Next Article in Journal
Transcriptome Analysis Reveals Key Genes Involved in Fatty Acid and Triacylglycerol Accumulation in Developing Sunflower Seeds
Previous Article in Journal
Ovarian Transcriptome Profile from Egg-Laying Period to Incubation Period of Changshun Green-Shell Laying Hens
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Genes
Volume 16
Issue 4
10.3390/genes16040395
genes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Essay

Association Analysis of ENPP1 Tissue Expression, Polymorphism, and Growth Traits in Xiangsu Pigs

by
Jiaqi Chen
1,2,
Jiajin Huang
1,2 and
Houqiang Xu
1,2,*
1
Key Laboratory of Animal Genetics, Breeding and Reproduction in the Plateau Mountainous Region, Ministry of Education, Guizhou University, Guiyang 550025, China
2
College of Animal Science, Guizhou University, Guiyang 550025, China
*
Author to whom correspondence should be addressed.
Genes 2025, 16(4), 395; https://doi.org/10.3390/genes16040395
Submission received: 5 March 2025 / Revised: 25 March 2025 / Accepted: 28 March 2025 / Published: 29 March 2025
(This article belongs to the Section Animal Genetics and Genomics)
Browse Figures
Versions Notes

Abstract

:
Background: Pigs are vital agricultural animals, with growth traits serving as key indicators of their quality. Methods: In this study, we examined the mRNA expression of ENPP1 as a candidate gene in heart, liver, spleen, lungs, and kidneys at 3 days and 6 months of age by real-time polymerase chain reaction method and single-nucleotide polymorphism (SNP) loci in 165 Xiangsu pigs by Sanger sequencing. Results: The expression of ENPP1 in different tissues of Xiangsu pigs at different stages was significantly different, and it had high conservation in different species.. Sequence alignment with reference data identified five SNP sites: g.64275T→C and g.64429G→A in intron 19, g.64850T→C and g.64911G→A in intron 20, and g.64527T→C in exon 20. Association analysis revealed that g.64275T→C, g.64429G→A, and g.64527T→C significantly influence the growth performance of Xiangsu pigs (p < 0.05). Conclusions: These findings suggest that ENPP1 polymorphisms are closely associated with growth traits in Xiangsu pigs and may provide valuable insights for molecular breeding of this breed.

1. Introduction

Pigs are vital livestock, providing a rich source of meat and serving as a key food resource for humans. Indigenous Chinese pig breeds exhibit unique genetic traits, making them an important part of global germplasm resources [1]. The Congjiang Xiang pig, a small native breed from Guizhou, China, is renowned for its strong resilience and tender, flavorful meat; however, it has relatively slow growth and development. To overcome this limitation, the Xiangsu hybrid pig was developed through successive backcrossing. The Congjiang Xiang pig was used as the maternal line, while the Suzhou Taihu pig served as the paternal line. Subsequent generations were then backcrossed to the Congjiang Xiang pig to maintain the maternal genetic contribution [2]. This hybrid combines the tender, flavorful meat and strong adaptability of the Congjiang Xiang pig with the rapid growth rate and high litter size of the Suzhou Taihu pig [3]. In this study, by using ENPP1 as a candidate gene, detecting mRNA expression in the heart, liver, spleen, lungs, and kidneys at 3 days and 6 months of age by real-time polymerase chain reaction and analyzing the relationship between different genotypes of ENPP1 in Xiangsu crossbred pigs and growth traits at 6 months of age by Sanger sequencing, we identified five SNPs in the ENPP1 gene of Xiangsu pigs and screened them to find out the superior genes or genotypes of superior growth traits and predicted the functions of the ENPP1 gene by using bioinformatics analysis technology. Finally, we carried out a correlation analysis between the growth traits and mutation sites in Xiangsu crossbred pigs, which will provide a theoretical basis for the subsequent investigation of molecular genetic breeding of Xiangsu crossbred pigs.
Ecto-nucleotide pyrophosphatase/phosphodiesterase 1 (ENPP1) is a type II transmembrane protein that belongs to the ecto-nucleotide pyrophosphatase/phosphodiesterase (ENPP) family [4]. To date, seven family members (ENPP1–7) have been identified, all of which share a conserved catalytic core, the phosphodiesterase (PDE) domain [5]. In ENPP1–3, the PDE domain is flanked by two N-terminal auxin-binding protein-like domains and one inactive nuclease domain at the C-terminus. In contrast, ENPP4–7 contain only the PDE domain. Structural variations in the substrate-binding sites confer distinct properties to each protein. Consequently, ENPPs 1, 3, 4, and 5 hydrolyze nucleotides, while ENPPs 2, 6, and 7 have evolved into phosphodiesterases through their catalytic domains [6,7]. As the founding member of the ENPP family, ENPP1 regulates skeletal and soft tissue mineralization by generating inorganic pyrophosphate (PPi). Studies have shown that ENPP1 catalyzes the hydrolysis of ATP or GTP, producing PPi, which subsequently influences bone and cartilage mineralization. This positions ENPP1 as a central regulator of skeletal and cartilage development in mammals [8]. ENPP1 knockout mouse models display severe ectopic calcification and bone defects in multiple tissues, accompanied by the progressive loss of osteocytes [9,10]. Furthermore, ENPP1 functions as an inhibitor in the insulin signaling pathway, modulating biological processes related to obesity and type 2 diabetes (T2D) by influencing insulin resistance (IR) in tissues and cells. Overexpression of ENPP1 in adipocytes has been shown to promote the development of conditions such as fatty liver and hyperlipidemia [11,12,13]. In addition, numerous studies have demonstrated the widespread expression of ENPP1 in tissues, including bone, liver, skeletal muscle, ovaries, and adipose tissue. ENPP1 is essential for purinergic signaling and plays a key role in regulating neuroimmune responses, musculoskeletal functions, hormonal balance, and blood circulation [14,15,16]. In related studies reporting on whole genome resequencing and transcriptome analyses in the Min pig, the results showed that the ENPP1 gene is a candidate gene related to body size variation in Min pigs, but no further studies on ENPP1 gene were seen [17].
Alterations in factors such as selection rather than random mating, migration, mutation and natural selection can result in changes in the genetic balance of a population, and therefore mutations are important for the evolution of populations. Studies have demonstrated that gene polymorphisms and SNP sites regulate the growth and development of animals [18,19]. Investigating the SNP sites and polymorphisms within the ENPP1 gene will provide essential data for further studies on the role of ENPP1 in the growth traits of Xiangsu hybrid pigs. This study is the first to identify five SNPs in the ENPP1 gene of Xiangsu pigs and uses bioinformatics tools to predict the functional implications of these mutations. Finally, a correlation analysis was conducted between the growth traits of Xiangsu hybrid pigs and the identified mutations, laying a theoretical foundation for future molecular genetic breeding of this hybrid pig population.

2. Materials and Methods

2.1. Experimental Animals

The 165 Xiangsu pigs used in this study were provided by the Xiangsu Pig Breeding Farm of Guizhou University and were uniformly fed until 6 months of age, when blood samples were collected and growth traits were measured. The measured traits included withers height, body weight, body length, chest width, chest depth, chest girth, abdominal girth, rib girth, and hind limb girth. Of these, weight was measured on an electronic table scale and the rest of the indicators were measured with a soft tape measure. Blood samples were also collected. Subsequently, three piglets were randomly selected for slaughter from the 165, and tissue samples from the heart, liver, spleen, lungs, and kidneys were collected.
For comparison, a separate group of three healthy 3-day-old piglets from the outside experimental group was selected for slaughter and tissue sample collection, following the same procedures. The experimental animals were provided by the Breeding Pig Farm of Guizhou University, and all procedures were performed in strict accordance with the guidelines of the Guizhou University Animal Welfare Committee (EAE-GZU-2023-E079).

2.2. Whole-Blood DNA, Tissue RNA Extraction, and cDNA Synthesis

Genomic DNA was extracted from the anterior vena cava blood samples of Xiangsu pigs using a DNA extraction kit (Tiangen, Beijing, China). Total RNA was isolated from the heart, liver, spleen, lungs, and kidneys of Xiangsu pigs at various developmental stages using TRIzol reagent. The RNA concentration was adjusted to 1000 ng/μL, and cDNA was synthesized via reverse transcription under the following conditions: 37 °C for 2 min, 50 °C for 15 min, and 85 °C for 2 min, in a single cycle. The resulting cDNA was stored at −20 °C.

2.3. Primer Design

Based on the DNA (accession number: NC_010443.5) and RNA (accession number: XM_021087933.1) sequences of the pig ENPP1 gene published by NCBI, PCR and fluorescent primers were designed using Primer Premier 5.0 software. GAPDH was used as the internal reference gene for quantitative fluorescence, and primers were synthesized by Qingke Biotechnology (Chongqing, China). Primer information is provided in Table 1.

2.4. PCR Sequence Amplification and Real-Time Fluorescence Quantitative Analysis

Genomic DNA was amplified using PCR in a 20 µL reaction mixture, which consisted of 10 µL PCR Mix (Genstar, Beijing, China), 1 µL each of forward and reverse primers, 1 µL genomic DNA, and 7 µL double-distilled water (ddH2O). The amplification program began with an initial denaturation at 94 °C for 3 min, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 63 °C for 30 s, and extension at 72 °C for 5 min, with a final hold at 4 °C. The PCR products were subjected to 1% agarose gel electrophoresis for analysis, and subsequently purified and sequenced by Qingke Biotechnology (Chongqing, China). For qRT-PCR, the reaction mixture was prepared in a total volume of 20 µL, containing 1 µL cDNA, 0.5 µL each of forward and reverse primers, 10 µL 2×RealStar Fast SYBR qPCR Mix, and 8 µL ddH2O. The amplification conditions were as follows: an initial denaturation at 95 °C for 2 min, followed by 40 cycles of denaturation at 95 °C for 15 s, annealing at 60 °C for 30 s, and extension at 72 °C for 30 s.

2.5. Bioinformatics Analysis

Amino acid sequences of the ENPP1 gene from 10 species were retrieved from the NCBI database. The species included are Sus scrofa (XP_020943592.1), Gallus gallus (XP_004940275.3), Bos taurus (NP_001193141.1), Anas platyrhynchos (XP_038032814.1), Phacochoerus africanus (XP_047614516.1), Homo sapiens (NP_006199.2), Mus musculus (NP_001295256.1), Capra hircus (XP_017909005.1), Oryctolagus cuniculus (NP_001076211.2), and Danio rerio (NP_001025339.1). A phylogenetic tree was constructed using the MEGA software (www.megasoftware.net, accessed on 24 March 2025), employing the neighbor-joining method. The MEME suite (http://meme.nbcr.net/, accessed on 24 March 2025) was used to analyze the structural features and functional aspects of the ENPP1 protein across these species.

2.6. Statistical Analysis

The sequencing results were analyzed using SeqMan software (Pro), and peak charts were examined to identify SNP sites for subsequent statistical analysis. Hardy–Weinberg equilibrium (HWE) was evaluated using the Chi-square (χ2) test. Genetic polymorphism parameters, including observed heterozygosity (Ho), expected heterozygosity (He), polymorphic information content (PIC), and effective allele number (Ne), were calculated. One-way analysis of variance (ANOVA) was performed using SPSS 25.0 to assess differences in growth performance among genotype groups. A general linear model (GLM) was applied in SPSS for association analysis, with genotype effect as a fixed factor and phenotype as the dependent variable. Multiple comparisons were conducted using Duncan’s method. The statistical model used was as follows: Yij = μ + Gi + eij, where Yij represents the observed value of the growth trait, μ is the overall mean, Gi is the genotype effect, and eij is the random error. Multiple comparisons among different genotypes were adjusted using the Bonferroni method. The expression levels of ENPP1 in various tissues of Xiangsu pigs were quantified using the 2−ΔΔCt method. Data are presented as means ± standard deviation, with all values rounded to two decimal places.

3. Results

3.1. Expression Levels of ENPP1 in Different Tissues of Xiangsu Pigs

Expression profiles of the ENPP1 gene in various tissues of 3-day-old and 6-month-old crispy pigs are shown in Figure 1. At 3 days, ENPP1 expression was highest in the kidneys and lowest in the heart. By 6 months of age, the highest expression was observed in the liver, while the heart exhibited the lowest expression (p-value < 0.01). Notable differences in ENPP1 expression were found across tissues at different ages. Specifically, 6-month-old Xiangsu pigs had higher expression levels in the liver and lungs compared to 3-day-old pigs, whereas expression was lower in the heart, spleen, and kidneys.

3.2. Analysis of ENPP1 Gene Polymorphism

The sequencing results were aligned with the pig ENPP1 reference sequence (accession number: NC_010443.5) using SeqMan software (Figure 2). Five SNPs were identified in the ENPP1 gene: g.64275T→C, g.64429G→A, g.64527T→C, g.64850T→C, and g.64911G→A. The g.64275T→C and g.64429G→A variants are located in intron 19, while g.64850T→C and g.64911G→A are found in intron 20, with g.64850T→C also present in exon 20. All five SNPs display two alleles and three genotypes, and all are synonymous mutations, meaning they do not alter the amino acid sequence.

3.3. Biodiversity Analysis

A phylogenetic tree of ENPP1 sequences from 10 species was constructed using MEGA6 software (6.0), based on a neighbor-joining analysis. The species included mammals (mouse, pig, cattle, goat, warthog, and rabbit), as well as human, chicken, duck, and zebrafish. Conserved motifs within the supersecondary structure were predicted using the MEME suite (http://meme-suite.org/tools/meme, accessed on 24 March 2025). The phylogenetic analysis showed that pigs are most closely related to warthogs, followed by humans and cattle, with zebrafish being the most distantly related (Figure 3). Ten significant amino acid sequences were identified across the ten species (Motif Count: 6–30), suggesting functional similarities at the supersecondary structure level (Figure 4).

3.4. Analysis of Growth Data of Xiangsu Hybrid Pig Population

The mean, maximum, minimum, and standard deviation values for nine growth traits (withers height, body weight, body length, chest width, chest depth, chest girth, abdominal girth, rib girth, and hind limb girth) in 165 fattening Xiangsu pigs were calculated. The results are presented in Table 2. Analysis of the distribution of these growth traits (Figure 5) revealed variability among individual data points, with a significant clustering around the mean, in line with the principles of randomness and variability.

3.5. Analysis of Population Genetic Diversity

Table 3 presents the genotype frequencies and genetic parameters for five mutation sites in the ENPP1 gene of pigs. Genetic analysis was conducted on these five SNPs, and the results of the Chi-square (χ2) test are shown in the table. The χ2 values for the SNPs g.64275 T→C, g.64429 G→A, g.64527 T→C, g.64850 T→C, and g.64911 G→A were 0.953, 3.802, 0.014, 0.213, and 0.106, respectively, indicating that the genotype distributions were in Hardy–Weinberg equilibrium (p-value > 0.05). As shown in Table 4, the effective allele numbers for these five SNPs ranged from 1.581 to 1.994, with heterozygosity values of between 0.367 and 0.499 and homozygosity values of between 0.502 and 0.633. In all cases, homozygosity was higher than heterozygosity. The polymorphic information content (PIC) values for these SNPs were 0.300, 0.357, 0.374, 0.368, and 0.360 (all falling within the range of 0.25 < PIC < 0.5), indicating moderate polymorphism.

3.6. Correlation Analysis Between Genotype and Growth Traits

The relationship between five mutation sites in the ENPP1 gene and nine growth traits was examined in 165 Xiangsu hybrid pigs. The association analysis of different genotypes at the ENPP1 mutation sites (g.64275T→C, g.64429G→A, g.64527T→C, g.64850T→C, and g.64911G→A) with growth traits is presented in Table 5. For the g.64275T→C site, pigs with the CC genotype showed significantly better performance in weight, body height, and chest depth compared to those with the TC genotype (p-value < 0.05), and a significantly better chest circumference (p-value < 0.01). At the g.64429G→A site, the AA genotype exhibited a highly significant improvement in chest depth over the GG genotype (p-value < 0.01). For the g.64527T→C site, the CC genotype had significantly better chest depth than the TT genotype (p-value < 0.05).

4. Discussion

China is home to the most diverse range of indigenous pig breeds, which are regionally categorized into types such as Central China, North China, Jiang-Hai, Southwest, South China, and Plateau. The Congjiang Xiang pig, a small-sized breed from Guizhou, belongs to the Southwest type. It is well regarded for its tender meat and robust stress resistance; however, its slow growth significantly impedes the local pig farming industry’s economic development [20,21,22]. The Xiangsu hybrid pig inherits the Congjiang Xiang pig’s desirable meat qualities while demonstrating substantial improvements in body size and reproductive performance. Consequently, the development of the Xiangsu pig breed plays a pivotal role in advancing the pig farming industry in Guizhou. Studies have shown that the ENPP1 gene is involved in various physiological processes across multiple tissues. The products of the ENPP1 protein catalyze extracellular signaling molecules that regulate physiological functions or serve as ligands for receptors on the cell surface and within cells [23,24,25]. ENPP1 also regulates bone and soft tissue mineralization by generating pyrophosphate and is involved in bone remodeling [15,26]. ENPP1 deficiency is associated with ectopic calcification in multiple tissues, neointimal proliferation, growth and developmental disorders, and skeletal deformities [27,28,29]. Since bone and muscle functions are closely interconnected, they interact through osteogenic and myogenic factors. Osteoporosis is often accompanied by a loss of muscle mass or is linked to postpartum paralysis in sows [30]. Recent studies have demonstrated that ENPP1 is expressed in various tissues of Xiangsu pigs at different stages, with significant variation in expression levels, which aligns with previous findings [31,32]. Therefore, investigating the association between ENPP1 gene mutations and growth performance in pigs is of considerable value. To date, however, no studies have addressed this topic. This study aims to explore the correlation between ENPP1 gene SNPs and growth performance in Xiangsu pigs, which holds important research implications.
In mammalian genetics, nucleotide sequence alterations—resulting from artificial interventions, natural selection, or genetic drift—can influence an organism’s genetic traits. Generally, higher polymorphic information content (PIC) corresponds to greater genetic diversity within a population [33,34]. This study analyzed the SNPs in the ENPP1 gene in the Xiangsu pig population. Five novel SNP sites were identified in the ENPP1 gene, all exhibiting moderate polymorphism (0.25 < PIC < 0.50), with no deviations from Hardy–Weinberg equilibrium. These findings suggest that mutations at these sites may impact the genetic equilibrium of the population and potentially influence evolutionary processes, indicating their selective value for breed improvement [33,35]. Sequence alignment revealed that g.64527T→C is located in the exon region, while the remaining four sites are within intronic regions. Previous research has shown that intronic variations can disrupt mRNA expression, protein function, and splicing in eukaryotes [36,37,38]. Thus, intronic mutations may also affect growth traits and serve as valuable genetic markers. Although no amino acid changes were observed at the identified sites, SNPs in the intronic and 3′-UTR regions can still regulate gene expression [39,40,41]. These regulatory and functional sites strengthen the potential role of the ENPP1 gene in modulating pig growth performance. To further investigate the impact of each SNP on growth traits, we performed genotype and haplotype association analyses. The results indicated that g.64275T→C, g.64429G→A, and g.64527T→C significantly influenced growth performance in Xiangsu pigs. Specifically, the g.64275T→C site was associated with withers height, chest circumference, and chest depth (p < 0.05, p < 0.01), while g.64429G→A and g.64527T→C were both linked to chest depth (p < 0.05, p < 0.01), highlighting their potential as candidate markers for this trait. Additionally, structural and functional predictions of the ENPP1 protein revealed that pigs are most distantly related to poultry in evolutionary terms. Fifteen significant amino acid sequences were identified across eight species, suggesting functional similarities at the supersecondary structure level. Moreover, ENPP1 exhibits considerable conservation across species. Previous studies have also suggested that polymorphisms in the 3′ UTR binding region of the ENPP1 gene are associated with increased ENPP1 protein levels in skeletal muscles [42].
The aforementioned studies demonstrate a significant correlation between the ENPP1 gene and production performance in livestock, highlighting its potential as a key reference gene for breeding programs. Our results also suggest that polymorphisms in the ENPP1 gene may be closely linked to growth performance in Xiangsu pigs, justifying further investigation in future breeding studies.

5. Conclusions

In summary, this study identified five novel SNPs in the ENPP1 gene of pigs and analyzed their association with growth performance. The results indicate that the SNPs g.64275T→C, g.64429G→A, and g.64527T→C significantly influence growth traits. These findings offer valuable insights for molecular marker-assisted selection and the enhancement of growth performance in Xiangsu pigs.

Author Contributions

J.C.: writing—original draft, formal analysis, data curation, methodology, visualization, conceptualization. J.H.: conceptualization, formal analysis. H.X.: project administration, funding acquisition. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Guizhou Provincial Science and Technology Project (QKHFQ-2018, 4007, (002)), and the Guizhou Provincial Agricultural Major Industrial Scientific Research Project (QKHKYZ-2019, 011).

Acknowledgments

The authors would like to thank all the reviewers who participated in the review and all the researchers who helped in the process of writing this manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Yuan, H.; Wei, W.; Zhang, Y.; Li, C.; Zhao, S.; Chao, Z.; Xia, C.; Quan, J.; Gao, C. Unveiling the Influence of Copy Number Variations on Genetic Diversity and Adaptive Evolution in China’s Native Pig Breeds via Whole-Genome Resequencing. Int. J. Mol. Sci. 2024, 25, 5843. [Google Scholar] [CrossRef]
  2. Xu, J.; Ruan, Y.; Sun, J.; Shi, P.; Huang, J.; Dai, L.; Xiao, M.; Xu, H. Association Analysis of PRKAA2 and MSMB Polymorphisms and Growth Traits of Xiangsu Hybrid Pigs. Genes 2022, 14, 113. [Google Scholar] [CrossRef]
  3. Huang, J.; Ruan, Y.; Xiao, M.; Dai, L.; Jiang, C.; Li, J.; Xu, J.; Chen, X.; Xu, H. Association between polymorphisms in NOBOX and litter size traits in Xiangsu pigs. Front. Vet. Sci. 2024, 11, 1359312. [Google Scholar] [CrossRef]
  4. Borza, R.; Salgado-Polo, F.; Moolenaar, W.H.; Perrakis, A. Structure and function of the ecto-nucleotide pyrophosphatase/phosphodiesterase (ENPP) family: Tidying up diversity. J. Biol. Chem. 2022, 298, 101526. [Google Scholar] [CrossRef]
  5. Onyedibe, K.I.; Wang, M.; Sintim, H.O. ENPP1, an old enzyme with new functions, and small molecule inhibitors-A sting in the tale of ENPP. Molecules 2019, 24, 4192. [Google Scholar] [CrossRef]
  6. Bollen, M.; Gijsbers, R.; Ceulemans, H.; Stalmans, W.; Stefan, C. Nucleotide pyrophosphatases/phosphodiesterases on the move. Crit. Rev. Biochnol. 2000, 35, 393–432. [Google Scholar] [CrossRef] [PubMed]
  7. Guan, D.; Fang, L.; Feng, M.; Guo, S.; Xie, L.; Chen, C.; Zhou, J.; Zhang, H. Ecto-nucleotide pyrophosphatase/phosphodiesterase 1 inhibitors: Research progress and prospects. Eur. J. Med. Chem. 2024, 267, 116211. [Google Scholar] [CrossRef]
  8. Dong, H.; Maddux, B.A.; Altomonte, J.; Meseck, M.; Accili, D.; Youngren, J.F.; Goldfine, I.D. Increased Hepatic Levels of the Insulin Receptor Inhibitor, PC-1/NPP1, Induce Insulin Resistance and Glucose Intolerance. Diabetes 2025, 54, 367–372. [Google Scholar] [CrossRef]
  9. Arnold, A.; Dennison, E.; Kovacs, C.S.; Mannstadt, M.; Rizzoli, R.; Brandi, M.L.; Clarke, B.; Thakker, R.V. 2021. Hormonal regulation of biomineralization. Nat. Rev. Endocrinol. 2021, 17, 261–275. [Google Scholar] [CrossRef]
  10. Cheng, Z.; O’Brien, K.; Howe, J.; Sullivan, C.; Schrier, D.; Lynch, A.; Jungles, S.; Sabbagh, Y.; Thompson, D. INZ-701 prevents ectopic tissue calcification and restores bone architecture and growth in ENPP1-deficient mice. J. Bone Miner. Res. 2020, 3, 1594–1604. [Google Scholar] [CrossRef]
  11. Brachet, C.; Mansbach, A.L.; Clerckx, A.; Deltenre, P.; Heinrichs, C. Hearing loss is part of the clinical picture of ENPP1 loss of function mutation. Horm. Res. Paediat. 2014, 81, 63–66. [Google Scholar] [CrossRef]
  12. Roberts, F.L.; Rashdan, N.A.; Phadwal, K.; Markby, G.R.; Zoll, J.; Farquharson, C.; MacRae, V.E. Osteoblast-specific deficiency of ectonucleotide pyrophosphatase or phosphodiesterase-1 engenders insulin resistance in high-fat diet fed mice. J. Cell. Physiol. 2021, 236, 4614–4624. [Google Scholar] [CrossRef]
  13. Neamati, N.; Hosseini, S.R.; Hajiahmadi, M.; Halalkhor, S.; Nooreddini, H.; Niaki, H.A.; Korani, B.; Parsian, H. The ENPP1 K121Q polymorphism modulates developing of bone disorders in type 2 diabetes: A cross sectional study. Gene 2017, 637, 100–107. [Google Scholar] [CrossRef]
  14. Pan, W.; Ciociola, E.; Saraf, M.; Tumurbaatar, B.; Tuvdendorj, D.; Prasad, S.; Chandalia, M.; Abate, N. Metabolic consequences of ENPP1 overexpression in adipose tissue. Am. J. Physiol. Endocrinol. Metab. 2011, 301, E901–E911. [Google Scholar] [CrossRef] [PubMed]
  15. Zimmerman, K.; Liu, X.; Von, K.S.; Stabach, P.; Lester, E.R.; Chu, E.Y.; Srivastava, S.; Somerman, M.J.; Tommasini, S.M.; Busse, B.; et al. Catalysis-Independent ENPP1 Protein Signaling Regulates Mammalian Bone Mass. J. Bone Miner. Res. 2022, 37, 1733–1749. [Google Scholar] [CrossRef] [PubMed]
  16. Hu, M.; Guo, W.; Liao, Y.; Xu, D.; Sun, B.; Song, H.; Wang, T.; Kuang, Y.; Jing, B.; Li, K.; et al. Dysregulated ENPP1 increases the malignancy of human lung cancer by inducing epithelial-mesenchymal transition phenotypes and stem cell features. Am. J. Cancer Res. 2019, 9, 134–144. [Google Scholar]
  17. Wu, G.; Yu, M.; Liu, T.; Zhang, D.; Chang, Y.; Liu, Z.; Liu, D.; Xu, C. Integration of Multiomics Data Reveals Selection Characteristics of ITGB1 That Are Associated with Size Differentiation in Pigs. Int. J. Mol. Sci. 2025, 26, 1569. [Google Scholar] [CrossRef] [PubMed]
  18. Goldfine, I.D.; Maddux, B.A.; Youngren, J.F.; Reaven, G.; Accili, D.; Vigneri, R.; Frittitta, L. The role of membrane glycoprotein plasma cell antigen 1/ectonucleotide pyrophosphatase phosphodiesterase 1 in the pathogenesis of insulin resistance and related abnormalities. Endocr. Rev. 2008, 29, 62–75. [Google Scholar] [CrossRef]
  19. Zhu, M.; Wang, L.; Ma, Z.; Mao, Y.; Wang, G.; Zheng, R.; Zuo, B.; Wang, Y. Analysis of the Genetic Diversity and Genetic Structure of Jiangshan Black Pigs Using Single Nucleotide Polymorphism (SNP) Chips. Animals 2024, 14, 2660. [Google Scholar] [CrossRef]
  20. Zwierzchowski, L.; Ostrowska, M.; Żelazowska, B.; Bagnicka, E. Single nucleotide polymorphisms in the bovine SLC2A12 and SLC5A1 glucose transporter genes—The effect on gene expression and milk traits of Holstein Friesian cows. Anim. Biotechnol. 2023, 34, 225–235. [Google Scholar] [CrossRef]
  21. Liu, C.; Ran, X.; Wang, J.; Li, S.; Liu, J. Detection of genomic structural variations in Guizhou indigenous pigs and the comparison with other breeds. PLoS ONE 2018, 13, e0194282. [Google Scholar] [CrossRef] [PubMed]
  22. Tang, L.T.; Ran, X.Q.; Mao, N.; Zhang, F.P.; Niu, X.; Ruan, Y.Q.; Yi, F.L.; Li, S.; Wang, J.F. Analysis of alternative splicing events by RNA sequencing in the ovaries of Xiang pig at estrous and diestrous. Theriogenology 2018, 119, 60–68. [Google Scholar] [CrossRef]
  23. Luo, Z.Y.; Dai, X.L.; Ran, X.Q.; Cen, Y.X.; Niu, X.; Li, S.; Huang, S.H.; Wang, J.F. Identification and profile of microRNAs in Xiang pig testes in four different ages detected by Solexa sequencing. Theriogenology 2018, 117, 61–71. [Google Scholar] [CrossRef] [PubMed]
  24. Zhou, Y.; Bao, L.; Gong, S.; Dou, G.; Li, Z.; Wang, Z.; Yu, L.; Ding, F.; Yang, X.; Liu, S. T Cell-Derived Apoptotic Extracellular Vesicles Hydrolyze cGAMP to Alleviate Radiation Enteritis via Surface Enzyme ENPP1. Adv. Sci. 2024, 11, e2401634. [Google Scholar] [CrossRef]
  25. Zhou, X.; Pan, Y.; Wang, Y.; Wang, B.; Yan, Y.; Qu, Y.; Ke, X. Tanshinones induce tumor cell apoptosis via directly targeting FHIT. Sci. Rep. 2021, 11, 12217. [Google Scholar] [CrossRef] [PubMed]
  26. Zhao, L.; Zhang, Y.; Tian, Y.; Ding, X.; Lin, R.; Xiao, L.; Peng, F.; Zhang, K.; Yang, Z. Role of ENPP1 in cancer pathogenesis: Mechanisms and clinical implications (Review). Oncol. Lett. 2024, 28, 590. [Google Scholar] [CrossRef]
  27. Zhu, Z.; He, Z.; Tang, T.; Wang, F.; Chen, H.; Zhou, J.; Lin, C.; Chen, G.; Wang, J.; Li, J.; et al. Effect of mechanical stimulation on tissue heterotopic ossification: An in vivo experimental study. Front. Physiol. 2023, 14, 1225898. [Google Scholar] [CrossRef]
  28. Furukawa, H.; Oka, S.; Kondo, N.; Nakagawa, Y.; Shiota, N.; Kumagai, K.; Ando, K.; Takeshita, T.; Oda, T.; Yoshikawa, N.; et al. The Contribution of Deleterious Rare Alleles in ENPP1 and Osteomalacia Causative Genes to Atypical Femoral Fracture. J. Clin. Endocrinol. Metab. 2022, 107, e1890–e1898. [Google Scholar] [CrossRef]
  29. Li, Q.; van de Wetering, K.; Uitto, J. Pseudoxanthoma Elasticum as a Paradigm of Heritable Ectopic Mineralization Disorders: Pathomechanisms and Treatment Development. Am. J. Pathol. 2018, 189, 216–225. [Google Scholar] [CrossRef]
  30. Ferreira, C.R.; Kavanagh, D.; Oheim, R.; Zimmerman, K.; Stürznickel, J.; Li, X.; Stabach, P.; Rettig, R.L.; Levine, M.A.; Horowitz, M.C.; et al. Response of the ENPP1-Deficient Skeletal Phenotype to Oral Phosphate Supplementation and/or Enzyme Replacement Therapy: Comparative Studies in Humans and Mice. J. Bone Miner. Res. 2021, 36, 942–955. [Google Scholar] [CrossRef]
  31. Zhu, L.; Zhang, L.; Cha, J.; Li, C.; Mao, B. Loss of ZC4H2, an Arthrogryposis Multiplex Congenita Associated Gene, Promotes Osteoclastogenesis in Mice. Genes 2024, 15, 1134. [Google Scholar] [CrossRef] [PubMed]
  32. Yang, K.; Li, J.; Tao, L. Purine metabolism in the development of osteoporosis. Biomed. Pharmacother. 2022, 155, 113784. [Google Scholar] [CrossRef]
  33. Chang, C.C.; Lee, K.L.; Chan, T.S.; Chung, C.C.; Liang, Y.C. Histone Deacetylase Inhibitors Downregulate Calcium Pyrophosphate Crystal Formation in Human Articular Chondrocytes. Int. J. Mol. Sci. 2022, 23, 2604. [Google Scholar] [CrossRef] [PubMed]
  34. Mäki-Tanila, A.; Webster, L. Heritability, SNP, inbreeding, dairy cattle, genomic selection—And other keywords. J. Anim. Genet. 2019, 136, 1–2. [Google Scholar] [CrossRef]
  35. Azimu, W.; Manatbay, B.; Li, Y.; Kaimaerdan, D.; Wang, H.E.; Reheman, A.; Muhatai, G. Genetic diversity and population structure analysis of eight local chicken breeds of Southern Xinjiang. Br. Poult. Sci. 2018, 59, 629–635. [Google Scholar] [CrossRef]
  36. Wang, M.; Shu, H.; Xie, J.; Huang, Y.; Wang, K.; Feng, R.; Yu, X.; Guan, J.; Feng, W.; Liu, M. An intron mutation of HNF1A causes abnormal splicing and impairs its activity as a transcription facto. Mol. Cellular. Endocrinol. 2022, 545, 111575. [Google Scholar] [CrossRef]
  37. Abou Tayoun, A.N.; Pesaran, T.; DiStefano, M.T.; Oza, A.; Rehm, H.L.; Biesecker, L.G.; Harrison, S.M. Recommendations for interpreting the loss of function PVS1 ACMG/AMP variant criterion. Human Mutat. 2018, 39, 1517–1524. [Google Scholar] [CrossRef]
  38. Chiang, H.L.; Chen, Y.T.; Su, J.Y.; Lin, H.N.; Yu, C.A.; Hung, Y.J.; Lin, C.L. Mechanism and modeling of human disease-associated near-exon intronic variants that perturb RNA splicing. Nat. Struct. Mol. Biol. 2022, 29, 1043–1055. [Google Scholar] [CrossRef]
  39. Mauro, V.P.; Chappell, S.A. A critical analysis of codon optimization in human therapeutics. Trends Mol. Med. 2014, 20, 604–613. [Google Scholar] [CrossRef]
  40. Safdar, M.; Khan, M.S.; Karim, A.Y.; Omar, S.A.; Smail, S.W.; Saeed, M.; Zaheer, S.; Ali, M.; Ahmad, B.; Tasleem, M.; et al. SNPs at 3′UTR of APOL1 and miR-6741-3p target sites associated with kidney diseases more susceptible to SARS-CoV-2 infection: In silco and in vitro. Mamm. Genome 2021, 32, 389–400. [Google Scholar] [CrossRef]
  41. Clark, D.L.; Bohrer, B.M.; Tavárez, M.A.; Boler, D.D.; Beever, J.E.; Dilger, A.C. Effects of the porcine IGF2 intron 3-G3072A mutation on carcass cutability, meat quality, and bacon processing. J. Anim. Sci. 2014, 92, 5778–5788. [Google Scholar] [CrossRef] [PubMed]
  42. Frittitta, L.; Ercolino, T.; Bozzali, M. A cluster of three single nucleotide polymorphisms in the 3′-untranslated region of human glycoprotein PC-1 gene stabilizes PC-1 mRN and is associated with increased PC-1 protein content and insulin resistance-related abnormalities. Diabetes 2021, 50, 1952–1955. [Google Scholar] [CrossRef]
Genes 16 00395 g001
Figure 1. Expression level of ENPP1 in Xiangsu pigs. (A) Expression level of ENPP1 in tissues of 3-day-old Xiangsu pigs; (B) expression level of ENPP1 in tissues of 6-month-old Xiangsu pigs. * Indicating significant differences (p-value < 0.05); (C): Tissue expression of ENPP1 in different growth stages of Xiangsu pigs was different. ** different capital letters indicate extremely significant differences (p-value < 0.01).
Figure 1. Expression level of ENPP1 in Xiangsu pigs. (A) Expression level of ENPP1 in tissues of 3-day-old Xiangsu pigs; (B) expression level of ENPP1 in tissues of 6-month-old Xiangsu pigs. * Indicating significant differences (p-value < 0.05); (C): Tissue expression of ENPP1 in different growth stages of Xiangsu pigs was different. ** different capital letters indicate extremely significant differences (p-value < 0.01).
Genes 16 00395 g001
Genes 16 00395 g002
Figure 2. SNP loci of ENPP1 gene in Xiangsu pig. (A) g.64275 T→C, (B) g.64429G→A, (C) g.64527T→C, (D) g.64850T→C, (E) g.64911G→A.
Figure 2. SNP loci of ENPP1 gene in Xiangsu pig. (A) g.64275 T→C, (B) g.64429G→A, (C) g.64527T→C, (D) g.64850T→C, (E) g.64911G→A.
Genes 16 00395 g002
Genes 16 00395 g003
Figure 3. Evolutionary tree of the ENPP1 system for 10 species (Left) and motif structure analysis (Right).
Figure 3. Evolutionary tree of the ENPP1 system for 10 species (Left) and motif structure analysis (Right).
Genes 16 00395 g003
Genes 16 00395 g004
Figure 4. The motif sequence of ENPP1 in 10 species.
Figure 4. The motif sequence of ENPP1 in 10 species.
Genes 16 00395 g004
Genes 16 00395 g005
Figure 5. Distribution area of growth data for 165 Xiangsu pigs.
Figure 5. Distribution area of growth data for 165 Xiangsu pigs.
Genes 16 00395 g005
Table 1. Primers for the porcine ENPP1 gene.
Table 1. Primers for the porcine ENPP1 gene.
GenesProduct Size (bp)Primer Sequence (5′-3′)Tm (°C)
ENPP1-Exon1808F: AGTGCCCGAAATCAGACAGGAAG
R: CCTTGTCGGCTTTTCCTAAGACC		56
ENPP1-Exon2241F: GCACACATTGTATGACCAGCACTA
R: CGAATCTCAGTCACATTCTGAAGG		57
ENPP1-Exon3992F: CAGCAATGCCAGATCCTTAACCC
R: CCAGTCACTGTTGGAGAACTCAGAA		57
ENPP1-Exon4875F: ACTCGGACTTAGGAAATAGCCCA
R: TACCTGTGCTAAACCCAGCTAAGAC		63
ENPP1-Exon5644F: GTGGATAGAAGGAGGGTTGTCAGTT
R: GAGTTCTCTTCTTGGCTCAGCAGTT		65
ENPP1-Exon6712F: CTTTAGACGACATGCCGACATCAG
R: GGCTACAGCTCTGATTAGACCCCTA		62
ENPP1-Exon7645F: CTTTTCTTAGCACTGGTGCCAAAG
R: GAACACTGTAAACCAGCCGAAATG		62
ENPP1-Exon8665F: ACCAAAGCAAAGAGGAGTTTGCTC
R: ACCCAGCTCTGGAATAAACTCCAC		63
ENPP1-Exon9325F: CTTAAGAGGAAAGCACTGGTGTTG
R: ACAGGTCTCATCGTTCAGACAACA		61
ENPP1-Exon10486F: GCGTCCACTTCCCAGTTTTACTA
R: TCAGAGCCAAGAGCAAAGTCTTC		57
ENPP1-Exon11408F: AGGAATGATACCCCAGTGTTGTG
R: CCACTGGTTCAACTTAGCACTGTAG		59
ENPP1-Exon12475F: ATGTGCCATTCTGTGCCCTTGT
R: CGGAGCCACAACAGGAACTCTTAT		59
ENPP1-Exon13896F: CTCTGGATATATGTCCAGGAATGGG
R: TCATCTCTTCCAGCATTCCTCCTT		57
ENPP1-Exon14598F: GGCTGAGTGGTTCCGAAAAATCT
R: AACCAGAGCCACAGTGGTGAGAAT		59
ENPP1-Exon15543F: AACTAGGGACTGAATCTAGGCATCC
R: GCCAAGGTTAAGAGACCCTGAGATA		59
ENPP1-Exon16843F: TAGCATGGTCAGGGTTCAAAGTC
R: TCTCACTCTGCCCAACATACACA		60
ENPP1-Exon17363F:CATGGTAAATGTACACCAGGGGTT
R:CCTGACCTATGACCTCCTTTTGAT		62
ENPP1-Exon18702F: CAAGGTCTGTCTGTATTCAGCTACC
R: AGGTCTGCCTGTGTGACTAGAATTG		56
ENPP1-Exon19792F: GGGAGAGATCTAGCTTAGTCCTGGA
R: TCTGTTTCATCAGGTGGTCCTCC		56
ENPP1-Exon20977F: CGAATCCGACTAGGAACCATGAG
R: CGGGGTTTCAAAGTCACGTAGATAG		57
ENPP1-Exon21791F: GCATATGGAGGTCACCAGCTTATG
R: TAGCTCCAATTAGACCCCTAGCCT		59
ENPP1-Exon22917F: TAGTTGAAATGAGGCAGAGGAGG R: GTTATCCGGGCTGATGGTCAATA57
ENPP1-Exon23677F: GGGATGCTTGAAGTACAGCCGAT
R: GACAAGATCGTAACAGCAGCCACA		57
ENPP1-Exon24557F: CAGTCTGGCAGGAAATATTGAGG
R: GCCATACGTAGCCAGTGTAAGGTTT		57
ENPP1-Exon25617F: TGATGAGAACGGAGGAGATGGA
R: AAGGGTTTGCCAGCATCAGAGA		61
ENPP1-Exon261006F: GCAGAAGTGAATGTTGTCTGGTCAC
R: CATCAGAATGGATTAGGCAGAGGA		59
ENPP1-Exon271478F: CCATACCCTTTAGTACCAACCTGTG
R: GATGCTCTACATAGAGGCAACTGTG		61
ENPP1-qPCR109F: GAGAACATTTGGGAACTGTCGC
R: GCTGCAAGTCCATATCCGTTCT		63
GAPDH-qPCR169F: TTGTGATGGGCGTGAACC
R: GTCTTCTGGGTGGCAGTGAT		58
Table 2. Growth performance data of Xiangsu pigs.
Table 2. Growth performance data of Xiangsu pigs.
IndexW/kgB S/cmB H/cmC C/cmA C/cmT C/cmC D/cmC W/cmL H C/cm
Mean91.08110.1875.39110.75120.1220.2240.0930.1271.53
Max99.921198311913023463475
Min82.471006810310917342665
SD4.554.703.973.653.991.252.881.962.01
Note: W: weight/kg, B S: body straight/cm, B H: body height/cm, C C: chest circumference/cm, A C: abdominal circumference/cm, T C: tube circumference/cm, C D: chest depth/cm, C W: chest width/cm, L H C: leg and hip circumference/cm.
Table 3. The genotype frequency and gene frequency of ENPP1 in Xiangsu pigs.
Table 3. The genotype frequency and gene frequency of ENPP1 in Xiangsu pigs.
SNPsGenotypic FrequenciesAllelic
Frequency		χ2
g.64275T→CTTTCg.64275T→CTC0.953
0.073(12)0.339(56)0.588(97)0.2420.758
g.64429G→AGGGAg.64429G→AGA3.802
0.436(72)0.394(65)0.170(28)0.6330.367
g.64527T→CTTTCg.64527T→CTC0.014
0.424(70)0.4(66)0.176(29)0.6240.376
g.64850T→CTTTCg.64850T→CTC0.213
0.333(55)0.503(83)0.164(27)0.5850.415
g.64911G→AGGGAg.64911G→AGA0.103
0.358(59)0.491(81)0.152(25)0.6030.397
Note: χ20.05 < 5.99; χ20.01 < 9.21, sample size in parentheses. Note: HE, heterogeneity; HO, pureness; NE, effective allele; PIC, polymorphic information content; PIC < 0.25 implies low polymorphism; 0.5 > PIC > 0.25 denotes moderate polymorphism; PIC > 0.5 suggests high polymorphism; χ2 < 5.99 denotes Hardy–Weinberg equilibrium; χ2 > 5.99 signifies Hardy–Weinberg disequilibrium.
Table 4. Genetic diversity of SNP loci in the ENPP1 gene of Xiangsu pigs.
Table 4. Genetic diversity of SNP loci in the ENPP1 gene of Xiangsu pigs.
SNPsHeHoNePIC
g.64275T→C0.3670.6331.5810.300
g.64429G→A0.4640.5361.8670.357
g.64527T→C0.4990.5021.9940.374
g.64850T→C0.4560.5141.9940.368
g.64911G→A0.4790.5211.9190.364
Note: Ho represents homozygosity, He represents heterozygosity, Ne represents effective allele number, and PIC represents peptide information content. PIC < 0.25 indicates low polymorphism, 0.25 < PIC < 0.50 indicates moderate polymorphism, and PIC > 0.5 indicates high polymorphism.
Table 5. Association analysis of three SNPs in ENPP1 and the growth trait.
Table 5. Association analysis of three SNPs in ENPP1 and the growth trait.
SNPsGenotypeW/kgB S/cmB H/cmC C/cmA C/cmT C/cmC D/cmC W/cmL H C/cm
g.64275T→CTT(12)89.91 ± 4.41111.25 ± 4.9974.67 ± 3.94109.33 ± 1.92118.58 ± 2.1520.42 ± 0.6738.92 ± 2.4729.92 ± 2.3171.58 ± 2.07
TC(56)90.13 ± 4.51 a109.65 ± 4.8074.58 ± 3.95 a109.85 ± 3.31 A119.49 ± 3.8220.00 ± 1.1739.45 ± 2.87 a30.07 ± 1.9471.38 ± 1.88
CC(97)91.76 ± 4.50 b110.35 ± 4.6275.93 ± 3.94 b111.43 ± 3.85 B120.65 ± 4.1720.33 ± 1.3340.60 ± 2.85 b30.17 ± 1.9571.61 ± 2.09
g.64429G→AGG(72)90.38 ± 4.54109.94 ± 5.0574.68 ± 3.89110.28 ± 3.60119.78 ± 4.1420.17 ± 1.2039.50 ± 2.88 A30.01 ± 2.0071.65 ± 1.82
GA(64)91.73 ± 4.72110.14 ± 4.4875.89 ± 4.19110.89 ± 3.61120.18 ± 3.7520.28 ± 1.3240.26 ± 2.8730.12 ± 1.9171.48 ± 2.34
AA(29)91.39 ± 4.02110.89 ± 4.3776.04 ± 3.46111.64 ± 3.79120.82 ± 4.1620.25 ± 1.2441.25 ± 2.58 B30.39 ± 2.0471.36 ± 1.68
g.64527T→CTT(70)90.50 ± 4.51109.97 ± 5.0674.94 ± 3.86110.36 ± 3.60119.87 ± 4.1620.17 ± 1.2039.54 ± 2.91 a29.99 ± 2.0071.74 ± 1.78
TC(66)91.50 ± 4.80110.06 ± 4.5075.67 ± 4.25110.79 ± 3.65120.11 ± 3.7720.27 ± 1.3240.24 ± 2.8530.20 ± 1.8871.38 ± 2.36
CC(29)91.53 ± 4.02110.97 ± 4.3175.83 ± 3.58111.62 ± 3.73120.72 ± 4.1220.24 ± 1.2141.10 ± 2.65 b30.28 ± 2.1071.38 ± 1.66
g.64850T→CTT(55)90.81 ± 4.39111.04 ± 4.5375.36 ± 3.70110.67 ± 3.39120.04 ± 3.5720.18 ± 1.1140.31 ± 2.7730.20 ± 2.1271.27 ± 1.84
TC(83)91.18 ± 4.55109.63 ± 4.5075.34 ± 4.23110.45 ± 3.71119.82 ± 4.1720.19 ± 1.3039.76 ± 2.9530.08 ± 1.8871.61 ± 2.24
CC(27)91.33 ± 4.98110.15 ± 5.5375.59 ± 3.84111.85 ± 3.88121.19 ± 4.1820.41 ± 1.3740.70 ± 2.8430.07 ± 1.9671.81 ± 1.57
g.64911G→AGG(59)90.98 ± 4.40110.85 ± 4.5675.27 ± 3.73110.63 ± 3.41119.93 ± 3.5420.20 ± 1.1140.36 ± 2.7030.27 ± 2.0771.31 ± 1.79
GA(81)91.11 ± 4.51109.65 ± 4.4675.44 ± 4.21110.53 ± 3.69119.89 ± 4.1720.21 ± 1.3139.75 ± 2.9930.04 ± 1.8771.62 ± 2.27
AA(25)91.22 ± 5.15110.32 ± 5.6975.48 ± 3.87111.76 ± 4.02121.28 ± 4.3420.32 ± 1.3840.60 ± 2.9230.04 ± 2.0371.80 ± 1.61
Note: a, b indicate significant differences between different genotypes (p-value < 0.05); A, B indicate extremely significant differences between different genotypes (p-value < 0.01).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chen, J.; Huang, J.; Xu, H. Association Analysis of ENPP1 Tissue Expression, Polymorphism, and Growth Traits in Xiangsu Pigs. Genes 2025, 16, 395. https://doi.org/10.3390/genes16040395

AMA Style

Chen J, Huang J, Xu H. Association Analysis of ENPP1 Tissue Expression, Polymorphism, and Growth Traits in Xiangsu Pigs. Genes. 2025; 16(4):395. https://doi.org/10.3390/genes16040395

Chicago/Turabian Style

Chen, Jiaqi, Jiajin Huang, and Houqiang Xu. 2025. "Association Analysis of ENPP1 Tissue Expression, Polymorphism, and Growth Traits in Xiangsu Pigs" Genes 16, no. 4: 395. https://doi.org/10.3390/genes16040395

APA Style

Chen, J., Huang, J., & Xu, H. (2025). Association Analysis of ENPP1 Tissue Expression, Polymorphism, and Growth Traits in Xiangsu Pigs. Genes, 16(4), 395. https://doi.org/10.3390/genes16040395

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop