.; MacLean, P.; Brauning, R. SOLiD SAGE sequencing shows differential gene expression in jejunal lymph node samples of resistant and susceptible red deer (Cervus elaphus) challenged with Mycobacterium avium subsp. paratuberculosis. Vet. Immunol. Immunopathol. 2016, 169, 102–110. [Google Scholar] [CrossRef]
  29. Choteau, L.; Vancraeyneste, H.; Le Roy, D.; Dubuquoy, L.; Romani, L.; Jouault, T.; Poulain, D.; Sendid, B.; Calandra, T.; Roger, T.; et al. Role of TLR1, TLR2 and TLR6 in the modulation of intestinal inflammation and Candida albicans elimination. Gut Pathog. 2017, 9, 9. [Google Scholar] [CrossRef]
  30. Sayeed, S.; Uzal, F.A.; Fisher, D.J.; Saputo, J.; Vidal, J.E.; Chen, Y.; Gupta, P.; Rood, J.I.; McClane, B.A. Beta toxin is essential for the intestinal virulence of Clostridium perfringens type C disease isolate CN3685 in a rabbit ileal loop model. Mol. Microbiol. 2008, 67, 15–30. [Google Scholar] [CrossRef] [PubMed]
  31. Valgaeren, B.; Pardon, B.; Goossens, E.; Verherstraeten, S.; Schauvliege, S.; Timbermont, L.; Ducatelle, R.; Deprez, P.; Van Immerseel, F. lesion development in a new intestinal loop model indicates the involvement of a shared Clostridium perfringens virulence factor in haemorrhagic enteritis in calves. J. Comp. Pathol. 2013, 149, 103–112. [Google Scholar] [CrossRef]
  32. Goossens, E.; Verherstraeten, S.; Valgaeren, B.R.; Pardon, B.; Timbermont, L.; Schauvliege, S.; Rodrigo-Mocholí, D.; Haesebrouck, F.; Ducatelle, R.; Deprez, P.R.; et al. The C-terminal domain of Clostridium perfringens alpha toxin as a vaccine candidate against bovine necrohemorrhagic enteritis. Vet. Res. 2016, 47, 52. [Google Scholar] [CrossRef] [PubMed]
  33. Gerdts, V.; Uwiera, R.R.; Mutwiri, G.K.; Wilson, D.J.; Bowersock, T.; Kidane, A.; Babiuk, L.A.; Griebel, P.J. Multiple intestinal ‘loops’ provide an in vivo model to analyse multiple mucosal immune responses. J. Immunol. Methods 2001, 256, 19–33. [Google Scholar] [CrossRef]
  34. Nowell, V.J.; Kropinski, A.M.; Songer, J.G.; MacInnes, J.I.; Parreira, V.R.; Prescott, J.F. Genome sequencing and analysis of a type A Clostridium perfringens isolate from a case of bovine clostridial abomasitis. PLoS ONE 2012, 7, e32271. [Google Scholar] [CrossRef]
  35. Van Kruiningen, H.J.; Nyaoke, C.A.; Sidor, I.F.; Fabis, J.J.; Hinckley, L.S.; Lindell, K.A. Clostridial abomasal disease in Connecticut dairy calves. Can. Vet. J. 2009, 50, 857–860. [Google Scholar]
  36. Diab, S.S.; Kinde, H.; Moore, J.; Shahriar, M.F.; Odani, J.; Anthenill, L.; Songer, G.; Uzal, F.A. Pathology of Clostridium perfringens type C enterotoxemia in horses. Vet Pathol. 2012, 49, 255–263. [Google Scholar] [CrossRef] [PubMed]
  37. Uzal, F.A.; Songer, J.G. Diagnosis of Clostridium perfringens intestinal infections in sheep and goats. J. Vet. Diagn. Investig. 2008, 20, 253–265. [Google Scholar] [CrossRef] [PubMed]
  38. Shi, H.; Huang, X.; Yan, Z.; Yang, Q.; Wang, P.; Li, S.; Sun, W.; Gun, S. Effect of Clostridium perfringens type C on TLR4/MyD88/NF-κB signaling pathway in piglet small intestines. Microb. Pathog. 2019, 135, 103567. [Google Scholar] [CrossRef]
  39. Liang, L.; Wang, Z.J.; Ye, G.; Tang, X.Y.; Zhang, Y.Y.; Kong, J.X.; Du, H.H. Distribution of lactoferrin is related with dynamics of neutrophils in bacterial infected mice intestine. Molecules 2020, 25, 1496. [Google Scholar] [CrossRef] [PubMed]
  40. Allam-Ndoul, B.; Castonguay-Paradis, S.; Veilleux, A. Gut microbiota and intestinal trans-epithelial permeability. Int. J. Mol. Sci. 2020, 21, 6402. [Google Scholar] [CrossRef]
  41. Eichner, M.; Protze, J.; Piontek, A.; Krause, G.; Piontek, J. Targeting and alteration of tight junctions by bacteria and their virulence factors such as Clostridium perfringens enterotoxin. Pflügers Arch. 2017, 469, 77–90. [Google Scholar] [CrossRef]
  42. Xun, W.; Fu, Q.; Shi, L.; Cao, T.; Jiang, H.; Ma, Z. Resveratrol protects intestinal integrity, alleviates intestinal inflammation and oxidative stress by modulating AhR/Nrf2 pathways in weaned piglets challenged with diquat. Int. Immunopharmacol. 2021, 99, 107989. [Google Scholar] [CrossRef]
  43. Katahira, J.; Inoue, N.; Horiguchi, Y.; Matsuda, M.; Sugimoto, N. Molecular cloning and functional characterization of the receptor for Clostridium perfringens enterotoxin. J. Cell Biol. 1997, 136, 1239–1247. [Google Scholar] [CrossRef] [PubMed]
  44. Kimura, J.; Abe, H.; Kamitani, S.; Toshima, H.; Fukui, A.; Miyake, M.; Kamata, Y.; Sugita-Konishi, Y.; Yamamoto, S.; Horiguchi, Y. Clostridium perfringens enterotoxin interacts with claudins via electrostatic attraction. J. Biol. Chem. 2010, 285, 401–408. [Google Scholar] [CrossRef] [PubMed]
  45. Oh, S.T.; Lillehoj, H.S. The role of host genetic factors and host immunity in necrotic enteritis. Avian Pathol. 2016, 45, 313–316. [Google Scholar] [CrossRef]
  46. Takehara, M.; Seike, S.; Sonobe, Y.; Bandou, H.; Yokoyama, S.; Takagishi, T.; Miyamoto, K.; Kobayashi, K.; Nagahama, M. α-toxin impairs granulocyte colony-stimulating factor receptor-mediated granulocyte production while triggering septic shock. Commun. Biol. 2019, 2, 45. [Google Scholar] [CrossRef]
  47. Fitzgerald, K.A.; Kagan, J.C. Toll-like receptors and the control of immunity. Cell 2020, 180, 1044–1066. [Google Scholar] [CrossRef] [PubMed]
  48. Kye, Y.J.; Lee, S.Y.; Kim, H.R.; Lee, B.H.; Park, J.H.; Park, M.S.; Ji, G.E.; Sung, M.K. Lactobacillus acidophilus PIN7 paraprobiotic supplementation ameliorates DSS-induced colitis through anti-inflammatory and immune regulatory effects. J. Appl. Microbiol. 2022, 132, 3189–3200. [Google Scholar] [CrossRef]
  49. Noreen, M.; Arshad, M. Association of TLR1, TLR2, TLR4, TLR6, and TIRAP polymorphisms with disease susceptibility. Immunol. Res. 2015, 62, 234–252. [Google Scholar] [CrossRef]
  50. Williams, J.M.; Duckworth, C.A.; Burkitt, M.D.; Watson, A.J.; Campbell, B.J.; Pritchard, D.M. Epithelial cell shedding and barrier function: A matter of life and death at the small intestinal villus tip. Vet. Pathol. 2015, 52, 445–455. [Google Scholar] [CrossRef]
  51. Guma, M.; Stepniak, D.; Shaked, H.; Spehlmann, M.E.; Shenouda, S.; Cheroutre, H.; Vicente-Suarez, I.; Eckmann, L.; Kagnoff, M.F.; Karin, M. Constitutive intestinal NF-κB does not trigger destructive inflammation unless accompanied by MAPK activation. J. Exp. Med. 2011, 208, 1889–1900. [Google Scholar] [CrossRef]
  52. Oda, M.; Kihara, A.; Yoshioka, H.; Saito, Y.; Watanabe, N.; Uoo, K.; Higashihara, M.; Nagahama, M.; Koide, N.; Yokochi, T.; et al. Effect of erythromycin on biological activities induced by Clostridium perfringens alpha-toxin. J. Pharmacol. Exp. Ther. 2008, 327, 934–940. [Google Scholar] [CrossRef]
  53. Huang, F.C. The interleukins orchestrate mucosal immune responses to Salmonella infection in the intestine. Cells 2021, 10, 3492. [Google Scholar] [CrossRef]
  54. Kinra, M.; Nampoothiri, M.; Arora, D.; Mudgal, J. Reviewing the importance of TLR-NLRP3-pyroptosis pathway and mechanism of experimental NLRP3 inflammasome inhibitors. Scand. J. Immunol. 2022, 95, e13124. [Google Scholar] [CrossRef]
  55. Chen, J.; Li, Y.; Yu, B.; Chen, D.; Mao, X.; Zheng, P.; Luo, Y.; He, J. Dietary chlorogenic acid improves growth performance of weaned pigs through maintaining antioxidant capacity and intestinal digestion and absorption function. J. Anim. Sci. 2018, 96, 1108–1118. [Google Scholar] [CrossRef]
  56. Yin, J.; Wu, M.M.; Xiao, H.; Ren, W.K.; Duan, J.L.; Yang, G.; Li, T.J.; Yin, Y.L. Development of an antioxidant system after early weaning in piglets. J. Anim. Sci. 2014, 92, 612–619. [Google Scholar] [CrossRef] [PubMed]
  57. Hao, Y.; Xing, M.; Gu, X. Research progress on oxidative stress and its nutritional regulation strategies in pigs. Animals 2021, 11, 1384. [Google Scholar] [CrossRef] [PubMed]
  58. Luo, L.; Zang, G.; Liu, B.; Qin, X.; Zhang, Y.; Chen, Y.; Zhang, H.; Wu, W.; Wang, G. Bioengineering CXCR4-overexpressing cell membrane functionalized ROS-responsive nanotherapeutics for targeting cerebral ischemia-reperfusion injury. Theranostics 2021, 11, 8043–8056. [Google Scholar] [CrossRef] [PubMed]
  59. Monturiol-Gross, L.; Flores-Díaz, M.; Pineda-Padilla, M.J.; Castro-Castro, A.C.; Alape-Girón, A. Clostridium perfringens phospholipase C induced ROS production and cytotoxicity require PKC, MEK1 and NF-κB activation. PLoS ONE 2014, 9, e86475. [Google Scholar] [CrossRef] [PubMed]
  60. Bunkar, N.; Sharma, J.; Chouksey, A.; Kumari, R.; Gupta, P.K.; Tiwari, R. Clostridium perfringens phospholipase C impairs innate immune response by inducing integrated stress response and mitochondrial-induced epigenetic modifications. Cell. Signal. 2020, 75, 109776. [Google Scholar] [CrossRef] [PubMed]
  61. Zhou, M.; Xu, W.; Wang, J.; Yan, J.; Shi, Y.; Zhang, C.; Ge, W.; Wu, J.; Du, P.; Chen, Y. Boosting mTOR-dependent autophagy via upstream TLR4-MyD88-MAPK signalling and downstream NF-κB pathway quenches intestinal inflammation and oxidative stress injury. eBioMedicine 2018, 35, 345–360. [Google Scholar] [CrossRef]
  62. Ali, S.S.; Ahsan, H.; Zia, M.K.; Siddiqui, T.; Khan, F.H. Understanding oxidants and antioxidants: Classical team with new players. J. Food Biochem. 2020, 44, e13145. [Google Scholar] [CrossRef]
  63. Zhang, X.; Fan, J.; Li, H.; Chen, C.; Wang, Y. CD36 signaling in diabetic cardiomyopathy. Aging Dis. 2021, 12, 826–840. [Google Scholar] [CrossRef] [PubMed]
Genes 16 00949 g001
Figure 1. Process of Clostridium perfringens infection in an intestinal loop model. The jejunum of the deer is exposed by laparotomy and separated by ligation, leaving an empty segment of intestine between the loops. An equal amount of logarithmic growth phase C. perfringens culture was injected into each intestinal loop. At the end of the procedure, the intestinal loops were placed back into the abdominal cavity and the abdominal incision was closed with sutures to the muscle and skin, respectively. After 7 h, the intestine was removed again and the C. perfringens-injected intestinal segment appeared congested (brown intestinal loops in the figure) as CP group.
Figure 1. Process of Clostridium perfringens infection in an intestinal loop model. The jejunum of the deer is exposed by laparotomy and separated by ligation, leaving an empty segment of intestine between the loops. An equal amount of logarithmic growth phase C. perfringens culture was injected into each intestinal loop. At the end of the procedure, the intestinal loops were placed back into the abdominal cavity and the abdominal incision was closed with sutures to the muscle and skin, respectively. After 7 h, the intestine was removed again and the C. perfringens-injected intestinal segment appeared congested (brown intestinal loops in the figure) as CP group.
Genes 16 00949 g001
Genes 16 00949 g002
Figure 2. Histopathology of the intestinal tract after inoculation with C. perfringens. Haematoxylin–eosin staining showed intestinal structures. (A–D,I–L) Representative tissue sections of intestinal segments not inoculated with C. perfringens. The intestine was well organized and structurally hierarchical in the control group. (E–H) Representative histological sections of intestine injected with C. perfringens strain to the mucosal layer showing villi haemorrhage and necrosis. (M–P) Representative histological sections of the mucosal and submucosal layers of the intestine injected with C. perfringens strains, showing inflammatory cell infiltration in the intestine. The arrow represents necrosis, the triangle represents haemorrhage and the star represents inflammatory cell infiltration in figures. Size bars/magnifications: (A,C,E,G,I,K,M,O) = 100 μm/×100; (B,D,F,H,J,L,N,P) = 25 μm/×400.
Figure 2. Histopathology of the intestinal tract after inoculation with C. perfringens. Haematoxylin–eosin staining showed intestinal structures. (A–D,I–L) Representative tissue sections of intestinal segments not inoculated with C. perfringens. The intestine was well organized and structurally hierarchical in the control group. (E–H) Representative histological sections of intestine injected with C. perfringens strain to the mucosal layer showing villi haemorrhage and necrosis. (M–P) Representative histological sections of the mucosal and submucosal layers of the intestine injected with C. perfringens strains, showing inflammatory cell infiltration in the intestine. The arrow represents necrosis, the triangle represents haemorrhage and the star represents inflammatory cell infiltration in figures. Size bars/magnifications: (A,C,E,G,I,K,M,O) = 100 μm/×100; (B,D,F,H,J,L,N,P) = 25 μm/×400.
Genes 16 00949 g002
Genes 16 00949 g003
Figure 3. Transcriptional profile of the intestine after inoculation with C. perfringens. (A) Principal component analysis of the transcriptome (n = 3) of intestinal loops infected with C. perfringens. (B) Volcano plot shows gene expression analysis with upregulated genes in red and downregulated genes in green. (C) Bar graph shows GO pathway enrichment analysis of DEGs between intestines inoculated with or without C. perfringens. GO terms are classified into three categories: biological process, cellular component and molecular function. (D) The bubble map shows the pathway enrichment analysis by KEGG analysis of whether the intestine is inoculated with C. perfringens of DEGs. C = Control, CP = C. perfringens.
Figure 3. Transcriptional profile of the intestine after inoculation with C. perfringens. (A) Principal component analysis of the transcriptome (n = 3) of intestinal loops infected with C. perfringens. (B) Volcano plot shows gene expression analysis with upregulated genes in red and downregulated genes in green. (C) Bar graph shows GO pathway enrichment analysis of DEGs between intestines inoculated with or without C. perfringens. GO terms are classified into three categories: biological process, cellular component and molecular function. (D) The bubble map shows the pathway enrichment analysis by KEGG analysis of whether the intestine is inoculated with C. perfringens of DEGs. C = Control, CP = C. perfringens.
Genes 16 00949 g003
Genes 16 00949 g004
Figure 4. Genes significantly altered in the tight junction pathway in C. perfringens-infected intestines. (A) Heatmap showing tight junction genes with different expression. (B) Gene interaction network of genes that will vary in the tight junction pathway produced through the STRING website in the http://string-db.org. And, the genes were clustered, where the red circle proteins were mainly located in the intestine. (C) Changes in Claudin3, Claudin8 and Occludin mRNA levels in the intestine of deer. All results are expressed as mean ± SEM. The level of statistical significance of all data was determined by independent samples t-test. * indicates significant differences compared to the control group, specifically ** p < 0.01 and *** p < 0.001.
Figure 4. Genes significantly altered in the tight junction pathway in C. perfringens-infected intestines. (A) Heatmap showing tight junction genes with different expression. (B) Gene interaction network of genes that will vary in the tight junction pathway produced through the STRING website in the http://string-db.org. And, the genes were clustered, where the red circle proteins were mainly located in the intestine. (C) Changes in Claudin3, Claudin8 and Occludin mRNA levels in the intestine of deer. All results are expressed as mean ± SEM. The level of statistical significance of all data was determined by independent samples t-test. * indicates significant differences compared to the control group, specifically ** p < 0.01 and *** p < 0.001.
Genes 16 00949 g004
Genes 16 00949 g005
Figure 5. Genes altered in the pathway of response to bacterium in the C. perfringens-infected gut. (A) Heatmap showing differential expression of genes in response to bacterium. (B) A partial protein map of the gene interaction network of response to bacterium pathway generated through the STRING website, after removing proteins with lesser degrees of interaction, is available at http://string-db.org. (C) Changes in Tlr4 and Tlr6 mRNA levels in the intestine with C. perfringens infection. All results are expressed as mean ± SEM. The level of statistical significance of all data was determined by independent samples t-test. * indicates significant differences compared to the control group, specifically * p < 0.05 and ** p < 0.01.
Figure 5. Genes altered in the pathway of response to bacterium in the C. perfringens-infected gut. (A) Heatmap showing differential expression of genes in response to bacterium. (B) A partial protein map of the gene interaction network of response to bacterium pathway generated through the STRING website, after removing proteins with lesser degrees of interaction, is available at http://string-db.org. (C) Changes in Tlr4 and Tlr6 mRNA levels in the intestine with C. perfringens infection. All results are expressed as mean ± SEM. The level of statistical significance of all data was determined by independent samples t-test. * indicates significant differences compared to the control group, specifically * p < 0.05 and ** p < 0.01.
Genes 16 00949 g005
Genes 16 00949 g006
Figure 6. Changes in mRNA and protein of immune-related genes in the C. perfringens-infected intestine. (A) Changes in mRNA of Nf-κb, Nlrp3, Il-1β, Il-6, Il-8 and Il-22 in the C. perfringens-infected intestine. (B) Changes in protein of IL-1β, IL-4, IL-6, IL-8, IL-22 and TNF-α in the C. perfringens-infected intestine. All results are expressed as mean ± SEM. The level of statistical significance of all data was determined by independent samples t-test. * indicates significant differences compared to the control group, specifically * p < 0.05, ** p < 0.01 and *** p < 0.001.
Figure 6. Changes in mRNA and protein of immune-related genes in the C. perfringens-infected intestine. (A) Changes in mRNA of Nf-κb, Nlrp3, Il-1β, Il-6, Il-8 and Il-22 in the C. perfringens-infected intestine. (B) Changes in protein of IL-1β, IL-4, IL-6, IL-8, IL-22 and TNF-α in the C. perfringens-infected intestine. All results are expressed as mean ± SEM. The level of statistical significance of all data was determined by independent samples t-test. * indicates significant differences compared to the control group, specifically * p < 0.05, ** p < 0.01 and *** p < 0.001.
Genes 16 00949 g006
Genes 16 00949 g007
Figure 7. Effect of C. perfringens infection on antioxidant capacity in the intestine. Changes in intestinal antioxidant capacity following C. perfringens infection of the intestine were assessed by measuring T-AOC, CAT, GSH and MDA levels in the intestine using commercial kits. All results are expressed as mean ± SEM. The level of statistical significance of all data was determined by independent samples t-test. * indicates significant differences compared to the control group, specifically * p < 0.05 and *** p < 0.001.
Figure 7. Effect of C. perfringens infection on antioxidant capacity in the intestine. Changes in intestinal antioxidant capacity following C. perfringens infection of the intestine were assessed by measuring T-AOC, CAT, GSH and MDA levels in the intestine using commercial kits. All results are expressed as mean ± SEM. The level of statistical significance of all data was determined by independent samples t-test. * indicates significant differences compared to the control group, specifically * p < 0.05 and *** p < 0.001.
Genes 16 00949 g007
Table 1. Primers used in this study.
Table 1. Primers used in this study.
PrimerDirectionSequences (5′ to 3′)
Claudin3ForwardGAGGGCCTGTGGATGAACTG
Claudin3ReverseGAAGACGGCCAGTAGGATGG
Claudin8ForwardAAAACTGCTCTCCCTCGGTG
Claudin8ReverseGGCGTAGGTAGCCATTCTCC
OccludinForwardAATAGTGAACGCCGTCCTGG
OccludinReverseGGTCTGGGCAGTTGGATTGA
Tlr4ForwardCTCCTGCCTGAGATCCGAGA
Tlr4ReverseAGGTCCAGCATCTTGGTTGTT
Tlr6ForwardTGCTGATTACAGTGGATGTTGTG
Tlr6ReverseAACTGACCCCAAGGCTGATG
Nf-κbForwardTTGGCAACAACACTGACCCT
Nf-κbReverseCCATGGGTACACCCTGGTTC
Nlrp3ForwardTTCCCATCAGTGCTGCTTCA
Nlrp3ReverseGGCCAGAATTCACCAACCAG
Il-1βForwardCTGTGGCCTTGGGTATCAGG
Il-1βReverseGCCACCTCTAAAACGTCCCA
Il-6ForwardACGAGTGGGTAAAGAACGCA
Il-6ReverseGGAATGCCCAGGAACTACCA
Il-8ForwardGACCCCAAGGAAAAGTGGGT
Il-8ReverseCCACACAGTACTCAAGGCACT
Il-22ForwardACCCTGAAACGTGAATGTGC
Il-22ReverseAGGACTGTGGAGTTTGGCTT
GapdhForwardGAGCACGAGAGGAAGAGAGTT
GapdhReverseTTGGGGATGGAAACTGTGGA
Among these, Gapdh was used as the housekeeping gene.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, M.; Guo, Q.; Zhong, Z.; Zhang, Q.; Shan, Y.; Cheng, Z.; Wang, X.; Meng, Y.; Dong, Y.; Bai, J. Oxidative Stress and Intestinal Transcriptome Changes in Clostridium perfringens Type A-Caused Enteritis in Deer. Genes 2025, 16, 949. https://doi.org/10.3390/genes16080949

AMA Style

Wang M, Guo Q, Zhong Z, Zhang Q, Shan Y, Cheng Z, Wang X, Meng Y, Dong Y, Bai J. Oxidative Stress and Intestinal Transcriptome Changes in Clostridium perfringens Type A-Caused Enteritis in Deer. Genes. 2025; 16(8):949. https://doi.org/10.3390/genes16080949

Chicago/Turabian Style

Wang, Meihui, Qingyun Guo, Zhenyu Zhong, Qingxun Zhang, Yunfang Shan, Zhibin Cheng, Xiao Wang, Yuping Meng, Yulan Dong, and Jiade Bai. 2025. "Oxidative Stress and Intestinal Transcriptome Changes in Clostridium perfringens Type A-Caused Enteritis in Deer" Genes 16, no. 8: 949. https://doi.org/10.3390/genes16080949

APA Style

Wang, M., Guo, Q., Zhong, Z., Zhang, Q., Shan, Y., Cheng, Z., Wang, X., Meng, Y., Dong, Y., & Bai, J. (2025). Oxidative Stress and Intestinal Transcriptome Changes in Clostridium perfringens Type A-Caused Enteritis in Deer. Genes, 16(8), 949. https://doi.org/10.3390/genes16080949

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop