Next Article in Journal
Methods for Extracellular Vesicle Isolation: Relevance for Encapsulated miRNAs in Disease Diagnosis and Treatment
Previous Article in Journal
Transcriptome and Metabolome Analysis of Low-Pressure Regulation in Saussurea involucrata Leaves
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Genes
Volume 16
Issue 3
10.3390/genes16030329
genes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Cloning, Characterization, and Expression Analysis of the DEAD-Box Family Genes, Vasa and PL10, in Pacific Abalone (Haliotis discus hannai)

by
Fei Chen
1,*,†,
Wenwei Wu
2,3,†,
Min Li
4,
Ying Su
2,3,
Miaoqing Huang
2,3,
Xuan Luo
2,3,
Weiwei You
2,3 and
Caihuan Ke
2,3,*
1
College of Biological Science and Engineering, Fuzhou University, Fuzhou 350108, China
2
State Key Laboratory of Mariculture Breeding, College of Ocean and Earth Sciences, Xiamen University, Xiamen 361102, China
3
Fujian Key Laboratory of Genetics and Breeding of Marine Organisms, College of Ocean and Earth Sciences, Xiamen University, Xiamen 361102, China
4
Department of Otorhinolaryngology, Guangxi Hospital Division of The First Affiliated Hospital, Sun Yat-sen University, Nanning 530000, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Genes 2025, 16(3), 329; https://doi.org/10.3390/genes16030329
Submission received: 8 February 2025 / Revised: 6 March 2025 / Accepted: 7 March 2025 / Published: 11 March 2025
(This article belongs to the Section Animal Genetics and Genomics)
Browse Figures
Versions Notes

Abstract

:
Background/Objectives: Vasa and PL10 belong to the DEAD-box protein family, which plays crucial roles in various cellular functions, such as DNA replication, DNA repair, and RNA processing. Additionally, DEAD-box family genes have also been identified as being related to gonadal development in many species. However, the function of vasa and PL10 in abalone is poorly understood on a molecular level. Methods: In the present study, we individually isolated and characterized the vasa and PL10 orthologs in Haliotis discus hannai (Hdh-vasa and Hdh-PL10). We also characterized the mRNA distributions of vasa and PL10 in various tissues from adult organisms and different embryonic developmental stages using real-time PCR (RT-qPCR) techniques. Furthermore, spatial and temporal expression of Hdh-vasa and Hdh-PL10 throughout embryonic and larval development was examined by whole-mount in situ hybridization (WMISH). Results: The two predicted amino acid sequences contained all of the conserved motifs characterized by the DEAD-box family. Homology and phylogenetic analyses indicate that they belong to the vasa and PL10 subfamilies. We found that vasa and PL10 mRNA were not solely restricted to gonads but were widely expressed in various tissues. WMISH showed that Hdh-vasa and Hdh-PL10 largely overlapped, with both being maternally expressed and specifically localized to the micromere lineage cells during early cleavage stages. By the gastrulation stage, Hdh-vasa were expressed strongly in two bilaterally symmetrical paraxial clusters, but Hdh-PL10 was dispersed in entire endodermal region. Our results suggest that Hdh-vasa-expressing cells are located as a subpopulation of undifferentiated multipotent cells that express Hdh-PL10. As such, we infer that primordial germ cells are specified from these vasa-expressing cells at some point during development, and inductive signals (epigenesis) play an important role in specifying primordial germ cells (PGCs) in H. discus hannai. Conclusions: This study provides valuable insights into the molecular characteristics and expression patterns of Hdh-vasa and Hdh-PL10, contributing to a better understanding of their roles in germ cell specification and early embryonic development in H. discus hannai.

1. Introduction

In recent years, various “germline factors” that regulate the differentiation of germ cells have been identified. Among these, the genes of the DDX4/vasa and Ded1/DDX3/PL10 subfamilies, which are evolutionarily related, have been studied extensively [1,2,3,4,5,6]. DDX4/vasa and Ded1/DDX3/PL10 are genes that encode DEAD-box ATP-dependent RNA helicases, which are defined by nine conserved motifs, including the D-E-A-D (Asp-Glu-Ala-Asp) sequence, from which the family derives its name. [7]. These DEAD-box genes, found in all eukaryotes and most prokaryotes [8,9,10,11,12], are involved in diverse cellular processes including splicing, rRNA processing, RNA editing, translational initiation, mRNA degradation, and nuclear mRNA export [13].
DDX4/vasa proteins, which were originally identified in Drosophila [14], are expressed in both male and female germ cells [15]. Studies in both model and non-model organisms have demonstrated that vasa plays crucial roles in germline specification and gamete development across various Metazoan species. [1,16,17]. Therefore, vasa has long been regarded as a key molecular marker for research on germline development. It is important to note that vasa is only a member of a wider regulatory network responsible for germline maintenance and specification. This regulatory network also includes another DEAD-box gene, PL10 [18], which is important for germ cell specification in a wide range of eukaryotes, including Hydra, planaria, Drosophila, and mammals [19,20,21,22]. However, increasingly, studies have highlighted that vasa and PL10, previously known as germline markers, are also expressed in multipotent stem cells with the potential to generate both somatic and germline lineages [2,3,4,5,23,24,25]. Research on the expression of these “germline factors” outside of the germline has sparked a reevaluation of the traditional germline/soma paradigm [26].
Pacific abalone (H. discus hannai) is an economically important abalone species that is widely cultivated in China. Despite the ongoing growth in production, several critical issues, such as gonad precocity, impact the abalone farming industry [27]. To combat this problem, transient silencing of “germline factor” mRNA in mollusks has been found to impede germ cell development in the gonads. [28]. The application of these techniques requires the identification of genes associated with germ cell development, particularly those crucial for the formation of primordial germ cells (PGCs), from which germ cells arise during early organismal development [29]. DEAD-box family genes have been identified as being related to gonadal development in many mollusk species [30,31,32]. However, the expression patterns of DEAD-box family genes like vasa and PL10 in abalone are still limited.
In the present study, we isolated and characterized the mRNA distribution of vasa and PL10 in various tissues from adult organisms by RT-qPCR. Furthermore, we also characterized the spatial and temporal expression of vasa and PL10 during embryonic and larval development using the WMISH and RT-qPCR techniques. We show here that, in H. discus hannai, vasa and PL10 mRNA are not solely restricted to gonads but are widely expressed in various tissues, suggesting that they are not limited to animal germlines but may also participate in diverse biological processes. Hdh-vasa and Hdh-PL10 exhibit significant overlap, as both are broadly expressed during early embryonic development. During late embryogenesis stages, Hdh-vasa and Hdh-PL10 are restricted to specific cells. These findings imply that the primary mechanism of PGC determination in H. discus hannai is governed by inductive signals (epigenesis).

2. Materials and Methods

2.1. Animals and Tissue Collection

The H. discus hannai were grown at the Fuda Abalone Farm (Jinjiang, China). A total of six healthy adult individuals (three males and three females, one year old) were randomly collected and euthanized, and samples of several tissues (pedal, mantle, gill, hepatopancreas, blood, and intestine) were extracted and stored at −80 °C (n = 3, 3 biological replicates per tissue). The developmental phases of the ovaries and testes in healthy adult individuals (1 years old, sexually mature) were divided into four stages based on histological observation: (i) proliferation (testes/ovaries in the proliferation phase), (ii) maturation (testes/ovaries in the maturation phase), (iii) ripe (testes/ovaries in the ripe phase), and (iv) spawning (testes/ovaries in the spawning phase). Six samples from each sex were collected at each stage.

2.2. Embryos and Larvae Collection

Thirty reproductively mature (three-year-old) Pacific abalone (20 females and 10 males), which were randomly collected from a single site at the Fuda Abalone Farm, were induced to spawn by UV-irradiated seawater (1000 mW h/L) and temperature shock [33]. Gametes were mixed together at concentrations sufficient to allow for fertilization. According to the morphological description by Lv et al. [34], various developmental stages, identified microscopically, were sampled, as follows: unfertilized eggs; 2-cell, 4-cell, 8-cell, 16-cell, 32-cell, 64-cell, and 128-cell embryos; morulas; gastrulas; intramembranous trochophores; extramembranous trochophores; early veliger larvae; metaphase veliger larvae; and anaphase veligers. A total of 100,000 embryos or larvae were sampled for each developmental stage.

2.3. RNA Isolation and Reverse Transcription

Total RNA was isolated from each sample using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA) and treated with 0.1 Unit/µL DNase I (Sigma, Kanagawa, Japan) to remove potential DNA contamination. For reverse transcription, 1 µg of total RNA was combined with 50 ng of random hexamers and 10 mM dNTPs and then heated to 65 °C for 5 min before being rapidly cooled on ice. Reverse transcription was performed in a 25 µL reaction with SuperScript™ III Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA), 5× First-Strand Buffer, 0.1 M DTT, and RNase inhibitor. The reaction was incubated at 25 °C for 10 min, followed by 50 °C for 60 min, and then heated to 70 °C for 15 min.

2.4. Cloning and Orthology Assignment of Vasa and PL10

Perform a BLASTX comparison of the vasa- and PL10-related cDNA sequences from various species on NCBI, prioritizing model organisms and mollusk-related sequences. Retrieve target gene sequences based on two criteria: high sequence similarity and presence of specific domains. Design primers specifically targeted the open reading frame (ORF) regions predicted by the transcriptome database. The primers for vasa and PL10 were designed as shown in Table 1. The PCR products were separated by electrophoresis on a 1% (w/v) agarose gel and visualized by staining with ethidium bromide. Bands of the expected size were subsequently extracted from the gel (QIAquick Gel Extraction Kit, Qiagen, Shanghai, China), cloned with pEASY®-Blunt E1 Expression Vector (TransGene, Beijing, China), and then sequenced. Full-length ORF sequences of vasa (GenBank accession no: PR891392) and PL10 (GenBank accession no: PP891393) were retrieved and analyzed using the BLAST tool (BLAST v2.11.0) in the NCBI database, confirming their orthology with other vasa and PL10 genes. Multiple amino acid (aa) sequences were aligned using ClustalW. Phylogenetic analysis was performed with the neighbor-joining (NJ) method in MEGA 3.1 [35], with distance datasets subjected to 1000 bootstrap replicates.

2.5. Selection of Suitable Reference Genes for RT-qPCR

Before conducting an RT-qPCR analysis of target genes, it is essential to identify reference genes. The expression of reference genes should be relatively stable, as this is crucial for correcting errors that may arise during the experiment, such as variations in the initial sample amounts, cDNA synthesis efficiency, and overall transcription efficiency in cells or tissues. Reliable reference genes are crucial for obtaining accurate relative quantification data.
The selection of the reference genes for the various tissues was based on the identification of eight candidate reference genes (ICG1-ICG8) from the transcriptome data of H. discus hannai by calculating the coefficient of variation (CV). Two commonly used reference genes (GAPDH and β-actin) were also used as candidate genes. Primer3 [36] was used to design the specific primers according to the transcriptome database. The ten candidate reference genes were amplified from H. discus hannai with the primer sequences listed in Table 2. To identify the optimal reference gene(s), we systematically evaluated the expression stability of 10 reference genes in multiple tissues from adult H. discus hannai using RT-qPCR. An integrated assessment of gene expression stability was performed using the following three different software tools: geNorm [37], NormFinder [38], and BestKeeper [39].
The selection of the candidate reference genes for the various embryonic developmental stages was based on the identification of five candidate reference genes (MZQ1–MZQ5) from the transcriptome data of H. discus hannai by calculating the coefficient of variation (CV). Two reference genes (UBE2 and RPL8) reported in a previous study [40] and three commonly used reference genes (GAPDH, β-actin, and 18S) were also used as candidate genes. The ten reference gene candidates were isolated from H. discus hannai using the primer sequences provided in Table 3. To select the suitable reference gene(s) for the gene expression analysis, H. discus hannai embryos and larvae in different developmental stages were used as materials to detect the expression levels of ten candidate reference genes by RT-qPCR. The method for analyzing the expression stability has been described above.

2.6. RT-qPCR

To assess the variations in the expression levels of Hdh-vasa and Hdh-PL10 quantitatively, we conducted an RT-qPCR analysis. The relative gene expression was determined using the 2−∆∆CT method for quantification. According to the stability value, reference genes were selected for the various tissues and embryonic developmental stages, and these genes were further analyzed to normalize the relative expression values. RT-qPCR was performed, in triplicate, with 5 µL cDNA (1/100 dilution) in a total volume of 20 µL with each primer at 0.5 µM, 2× FastStart Universal SYBR Green Master (ROX), and nuclease-free water (4 µL). The cycling program proceeded as follows: 10 min at 95 °C, followed by 40 cycles of 10 s at 95 °C and 30 s at 59 °C. Fluorescent signal intensities were measured after the cycles were completed.

2.7. WMISH

For the single-labeled WMISH assays, antisense RNA probes labeled with digoxigenin (DIG) were synthesized (Roche, Mannheim, Germany). Briefly, 1 µg of DNA template was transcribed in a 20 µL reaction mixture. The reaction was maintained at 37 °C for 2 h, then treated with RNase-free DNase I to eliminate the DNA template. The probes were synthesized using the selected inserts, which were cloned into the pGEM-T vector (Promega, Madison, WI, USA). The sequences of primers for the DIG-labeled RNA probes are listed in Table 4. Fixation, storage, preparation, and WMISH for the H. discus hannai larvae were performed according to previous studies [41]. The DIG-labeled probes were stained with an NBT/BCIP (nitro-blue-tetrazolium/5-bromo-4-chloro-3-inodlylphosphate) substrate [42]. All specimens were captured using a Leica M165C microscope equipped with DIC optics.

2.8. Statistics

Statistical analyses were carried out with one-way ANOVAs in SPSS 25.0 (IBM, Tulsa, OK, USA). The significance cut-off value was considered when p < 0.05.

3. Results

3.1. Cloning and Characterization of H. discus hannai Vasa and PL10

PCR amplification was used to isolate vasa and PL10 fragments from embryonic H. discus hannai cDNA. Sequence comparisons with NCBI databases revealed that these fragments are orthologous to the vasa and PL10 genes, respectively. Consequently, they were tentatively designated as Hdh-vasa and Hdh-PL10. The ORFs for Hdh-vasa and Hdh-PL10 encodes 853 aa and 749 aa, respectively; the ORF sequences can be found in GenBank under accession nos. PP891392 (Hdh-vasa) and PP891393 (Hdh-PL10). The predicted aa sequences of both Hdh-vasa and Hdh-PL10 shared all the nine motifs characteristic of the DEAD-box protein family (Q-motif, motif I, motif Ia, motif Ib, motif II, motif III, motif IV, motif V, and motif VI) (Figure 1 and Figure 2). The RG (arginine–glycine) and RGG (arginine-glycine-glycine) repeats at the N-terminal regions were both found in the Hdh-vasa and Hdh-PL10 (Figure 1 and Figure 2). An ARKF motif was also found in the vasa and PL10 (Figure 1 and Figure 2). The Hdh-vasa contains four tandem glycine-enriched sequences (Figure 1) and six tandem zinc-finger CCHC motifs (Figure 3) in its N-terminal region, which are absent in Hdh-PL10. Additionally, conserved Trp (W), Glu (E), and Asp (D) residues, characteristics of vasa family, are present in the C-terminal region of Hdh-vasa (Figure 1) but not in Hdh-PL10.
The vasa and PL10 subfamilies belong to the same gene family, and the aa sequences of these two genes were compared in one evolutionary tree together (Figure 4). Phylogenetic analysis of the DEAD-box gene family identified the following three distinct clusters: the vasa, PL10, and P68 subfamilies (Figure 4). Hdh-vasa grouped with vasa proteins from other species, exhibiting robust bootstrap support, while Hdh-PL10 clustered with other PL10 proteins. In the vasa clade, Hdh-vasa clustered together with two other proteins sequences of mollusk species Haliotis asinina (HasVasa) and Crassotrea gigas (OyVLG) (Figure 4). Within the PL10 clade, Hdh-PL10 clusters with another mollusk protein sequence of Azumapecten farreri (AfPL10) (Figure 4). Therefore, phylogenetic analysis corroborates the initial orthology assignments, indicating that Hdh-vasa and Hdh-PL10 belong to the vasa and PL10 subfamilies, respectively.

3.2. Evaluation of Expression Stability of the Reference Genes for the Various Tissues and Different Embryonic Stages of H. discus hannai

3.2.1. Selection of Reference Genes for Different Tissues

The expression levels of the ten candidate genes for different tissues were analyzed via RT-qPCR. The results of three statistical methods—GeNorm, NormFinder, and BestKeeper—are shown in Table 5. The GeNorm software assesses reference gene stability by calculating the average expression stability value (M) [37]. A lower M-value indicates greater expression stability. The software is set to a default critical value of 1.5. According to the analysis of GeNorm, the genes ICG1 (M = 1.157), ICG2 (M = 1.189), and ICG7 (M = 1.193) showed good stability, while β-actin (M = 1.577) displayed unstable characteristics. The NormFinder software evaluates candidate reference genes according to their stability value, which takes into account both intra- and inter-group variations [38]. The gene exhibiting the lowest stability value demonstrates the greatest stability. According to the NormFinder analysis, ICG1 (0.452) showed good stability. BestKeeper software assesses the stability of the reference gene’s expression using the correlation coefficient (r), standard deviation (SD), and coefficient of variation (CV) of the Cq values [39]. Higher r values and lower SD and CV values indicate a more stable expression. According to the analysis of the r values, ICG2 (0.796), ICG4 (0.755), and ICG1 (0.740) showed good stability. According to the analysis of the SD values, ICG1 (0.98), ICG6 (1.02), and ICG8 (1.06) showed good stability. According to the analysis of the CV values, ICG1 (3.71), ICG2 (4.19), and ICG8 (4.21) showed good stability. Based on the overall data, our findings show that ICG1, which encodes the predicted protein KIAA1143 homolog (GenBank code: XM_067796144.1), is a highly stable and reliable reference gene.

3.2.2. Selection of Candidate Reference Genes for Different Embryonic Developmental Stages

The expression levels of the ten candidate genes for different embryonic developmental stages were analyzed via RT-qPCR. The results of three statistical methods—GeNorm, NormFinder, and BestKeeper—are shown in Table 6. According to the analysis by GeNorm, MZQ1 (M = 0.964), MZQ4 (M = 1.023), and MZQ2 (M = 1.037) showed good stability, while MZQ5 (M = 1.505), 18s rRNA (M = 1.881), and β-actin (M = 1.703) displayed unstable characteristic. According to the analysis by NormFinder, MZQ1 (0.185), MZQ4 (0.202), and MZQ2 (0.258) showed good stability. According to the BestKeeper analysis of the r values, MZQ1 (0.959), MZQ4 (0.903), and MZQ2 (0.873) showed good stability. According to the analysis of the SD values, UBE2 (0.41), MZQ2 (0.70), and MZQ1 (0.72) showed good stability. According to the analysis of the CV values, UBE2 (1.80), MZQ2 (2.52), and MZQ4 (2.90) showed good stability. Based on the overall data, our finding showed that MZQ2, which encodes GPI-anchored glycoprotein, was a highly stable and reliable reference gene.

3.3. Tissue-Specific Expression of Hdh-Vasa and Hdh-PL10

To examine the tissue-specific expression of Hdh-vasa and Hdh-PL10, the pedal, mantle, gill, hepatopancreas, blood, intestine, and gonads were extracted from H. discus hannai. Interestingly, Hdh-vasa and Hdh-PL10 were not only expressed in the gonads, but also in the somatic tissues (Figure 5). Hdh-vasa exhibited high expression in the testes and hepatopancreas while showing low expression in the ovaries, pedal, mantle, gill, and intestine. Hdh-PL10 showed high expression in the ovaries, gill, mantle, and testes, while its expression was low in the pedal, hepatopancreas, and intestines (Figure 5). Interestingly, the expression of both Hdh-vasa and Hdh-PL10 in the testes increased gradually during the spermatogenesis progress (from proliferative M to ripe M) and then decreased dramatically in spawning M phase. However, we did not observe this expression trend during oogenesis in both genes, although Hdh-PL10 was expressed at a high level in the ovaries (Figure 5).

3.4. Spatiotemporal Expression of Hdh-Vasa and Hdh-PL10 Throughout Embryonic and Larval Development

The expression of Hdh-vasa and Hdh-PL10 was analyzed during embryonic and larval development using WMISH (Figure 6 and Figure 7) and RT-qPCR (Figure 8). Hdh-vasa was initially observed in the unfertilized egg, primarily in the central region of the animal hemisphere and the animal portion of the vegetal hemisphere (Figure 6A). After the first cleavage, Hdh-vasa maintained the same localization pattern in each daughter cell, as observed in the unfertilized egg (Figure 6B). As cleavage progressed to the 4-cell stage, Hdh-vasa expression was present in all cells (Figure 6C). At the 8-cell stage, when four vegetal macromeres and four animal micromeres formed, Hdh-vasa transcripts were predominantly found in the micromeres (Figure 6D). This expression pattern persisted through the sixth cleavage, continuing into the 64-cell embryos (Figure 6E). Interestingly, at the gastrulation stage, the Hdh-vasa signals were found in the mesodermal region of the larva, showing strong expression in two bilaterally symmetric paraxial clusters (Figure 6F). After the formation and hatching of the trochophore larva, Hdh-vasa expression continued the same bilaterally symmetrical expressional pattern, localizing ventrally in the posttrochal mesodermal region (Figure 6G). As trochophore development to early veliger, Hdh-vasa expression was localized to the ventral foot and mantle region, near visceral mass region (Figure 6H). In metaphase veliger stage, Hdh-vasa expression spread to the entire foot and head regions, and the positive signal was weak (Figure 6I). The RT-qPCR during the embryonic and larval stages showed that Hdh-vasa was highly expressed in unfertilized oocytes. The level of its expression declined gradually throughout embryonic and larval development. During the veliger stages, the level of Hdh-vasa mRNA expression dropped significantly relative to earlier stages (Figure 8).
Current evidence suggests that vasa-like genes evolved from a subset of helicases within the PL10 family [19]. Based on this, we opted to investigate the expression of Hdh-PL10 to further explore the underlying relationship between Hdh-vasa and Hdh-PL10. From the unfertilized egg to the 64-cell stage (Figure 7A–E), the expression pattern of Hdh-PL10 closely resembled that of Hdh-vasa. In the gastrulation stage, the Hdh-PL10 signals were dispersed throughout the entire endodermal region (Figure 7F). In the trochophore stage, Hdh-PL10 appeared to be expressed in ventrolateral ectoderm on either side of the presumptive midline, located in both pretrochal and posttrochal regions (Figure 7G). As trochophore development to early veliger, Hdh-PL10 expression was confined to extensive areas surrounding the foot and mantle regions. (Figure 7H). This expression pattern was maintained to the metaphase veliger stage, with the Hdh-PL10 transcripts being more concentrated in the foot region (Figure 7I). The expression levels of Hdh-PL10 mRNA during the embryonic and larval stages, as determined by RT-qPCR, revealed that the Hdh-PL10 transcripts were detectable from unfertilized egg through to the anaphase veliger stage, reaching a peak by the 8-cell and trochophore stages (Figure 8).

4. Discussion

The DEAD-box protein family contains nine highly conserved motifs, which are conserved across invertebrates and vertebrates [43]. Four of these motifs are recognized for their involvement the known functions of DEAD-box proteins, particularly in the activity of eIF-4A [44]. These proteins are believed to exhibit ATP-dependent RNA helicase activity, mediated by the ATP-A (AXXGXGKT) and ATP-B (DEAD) motifs, as well as to contribute to RNA unwinding, as indicated by the SAT and HRIGR motifs. The predicted aa sequences of Hdh-vasa and Hdh-PL10 contained these conserved domains, including both ATP-B (DEAD) and ATP-A (AQTGSGKT) motifs, along with the HRIGR and SAT motifs associated with RNA helicase activity. Multiple repeats of the RG and RGG motifs, which are putative RNA-binding motifs [45,46,47], were present in the N-terminal regions of both Hdh-vasa and Hdh-PL10. An ARKF motif, known as a characteristic feature of the vasa family [48], was also found in vasa and PL10. Therefore, these data strongly suggest that the characterized Hdh-vasa and Hdh-PL10 sequences encode protein members of the DEAD-box family, exhibiting RNA-binding, ATPase, and helicase activities. Additionally, certain sequence features were present only in vasa and were not observed in PL10. A glycine (G)-rich region was present in the N-terminal site of Hdh-vasa, which is also found in a number of putative RNA-binding proteins [8]. In the C-terminal region of Hdh-vasa, six of the last eight aa were acidic (glutamate or aspartate residues), a feature commonly observed in various single-stranded nucleic-acid-binding proteins [46]. These discrepancies between Hdh-vasa and Hdh-PL10 may contribute to variations in their expression patterns and functional properties.
Vasa and PL10 are key components of an extensive regulatory network that plays a crucial role in the maintenance of germ stem cells, as well as in germline specification and differentiation. For this reason, it is expected that these two genes are predominantly expressed in germline cells, a phenomenon that has been extensively documented in previous studies [15,16,17,18,19,20,21,22]. For instance, in mollusks, as in other studied phyla, vasa-related genes are uniquely expressed in germline cells and are widely recognized as key germline markers [11,31,32,49,50]. Similarly, PL10 is highly expressed in germline cells, from mammals such as mice to lower organisms like Hydra [19,51]. In our study, these two genes are expressed in both gonads (male and female) at all stages of adult development. The distinction is that vasa was highly expressed in the testes, whereas PL10 exhibited high expression levels in both the ovaries and testes. Notably, the expression levels of Hdh-vasa and Hdh-PL10 both increased gradually during male gonadal development (from proliferative M stage to ripe M stage), implying that both genes function synergistically in the development of spermatogenesis in H. discus hannai. Indeed, the role of these two genes and its homologues in spermatogenesis have been extensively reported in model animals [51,52,53,54].
However, it is important to note that the expression of Hdh-vasa was not restricted solely to the gonads but was also present in other tissues, including the hepatopancreas, pedal, mantle, gills, and intestines. The mRNA of Hdh-PL10 was also not limited to the gonads but widely expressed in other tissues, including gill, mantle pedal, hepatopancreas, and intestine. The tissue expression pattern may reflect that the function of vasa and PL10 are not limited to animal germlines but may also play diverse roles and participate in various biological processes in H. discus hannai. Studies in other animal species have shown that vasa and PL10 genes play crucial roles in multipotent stem cells contributing to both somatic and germline lineages [55]. In Hydra, vasa and PL10 are expressed in interstitial cells [19] and ectodermal epithelial cells [56,57], which generate germ cells and diverse somatic types. Similarly, in Clytia hemisphaerica, vasa and PL10 are found in somatic stem cells located at the tentacle bulb base, from which tentacle nematocytes are derived [2]. In summary, our findings show that vasa and PL10 are widely expressed in various tissues, suggesting they are linked to multipotent stem cells involved in essential biological processes beyond gametogenesis in H. discus hannai. Therefore, caution is recommended when utilizing them as adult germline markers for exploratory studies of this species.
Maternally inherited RNA and proteins control much of embryonic development, and these genes are referred to as maternal-effect genes. The effect of these mechanisms have been identified for a wide range of organisms [58,59,60,61,62]. Understanding the role of maternal effects is important for gaining insight into the basic mechanisms of inheritance. RT-qPCR analysis showed that Hdh-vasa expression peaked in unfertilized eggs and early development, then declined significantly in later stages. WMISH results also showed a large amount of Hdh-vasa observed in unfertilized oocytes and in first cleavage stage. Although Hdh-PL10 exhibited a distinct developmental expression pattern, its abundant mRNA expression in unfertilized oocytes and at the first cleavage stage, is similar to vasa. Molluscan embryonic genome transcription initiates during the gastrula stage [63], with early developmental processes primarily relying on maternal genome-derived transcripts. Therefore, our results implied that Hdh-vasa and Hdh-PL10 transcripts were maternally synthesized and, subsequently, transmitted to embryos to support early development. This suggests that Hdh-vasa and Hdh-PL10 are potential maternal-effect genes in H. discus hannai. In Drosophila, Danio rerio and Hydra, vasa-related genes, have been demonstrated to be maternally inherited, playing a key role in germline differentiation during embryonic development prior to the onset of zygotic gene expression [19,46,64]. However, further mutation validation experiments are required to ascertain whether Hdh-vasa and Hdh-PL10 function as maternal-effect genes.
PGCs are the earliest germ cells distinguishable from somatic cells during embryonic development. Germline development involves the specification and survival of PGCs during embryogenesis, as well as the sustained production of gametes throughout the adult reproductive lifespan. These processes are considered essential across all Metazoans [65]. PGC specification is typically categorized into the following two mechanisms: preformation (determinative mode), where PGCs are established early in development through maternally inherited factors, and epigenesis (inductive mode), where germ cells are not identifiable until later stages and arise through inductive signals from neighboring somatic cells [66]. Transcripts of many genes have been identified as germ plasm components, a granular cytoplasmic material that serves as a useful marker for identifying PGCs in many animal species [29]. Among these, vasa is a useful molecular marker and conserved across a wide range of animal classes [1]. Unlike traditional examples of preformation, where germ-cell-specific molecules (such as germ plasm components) are asymmetrically distributed to specific regions of the early embryo [67,68], vasa transcripts were located in all micromeres during the first six cleavages divisions in H. discus hannai. Instead, it was during late embryogenesis and the gastrulation stage that Hdh-vasa become restricted to specific cells. Given that Hdh-vasa is broadly expressed in the early embryo and symmetrically inherited during the initial cleavage stages, it seems improbable that the determination of PGCs in H. discus hannai is solely dependent on maternally inherited factors. Consequently, we propose that PGC establishment in H. discus hannai is more likely driven by inductive signals, following an epigenetic mode of regulation. We hypothesize the presence of undifferentiated multipotent cells expressing Hdh-PL10, which may play a broader role in stem cell function during early H. discus hannai embryogenesis. Hdh-vasa-expressing cells may constitute a subpopulation of these multipotent cells, which have the potential to give rise to both mesodermal tissue and PGCs. In this context, PGCs are determined from vasa-expressing cells at a certain stage of development. The co-expression of germ cell and stem cell markers is also observed in other organisms [19,24,69].
In the equally cleaving vetigastropod H. asinina, a similar pattern was observed, with vasa progressively enriching in the dorsal quadrant of the embryo, and PGC specification following an inductive signals (epigenesis) mechanism [50]. This “progressive restriction” could represent an ancestral mechanism of germ cell specification.

5. Conclusions

In conclusion, this study provides novel insights into the roles of Hdh-vasa and Hdh-PL10, members of the DEAD-box gene family, in germline development in H. discus hannai. Notably, the broad tissue expression patterns of these genes, beyond the gonads, suggest additional roles in multipotent stem cells and other biological processes. The maternal inheritance of Hdh-vasa and Hdh-PL10, alongside their significant expression in early developmental stages, supports their potential as maternal-effect genes that contribute to early embryonic development. Furthermore, the distinctive expression dynamics of Hdh-vasa, which is not asymmetrically inherited but rather gradually restricted during later development, suggest that PGC determination in H. discus hannai follows an epigenetic mode of regulation, driven by inductive signals.
In the future, further investigation into the interactions between Hdh-vasa, Hdh-PL10, and other key regulatory factors will shed light on their roles in embryonic development and germ cell formation. RNAi-mediated knockdown of vasa and PL10 expression could help confirm their critical roles in germline cell specification and PGC formation. To gain a more comprehensive understanding of gene function, we could extend the sampling time to later developmental stages and apply advanced single-Cell transcriptomics to precisely capture gene expression dynamics with greater spatiotemporal resolution and reveal the regulation of Hdh-vasa and Hdh-PL10 in PGC formation, differentiation, and migration across different developmental stages. These studies will enhance our understanding of the functional roles of these genes in germ cell development and contribute to advancing research on PGCs.

Author Contributions

Conceptualization, F.C., C.K., M.L., Y.S. and M.H.; Data curation, F.C., W.W., M.L., Y.S., M.H., X.L. and W.Y.; Formal analysis, W.W.; Funding acquisition, F.C. and C.K.; Investigation, F.C., W.W., M.L., Y.S., M.H., X.L. and W.Y.; Methodology, W.W., M.L., Y.S. and M.H.; Project administration, F.C. and C.K.; Resources, Y.S., M.H., X.L. and W.Y.; Supervision, C.K.; Validation, F.C.; Visualization, W.W.; Writing—original draft, F.C. and W.W.; Writing—review and editing, F.C., C.K., M.L., Y.S., M.H., X.L. and W.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by a grant from the National Natural Science Foundation of China (U22A20530), Natural Science Foundation of Fujian Province, China (2021J01604), the National Natural Science Foundation of China (32100586), and China Agriculture Research System (No. CARS-49).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All relevant data are available from the corresponding author upon reasonable request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Raz, E. The function and regulation of vasa-like genes in germ-cell development. Genome Biol. 2000, 1, 1–6. [Google Scholar] [CrossRef]
  2. Leclère, L.; Jager, M.; Barreau, C.; Chang, P.; Le Guyader, H.; Manuel, M.; Houliston, E. Maternally localized germ plasm mRNAs and germ cell/stem cell formation in the cnidarian Clytia. Dev. Biol. 2012, 364, 236–248. [Google Scholar] [CrossRef] [PubMed]
  3. Kozin, V.V.; Kostyuchenko, R.P. Vasa, PL10, and Piwi gene expression during caudal regeneration of the polychaete annelid Alitta virens. Dev. Genes Evol. 2015, 225, 129–138. [Google Scholar] [CrossRef] [PubMed]
  4. Siebert, S.; Goetz, F.; Church, S.; Bhattacharyya, P.; Zapata, F.; Haddock, S.; Dunn, C. Stem cells in Nanomia bijuga (Siphonophora), a colonial animal with localized growth zones. EvoDevo 2015, 6, 22. [Google Scholar] [CrossRef]
  5. Fierro-Constaín, L.; Schenkelaars, Q.; Gazave, E.; Haguenauer, A.; Rocher, C.; Ereskovsky, A.; Borchiellini, C.; Renard, E. The Conservation of the Germline Multipotency Program, from Sponges to Vertebrates: A Stepping Stone to Understanding the Somatic and Germline Origins. Genome Biol. Evol. 2017, 9, 474–488. [Google Scholar] [CrossRef]
  6. Wang, Q.; Fang, D.A.; Sun, J.L.; Wang, Y.; Wang, J.; Liu, L.H. Characterization of the vasa gene in the Chinese mitten crab Eriocheir sinensis: A germ line molecular marker. J. Insect Physiol. 2012, 58, 960–965. [Google Scholar] [CrossRef]
  7. Linder, P.; Lasko, P.F.; Ashburner, M.; Leroy, P.; Nielsen, P.J.; Nishi, K.; Schnier, J.; Slonimski, P.P. Birth of the D-E-A-D box. Nature 1989, 337, 121–122. [Google Scholar] [CrossRef]
  8. Schmid, S.R.; Linder, P. D-E-A-D protein family of putative RNA helicases. Mol. Microbiol. 1992, 6, 283–292. [Google Scholar] [CrossRef] [PubMed]
  9. Fujiwara, Y.; Komiya, T.; Kawabata, H.; Sato, M.; Fujimoto, H.; Furusawa, M.; Noce, T. Isolation of a DEAD-family protein gene that encodes a murine homolog of Drosophila vasa and its specific expression in germ cell lineage. Proc. Natl. Acad. Sci. USA 1995, 91, 12258–12262. [Google Scholar] [CrossRef]
  10. Komiya, T.; Itoh, K.; Ikenishi, K.; Furusawa, M. Isolation and Characterization of a Novel Gene of the DEAD Box Protein Family Which Is Specifically Expressed in Germ Cells of Xenopus laevis. Dev. Biol. 1994, 162, 354–363. [Google Scholar] [CrossRef]
  11. Fabioux, C.; Pouvreau, S.; Le Roux, F.; Huvet, A. The oyster vasa-like gene: A specific marker of the germline in Crassostrea gigas. Biochem. Biophys. Res. Commun. 2004, 315, 897–904. [Google Scholar] [CrossRef]
  12. Zhou, Q.R.; Shao, M.Y.; Qin, Z.K.; Kang, Q.H.; Zhang, Z.F. Cloning, characterization, and expression analysis of the DEAD-box family genes, Fc-vasa and Fc-PL10a, in Chinese shrimp (Fenneropenaeus chinensis). Chin. J. Oceanol. Limnol. 2010, 28, 37–45. [Google Scholar] [CrossRef]
  13. Lüking, A.; Stahl, U.; Schmidt, U. The protein family of RNA helicases. Crit. Rev. Biochem. Mol. Biol. 1998, 33, 259–296. [Google Scholar] [CrossRef] [PubMed]
  14. Schüpbach, T.; Wieschaus, E. Maternal-effect mutations altering the anterior-posterior pattern of the Drosophila embryo. Rouxs Arch. Dev. Biol. Off. Organ Edbo 1986, 195, 302–317. [Google Scholar] [CrossRef]
  15. Lasko, F.P.; Ashburner, M. The product of the Drosophila gene vasa is very similar to eukaryotic initiation factor-4A. Nature 1988, 335, 611–617. [Google Scholar] [CrossRef] [PubMed]
  16. Adashev, V.E.; Kotov, A.A.; Olenina, L.V. RNA Helicase Vasa as a Multifunctional Conservative Regulator of Gametogenesis in Eukaryotes. Curr. Issues Mol. Biol. 2023, 45, 5677–5705. [Google Scholar] [CrossRef]
  17. Yu, M.; Wang, F.Y.; Li, M.; Wang, Y.; Gao, X.Z.; Zhang, H.H.; Liu, Z.Z.; Zhou, Z.C.; Zhao, D.Q.; Zhang, M.; et al. Characteristics of the Vasa Gene in Silurus asotus and Its Expression Response to Letrozole Treatment. Genes 2024, 15, 756. [Google Scholar] [CrossRef]
  18. Linder, P. Yeast RNA helicases of the DEAD-box family involved in translation initiation. Biol. Cell 2003, 95, 157–167. [Google Scholar] [CrossRef]
  19. Mochizuki, K.; Nishimiya-Fujisawa, C.; Fujisawa, T. Universal occurrence of the vasa-related genes among metazoans and their germline expression in Hydra. Dev. Genes Evol. 2001, 211, 299–308. [Google Scholar] [CrossRef]
  20. Solana, J.; Romero, R. SpolvlgA is a DDX3/PL10-related DEAD-box RNA helicase expressed in blastomeres and embryonic cells in planarian embryonic development. Int. J. Biol. Sci. 2009, 5, 64–73. [Google Scholar] [CrossRef]
  21. Kotov, A.A.; Olenkina, O.M.; Kibanov, M.V.; Olenina, L.V. RNA helicase Belle (DDX3) is essential for male germline stem cell maintenance and division in Drosophila. Biochim. Biophys. Acta 2016, 1863 Pt A, 1093–1105. [Google Scholar] [CrossRef]
  22. Abdelhaleem, M. RNA helicases: Regulators of differentiation. Clin. Biochem. 2005, 38, 499–503. [Google Scholar] [CrossRef]
  23. Yajima, M.; Wessel, G.M. Essential elements for translation: The germline factor Vasa functions broadly in somatic cells. Development 2015, 142, 1960–1970. [Google Scholar] [CrossRef] [PubMed]
  24. Shibata, N.; Umesono, Y.; Orii, H.; Sakurai, T.; Watanabe, K.; Agata, K. Expression of vasa(vas)-Related Genes in Germline Cells and Totipotent Somatic Stem Cells of Planarians. Dev. Biol. 1999, 206, 73–87. [Google Scholar] [CrossRef]
  25. Rebscher, N.; Zelada-González, F.; Banisch, T.U.; Raible, F.; Arendt, D. Vasa unveils a common origin of germ cells and of somatic stem cells from the posterior growth zone in the polychaete Platynereis dumerilii. Dev. Biol. 2007, 306, 599–611. [Google Scholar] [CrossRef] [PubMed]
  26. Solana, J. Closing the circle of germline and stem cells: The Primordial Stem Cell hypothesis. EvoDevo 2013, 4, 2. [Google Scholar] [CrossRef]
  27. Li, W.D.; Huang, M.; Lü, W.G.; Chen, X.; Shen, M.H.; Li, X.M.; Wang, R.X.; Ke, C.H. Involvement of Antizyme Characterized from the Small Abalone Haliotis diversicolor in Gonadal Development. PLoS ONE 2015, 10, e0135251. [Google Scholar] [CrossRef]
  28. Fabioux, C.; Corporeau, C.; Quillien, V.; Favrel, P.; Huvet, A. In vivo RNA interference in oyster—vasa silencing inhibits germ cell development. FEBS J. 2009, 276, 2566–2573. [Google Scholar] [CrossRef] [PubMed]
  29. Saffman, E.E.; Lasko, P. Germline development in vertebrates and invertebrates. Cell. Mol. Life Sci. 1999, 55, 1141–1163. [Google Scholar] [CrossRef]
  30. Fabioux, C.; Huvet, A.; Lelong, C.; Robert, R.; Pouvreau, S.; Daniel, J.Y.; Minguant, C.; Le Pennec, M. Oyster vasa-like gene as a marker of the germline cell development in Crassostrea gigas. Biochem. Biophys. Res. Commun. 2004, 320, 592–598. [Google Scholar] [CrossRef]
  31. Swartz, S.Z.; Chan, X.Y.; Lambert, J.D. Localization of Vasa mRNA during early cleavage of the snail Ilyanassa. Dev. Genes Evol. 2008, 218, 107–113. [Google Scholar] [CrossRef] [PubMed]
  32. Obata, M.; Sano, N.; Kimata, S.; Nagasawa, K.; Yoshizaki, G.; Komaru, A. The proliferation and migration of immature germ cells in the mussel, Mytilus galloprovincialis: Observation of the expression pattern in the M. galloprovincialis vasa-like gene (Myvlg) by in situ hybridization. Dev. Genes Evol. 2010, 220, 139–149. [Google Scholar] [CrossRef] [PubMed]
  33. You, W.W.; Guo, Q.; Fan, F.L.; Ren, P.; Luo, X.; Ke, C.H. Experimental hybridization and genetic identification of Pacific abalone Haliotis discus hannai and green abalone H. Fulgens. Aquaculture 2015, 448, 243–249. [Google Scholar] [CrossRef]
  34. Lv, J. Embryonic development of abalone (Haliotis Diversicolor Reeve). Acta Zool. Sin. 2001, 47, 317–323. [Google Scholar]
  35. Kumar, S.; Tamura, K.; Jakobsen, I.B.; Nei, M. MEGA2: Molecular evolutionary genetics analysis software. Bioinformatics 2001, 17, 1244. [Google Scholar] [CrossRef]
  36. Kõressaar, T.; Lepamets, M.; Kaplinski, L.; Raime, K.; Andreson, R.; Remm, M. Primer3_masker: Integrating masking of template sequence with primer design software. Bioinformatics 2018, 34, 1937–1938. [Google Scholar] [CrossRef]
  37. Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, 00341–003411. [Google Scholar] [CrossRef]
  38. Andersen, C.L.; Jensen, J.L.; Ørntoft, T.F. Normalization of Real-Time Quantitative Reverse Transcription-PCR Data: A Model-Based Variance Estimation Approach to Identify Genes Suited for Normalization, Applied to Bladder and Colon Cancer Data Sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef]
  39. Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
  40. Lee, S.Y.; Nam, Y.K. Transcriptional responses of metallothionein gene to different stress factors in Pacific abalone (Haliotis discus hannai). Fish Shellfish Immunol. 2016, 58, 530–541. [Google Scholar] [CrossRef]
  41. Williams, E.A.; Degnan, B.M.; Gunter, H.; Jackson, D.J.; Woodcroft, B.J.; Degnan, S.M. Widespread transcriptional changes pre-empt the critical pelagic-benthic transition in the vetigastropod Haliotis asinina. Mol. Ecol. 2009, 18, 1006–1025. [Google Scholar] [CrossRef]
  42. Hauptmann, G.; Gerster, T. Two-color whole-mount in situ hybridization to vertebrate and Drosophila embryos. Trends Genet. 1994, 10, 266. [Google Scholar] [PubMed]
  43. Cordin, O.; Banroques, J.; Tanner, N.K.; Linder, P. The DEAD-box protein family of RNA helicases. Gene 2006, 367, 17–37. [Google Scholar] [CrossRef]
  44. Svitkin, Y.V.; Pause, A.; Haghighat, A.; Pyronnet, S.; Witherell, G.; Belsham, G.J.; Sonenberg, N. The requirement for eukaryotic initiation factor 4A (elF4A) in translation is in direct proportion to the degree of mRNA 5′ secondary structure. RNA 2001, 7, 382–394. [Google Scholar] [CrossRef] [PubMed]
  45. Walker, J.E.; Saraste, M.; Runswick, M.J.; Gay, N.J. Distantly related sequences in the α- and β-subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold. EMBO J. 1982, 1, 945–951. [Google Scholar] [CrossRef] [PubMed]
  46. Hay, B.; Jan, L.Y.; Jan, Y.N. A protein component of Drosophila polar granules is encoded by vasa and has extensive sequence similarity to ATP-dependent helicases. Cell 1988, 55, 577–587. [Google Scholar] [CrossRef]
  47. Liang, L.; Diehl-Jones, W.; Lasko, P. Localization of vasa protein to the Drosophila pole plasm is independent of its RNA-binding and helicase activities. Development 1994, 120, 1201–1211. [Google Scholar] [CrossRef]
  48. Chang, C.C.; Dearden, P.; Akam, M. Germ line development in the grasshopper Schistocerca gregaria: Vasa as a marker. Dev. Biol. 2002, 252, 100–118. [Google Scholar] [CrossRef]
  49. Kakoi, S.; Kin, K.; Miyazaki, K.; Wada, H. Early Development of the Japanese Spiny Oyster (Saccostrea kegaki): Characterization of Some Genetic Markers. Zool. Sci. 2008, 25, 455–464. [Google Scholar] [CrossRef]
  50. Kranz, A.M.; Tollenaere, A.; Norris, B.J.; Degnan, B.M.; Degnan, S.M. Identifying the germline in an equally cleaving mollusc: Vasa and Nanos expression during embryonic and larval development of the vetigastropod Haliotis asinina. J. Exp. Zool. Part B Mol. Dev. Evol. 2010, 314, 267–279. [Google Scholar] [CrossRef]
  51. Leroy, P.; Alzari, P.; Sassoon, D.; Wolgemuth, D.; Fellous, M. The protein encoded by a murine male germ cell-specific transcript is a putative ATP-dependent RNA helicase. Cell 1989, 57, 549–559. [Google Scholar] [CrossRef]
  52. Carlo, F.; Alberto, F.; Enrico, M. Deletion and expression analysis of AZFa genes on the human Y chromosome revealed a major role for DBY in male infertility. Hum. Mol. Genet. 2000, 9, 1161–1169. [Google Scholar]
  53. Johnstone, O.; Deuring, R.; Bock, R.; Linder, P.; Fuller, M.T.; Lasko, P. Belle is a Drosophila DEAD-box protein required for viability and in the germ line. Dev. Biol. 2005, 277, 92–101. [Google Scholar] [CrossRef]
  54. Milani, L.; Cinelli, F.; Iannello, M.; Lazzari, M.; Franceschini, V.; Maurizii, M.G. Immunolocalization of Vasa, PIWI, and TDRKH proteins in male germ cells during spermatogenesis of the teleost fish Poecilia reticulata. Acta Histochem. 2022, 124, 151870. [Google Scholar] [CrossRef]
  55. Alié, A.; Leclère, L.; Jager, M.; Dayraud, C.; Chang, P.; Le Guyader, H.; Quéinnec, E.; Manuel, M. Somatic stem cells express Piwi and Vasa genes in an adult ctenophore: Ancient association of “germline genes” with stemness. Dev. Biol. 2010, 350, 183–197. [Google Scholar] [CrossRef] [PubMed]
  56. Bosch, T.C.G. Hydra and the evolution of stem cells. Bioessays 2010, 31, 478–486. [Google Scholar] [CrossRef] [PubMed]
  57. Bosch, T.C.; Anton-Erxleben, F.; Hemmrich, G.; Khalturin, K. The Hydra polyp: Nothing but an active stem cell community. Dev. Growth Differ. 2010, 52, 15–25. [Google Scholar] [CrossRef]
  58. Bowerman, B. 3 Maternal Control of Pattern Formation in Early Caenorhabditis elegans Embryos. Curr. Top. Dev. Biol. 1998, 39, 73–117. [Google Scholar]
  59. Luschnig, S.; Moussian, B.; Krauss, J.; Desjeux, I.; Perkovic, J.; Nüsslein-Volhard, C. An F1 Genetic Screen for Maternal-Effect Mutations Affecting Embryonic Pattern Formation in Drosophila melanogaster. Genetics 2004, 167, 325–342. [Google Scholar] [CrossRef]
  60. Droin, A. The developmental mutants of Xenopus. Int. J. Dev. Biol. 1993, 36, 455–464. [Google Scholar]
  61. Dosch, R. Next generation mothers: Maternal control of germline development in zebrafish. Crit. Rev. Biochem. Mol. Biol. 2015, 50, 54. [Google Scholar] [CrossRef] [PubMed]
  62. Condic, M.L. The Role of Maternal-Effect Genes in Mammalian Development: Are Mammalian Embryos Really an Exception? Stem. Cell Rev. 2016, 12, 276–284. [Google Scholar] [CrossRef]
  63. Andéol, Y. Early transcription in different animal species: Implication for transition from maternal to zygotic control in development. Roux’s Arch. Dev. Biol. 1994, 204, 3–10. [Google Scholar] [CrossRef]
  64. Knaut, H.; Pelegri, F.; Bohmann, K.; Schwarz, H.; Nüsslein-Volhard, C. Zebrafish vasa RNA but Not Its Protein Is a Component of the Germ Plasm and Segregates Asymmetrically before Germline Specification. J. Cell Biol. 2000, 149, 875–888. [Google Scholar] [CrossRef]
  65. Raz, E. Primordial Germ-Cell Development: The Zebrafish Perspective. Nat. Rev. Genet. 2003, 4, 690–700. [Google Scholar] [CrossRef]
  66. Extavour, C.; Akam, M. Mechanisms of Germ Cell Specification Across the Metazoans: Epigenesis and Preformation. Development 2003, 130, 5869–5884. [Google Scholar] [CrossRef] [PubMed]
  67. Yoon, C.; Kawakami, K.; Hopkins, N. Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells. Development 1997, 124, 3157–3165. [Google Scholar] [CrossRef] [PubMed]
  68. Fujimura, M.; Takamura, K. Characterization of an ascidian DEAD-box gene, Ci-DEAD1: Specific expression in the germ cells and its mRNA localization in the posterior-most blastomeres in early embryos. Dev. Genes Evol. 2000, 210, 64–72. [Google Scholar] [CrossRef]
  69. Mochizuki, K.; Sano, H.; Kobayashi, S.; Nishimiya-Fujisawa, C.; Fujisawa, T. Expression and evolutionary conservation of nanos-related genes in Hydra. Dev. Genes Evol. 2000, 210, 591–602. [Google Scholar] [CrossRef]
Genes 16 00329 g001
Figure 1. The ORF and deduced aa sequence of Hdh-vasa. Nine conserved motifs characteristic of the DEAD-box protein family (Q-motif, motif I, motif Ia, motif Ib, motif II, motif III, motif IV, motif V, and motif VI) are highlighted in yellow. RG repeats and RGG repeats are underlined. The ARKF motif is underlined with a wavy line. Four tandemly arranged glycine-enriched sequences in the N-terminal region are shaded in grey. C-terminal regions containing the conserved E, D, and W residues are indicated in red.
Figure 1. The ORF and deduced aa sequence of Hdh-vasa. Nine conserved motifs characteristic of the DEAD-box protein family (Q-motif, motif I, motif Ia, motif Ib, motif II, motif III, motif IV, motif V, and motif VI) are highlighted in yellow. RG repeats and RGG repeats are underlined. The ARKF motif is underlined with a wavy line. Four tandemly arranged glycine-enriched sequences in the N-terminal region are shaded in grey. C-terminal regions containing the conserved E, D, and W residues are indicated in red.
Genes 16 00329 g001
Genes 16 00329 g002
Figure 2. The ORF and deduced aa sequence of Hdh-PL10. Nine conserved motifs characteristic of the DEAD-box protein family (Q-motif, motif I, motif Ia, motif Ib, motif II, motif III, motif IV, motif V, and motif VI) are highlighted in yellow. RG repeats and RGG repeats are underlined. The ARKF motif is underlined with a wavy line.
Figure 2. The ORF and deduced aa sequence of Hdh-PL10. Nine conserved motifs characteristic of the DEAD-box protein family (Q-motif, motif I, motif Ia, motif Ib, motif II, motif III, motif IV, motif V, and motif VI) are highlighted in yellow. RG repeats and RGG repeats are underlined. The ARKF motif is underlined with a wavy line.
Genes 16 00329 g002
Genes 16 00329 g003
Figure 3. Zinc-finger motifs (CCHC) of the Hdh-vasa protein.
Figure 3. Zinc-finger motifs (CCHC) of the Hdh-vasa protein.
Genes 16 00329 g003
Genes 16 00329 g004
Figure 4. Phylogenetic analysis of vasa-related proteins. Each node displays the percentage values obtained from bootstrap analysis.
Figure 4. Phylogenetic analysis of vasa-related proteins. Each node displays the percentage values obtained from bootstrap analysis.
Genes 16 00329 g004
Genes 16 00329 g005
Figure 5. RT-qPCR results of various somatic tissues and gonads for (A) Hdh-vasa and (B) Hdh-PL10. The RT-qPCR values were determined relative to a reference sample, which included cDNA from all developmental stages involved in the experiment and were normalized against a reference gene index (ICG1). Significant differences are denoted by bars having distinct letters (p < 0.05). The error bars represent the standard error, which was calculated from three technical replicates.
Figure 5. RT-qPCR results of various somatic tissues and gonads for (A) Hdh-vasa and (B) Hdh-PL10. The RT-qPCR values were determined relative to a reference sample, which included cDNA from all developmental stages involved in the experiment and were normalized against a reference gene index (ICG1). Significant differences are denoted by bars having distinct letters (p < 0.05). The error bars represent the standard error, which was calculated from three technical replicates.
Genes 16 00329 g005
Genes 16 00329 g006
Figure 6. Expression of Hdh-vasa during embryonic and early larval development: (A–I) WMISH micrographs. (A–C) Lateral views—unfertilized egg (A), 2-cell embryo (B), and 4-cell embryo (C); (D,E) Lateral views, with the animal pole upwards and vegetal pole downwards; 8-cell embryo (D), 64-cell embryo (E); (F) Gastrulation stage, lateral view, with the animal pole upwards and vegetal pole downwards; black arrows indicate two positive signals; (G) trochophore stage, ventral view, with the pretrochal region upwards and the posttrochal region downwards; black dotted line indicates visceral mass, and black arrows indicate two positive signals; (H) Early veliger stage, right lateral view, the black dotted line indicates visceral mass, and black arrows indicate positive signals; (I) metaphase veliger stage, right lateral view, the white dotted line indicates positive signals. a, animal pole; ve, vegetal pole; pr, pretrochal region; ptr, posttrochal region; f, foot; vm, visceral mass; v, velum; m, mantle rudiment; and o, operculum. Scale bar: 200 μm.
Figure 6. Expression of Hdh-vasa during embryonic and early larval development: (A–I) WMISH micrographs. (A–C) Lateral views—unfertilized egg (A), 2-cell embryo (B), and 4-cell embryo (C); (D,E) Lateral views, with the animal pole upwards and vegetal pole downwards; 8-cell embryo (D), 64-cell embryo (E); (F) Gastrulation stage, lateral view, with the animal pole upwards and vegetal pole downwards; black arrows indicate two positive signals; (G) trochophore stage, ventral view, with the pretrochal region upwards and the posttrochal region downwards; black dotted line indicates visceral mass, and black arrows indicate two positive signals; (H) Early veliger stage, right lateral view, the black dotted line indicates visceral mass, and black arrows indicate positive signals; (I) metaphase veliger stage, right lateral view, the white dotted line indicates positive signals. a, animal pole; ve, vegetal pole; pr, pretrochal region; ptr, posttrochal region; f, foot; vm, visceral mass; v, velum; m, mantle rudiment; and o, operculum. Scale bar: 200 μm.
Genes 16 00329 g006
Genes 16 00329 g007
Figure 7. Expression of Hdh-PL10 during embryonic and early larval development. (A–I) Representative WMISH micrographs. (A–C) lateral views—unfertilized egg (A), 2-cell embryo (B), 4-cell embryo (C); (D,E) lateral views, with the animal pole upwards and vegetal pole downwards—8-cell embryo (D) and 64-cell embryo (E); (F) gastrulation stage, lateral view, with the animal pole upwards and vegetal pole downwards; the white dotted line indicates positive signals; (G) trochophore stage, ventral view, with the pretrochal region upwards and posttrochal region downwards; black dotted line indicates visceral mass and black arrows indicate positive signals; (H) early veliger stage, right lateral view; the black dotted line indicates visceral mass; (I) metaphase veliger stage, right lateral view. a, Animal pole; ve, vegetal pole; pr, pretrochal region; ptr, posttrochal region; f, foot; vm, visceral mass; v, velum; m, mantle rudiment; o, operculum. Scale bar: 200 μm.
Figure 7. Expression of Hdh-PL10 during embryonic and early larval development. (A–I) Representative WMISH micrographs. (A–C) lateral views—unfertilized egg (A), 2-cell embryo (B), 4-cell embryo (C); (D,E) lateral views, with the animal pole upwards and vegetal pole downwards—8-cell embryo (D) and 64-cell embryo (E); (F) gastrulation stage, lateral view, with the animal pole upwards and vegetal pole downwards; the white dotted line indicates positive signals; (G) trochophore stage, ventral view, with the pretrochal region upwards and posttrochal region downwards; black dotted line indicates visceral mass and black arrows indicate positive signals; (H) early veliger stage, right lateral view; the black dotted line indicates visceral mass; (I) metaphase veliger stage, right lateral view. a, Animal pole; ve, vegetal pole; pr, pretrochal region; ptr, posttrochal region; f, foot; vm, visceral mass; v, velum; m, mantle rudiment; o, operculum. Scale bar: 200 μm.
Genes 16 00329 g007
Genes 16 00329 g008
Figure 8. RT-qPCR results: (A) Hdh-vasa and (B) Hdh-PL10. Error bars represent the standard error estimated from three technical replicates.
Figure 8. RT-qPCR results: (A) Hdh-vasa and (B) Hdh-PL10. Error bars represent the standard error estimated from three technical replicates.
Genes 16 00329 g008
Table 1. Primer design for ORF amplification of target genes.
Table 1. Primer design for ORF amplification of target genes.
GenesForward Primer (5′→3′)Reverse Primer (5′→3′)Amplicon Length (bp)
vasaATGAAAATGTGCCCTGTAAAGGCGCTGACCAATCAGACAAATTTCCCCTAACATTGATACCCAGGGGAACAGTG2559
PL10ATGAATCCCAATGATACCCATCAAAATGGTTAGTTGCCCCACCAGTCGTTG2247
Table 2. The sequences of the primers for the candidate genes of the various tissues.
Table 2. The sequences of the primers for the candidate genes of the various tissues.
GenesGenBank CodeForward Primer (5′→3′)Reverse Primer (5′→3′)
ICG1PV224500CGACATCACAACAGAAGGCAAAATTTTCTTTCCTGATGTGCTCACC
ICG2PV224501CCAACAAGACCGTGATGAGAGAGAGATCATACAGCTCTGCCCTC
ICG3PV231213AGGTAAGACTGGTGGGAAGGTGCCATTTCTCACCAGCTTGTC
ICG4PV224502ACTCCAGCCCTTATCCTAGCACGCAACATTTGTCCGAGGATC
ICG5PV224503AGTATCAGACCAAGCTTGCAGAACGCCATCATTGTTCTCTTCTTCC
ICG6PV224504ATTGGTCCCCTCGGTTTGTCGCCTGCCGATTCTGGATGAT
ICG7PV224505GCCAACACATTTGCAATCACCTCCCTCTCCAGCAGCATTTG
ICG8PV224506TCCAGAGGACAAAGGAAGTGCGACCTCCGACAAGACCTCTCT
GAPDHPV224499TGACAGTGGTGCCGAATATGT-AACGTTCAGATCGGGTGTGTA
β-actinAY380809AACTTAGTCAGCGGCCGAACCCGGCCTTACACAT
Table 3. The sequences of primers for the candidate genes in different embryonic development stages.
Table 3. The sequences of primers for the candidate genes in different embryonic development stages.
GenesGenBank CodeForward Primer (5′→3′)Reverse Primer (5′→3′)
MZQ1PV231213TACTTTCTCTTCCTTGCCGACCCCACCCTTTCTCCATTCTTCCA
MZQ2PV224495TTACCTGCCCTTGTCATGCAAGCGGTTTCTTGTCACAGGT
MZQ3PV224496AGAAGTTGAAACAGTCGAAGCAGATGGTGAATTGTTCCAGATAAGCAG
MZQ4PV224497AAGCTTCGACGAAATGGTTGGATTCTTTCGCCATGTCAGGGT
MZQ5PV224498CGCCCATGAGAAGTGTGTTTTTGCTCACTTTAGGCCTTCTGT
UBE2KP698948CCAAGCTCTTCTTAGTGCACCTCCCCACTTCCATCACTTT
RPL8KP698947TGGAAACTACGCCACAGTCAGTCCTGCCTTCAACATTGGT
GAPDHPV224499TGACAGTGGTGCCGAATATGT-AACGTTCAGATCGGGTGTGTA
β-actinAY380809AACTTAGTCAGCGGCCGAACCCGGCCTTACACAT
18SAY319437CCGAGGGTCTCACTAAACCATTC′ACTACAATGAAGACGAAGCCCA
Table 4. The sequences of the primers for the DIG-labeled RNA probes.
Table 4. The sequences of the primers for the DIG-labeled RNA probes.
GenesForward Primer (5′→3′)Reverse Primer (5′→3′)Amplicon Length (bp)
vasaCATTCTGGATGAGGCTGACAGGATGGGCGGCAACTGATGTGGCAATA472
PL10AGGACTACTTTGGGTTGTGTCAGGACCGATGGCTTGGCAGATTGGAC529
Table 5. Candidate reference genes for the various tissues by GeNorm, NormFinder, and BestKeeper.
Table 5. Candidate reference genes for the various tissues by GeNorm, NormFinder, and BestKeeper.
GeneGeNormNormFinderBestKeeper
(M Value)(Stability Value)(r)(SD)(CV)
ICG11.1570.4520.7400.983.71
ICG21.1890.5040.7961.114.19
ICG31.4030.5380.6161.526.56
ICG41.3400.5490.7551.284.52
ICG51.2360.5750.6191.084.41
ICG61.2030.6560.6811.024.86
ICG71.1930.6900.7071.074.97
ICG81.3060.7140.5551.064.21
β-actin1.5770.7780.2341.125.36
GAPDH1.3580.9170.6121.205.38
Table 6. Results of the candidate reference genes for various embryonic stages by GeNorm, NormFinder, and BestKeeper.
Table 6. Results of the candidate reference genes for various embryonic stages by GeNorm, NormFinder, and BestKeeper.
GeneGeNormNormFinderBestKeeper
(M Value)(Stability Value)(r)(SD)(CV)
MZQ10.9640.1850.9590.723.66
MZQ21.0370.2020.8730.702.52
MZQ31.2470.2580.7940.953.50
MZQ41.0230.4430.9030.762.90
MZQ51.5050.5620.5371.244.63
RPL81.2270.5830.6720.843.79
UBE21.1310.6970.6180.411.80
18s rRNA1.8810.8810.5921.437.42
β-actin1.7031.0240.7261.506.81
GAPDH1.3131.2080.5050.863.52
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chen, F.; Wu, W.; Li, M.; Su, Y.; Huang, M.; Luo, X.; You, W.; Ke, C. Cloning, Characterization, and Expression Analysis of the DEAD-Box Family Genes, Vasa and PL10, in Pacific Abalone (Haliotis discus hannai). Genes 2025, 16, 329. https://doi.org/10.3390/genes16030329

AMA Style

Chen F, Wu W, Li M, Su Y, Huang M, Luo X, You W, Ke C. Cloning, Characterization, and Expression Analysis of the DEAD-Box Family Genes, Vasa and PL10, in Pacific Abalone (Haliotis discus hannai). Genes. 2025; 16(3):329. https://doi.org/10.3390/genes16030329

Chicago/Turabian Style

Chen, Fei, Wenwei Wu, Min Li, Ying Su, Miaoqing Huang, Xuan Luo, Weiwei You, and Caihuan Ke. 2025. "Cloning, Characterization, and Expression Analysis of the DEAD-Box Family Genes, Vasa and PL10, in Pacific Abalone (Haliotis discus hannai)" Genes 16, no. 3: 329. https://doi.org/10.3390/genes16030329

APA Style

Chen, F., Wu, W., Li, M., Su, Y., Huang, M., Luo, X., You, W., & Ke, C. (2025). Cloning, Characterization, and Expression Analysis of the DEAD-Box Family Genes, Vasa and PL10, in Pacific Abalone (Haliotis discus hannai). Genes, 16(3), 329. https://doi.org/10.3390/genes16030329

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop