Next Article in Journal
Novel Reassortants of Oropouche Virus (OROV) Are Causing Maternal–Fetal Infection During Pregnancy, Stillbirth, Congenital Microcephaly and Malformation Syndromes
Previous Article in Journal
Integrative Analysis of Radiation-Induced Senescence-Associated Secretory Phenotype Factors in Kidney Cancer Progression
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Genes
Volume 16
Issue 1
10.3390/genes16010086
genes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Cytogenomics of Frieseomelitta varia (Hymenoptera: Apidae) and the Sharing of a Satellite DNA Family in Several Neotropical Meliponini Genera

by
Zulemara B. M. Vignati
1,
Gisele A. Teixeira
1,
Marina S. Cunha
1,2,
Jaqueline A. Pereira
1 and
Denilce M. Lopes
1,*
1
Laboratório de Citogenética de Insetos, Departamento de Biologia Geral, Universidade Federal de Viçosa, Campus Universitário, Viçosa 36570-900, Minas Gerais, Brazil
2
Instituto de Veterinária, Universidade Federal Rural do Rio de Janeiro, Campus Seropédica, Seropédica 23891-970, Rio de Janeiro, Brazil
*
Author to whom correspondence should be addressed.
Genes 2025, 16(1), 86; https://doi.org/10.3390/genes16010086
Submission received: 29 November 2024 / Revised: 8 January 2025 / Accepted: 10 January 2025 / Published: 15 January 2025
(This article belongs to the Special Issue Genomics and Cytogenetics of Insects)
Browse Figures
Versions Notes

Abstract

:
Background/Objectives: A striking feature of the karyotypes of stingless bees is the large amount of heterochromatin present in most species. Cytogenomic studies performed in some Meliponini species have suggested that evolutionary events related to the diversification and amplification of satellite DNA families in the heterochromatin may reflect the structuring of phylogenetic clades in this tribe. In this study, we performed a genomic analysis in Frieseomelitta varia to characterize different satDNA families in its genome. We also investigated the presence of the most abundant satDNA family of F. varia in its own chromosomes, in two other Frieseomelitta species, and in other Meliponini genera encompassing the three main clades of Neotropical Meliponini, according to the available molecular phylogeny. Methods: Genomic analyses were performed using RepeatExplorer2 on the Galaxy platform, and chromosomal investigations were conducted using fluorescent in situ hybridization. Results: Seven satDNA families were recovered, which together totaled an abundance of 11.223% of the analyzed F. varia genomic fraction. The most abundant satDNA family, FvarSat01-306, predominates in the analyzed repetitive fraction (representing around 89%) and was recently amplified and homogenized in almost all the heterochromatin of F. varia. In addition, the data revealed an unprecedented sharing of this satDNA family in the centromeric/pericentromeric heterochromatin among different Meliponini genera, with independent amplifications and loss of this sequence in some taxa. Conclusions: One family of satellite DNA makes up most of the heterochromatin in this species and is shared with other Meliponini.

1. Introduction

The constitutive heterochromatin (c-heterochromatin) domain is a chromosomal region that remains highly condensed throughout the cell cycle and is typically enriched with repetitive sequences such as satellite DNA (here called satDNA) and transposable elements [1,2]. This type of chromatin plays an important role in the assembly of CenH3 (centromere-specific histone H3 protein) into nucleosomes and kinetochores, influencing correct chromosome segregation and maintaining genomic stability by restricting the activity of mobile elements and preventing the non-homologous recombination of repetitive sequences during DNA repair [2,3,4].
As a result of the classic cytogenetic studies conducted on stingless bees (Meliponini tribe), the importance of heterochromatin in the chromosomal evolution of these insects has already been discussed. Most species were found to have a significant amount of heterochromatin located along one of the chromosomal arms or even throughout almost the entire chromosomal length [5]. Consistent with these findings, amplifications of heterochromatin have been suggested as the origin of genomes with higher 1C values (the amount of DNA in the haploid nuclear genome) observed in some species of Meliponini, highlighting the role of heterochromatin in the genomic evolution of these bees [5,6].
Over the last few years, molecular cytogenetic studies using various methodologies for the production of specific probes (such as chromosomal microdissection, restriction enzymes, and C0t-DNA renaturation kinetics) and fluorescent in situ hybridization (FISH) in different stingless bees genera have provided the first insights into the composition and evolution of heterochromatin in Meliponini [7,8,9,10]. These studies revealed that heterochromatin contains a highly abundant repetitive DNA sequence that is shared between chromosomes of the same species and between closely related species of the same genus but not between the different genera. However, a recent study performed by Campos et al. [11] using C0t-DNA has revealed the sharing of repetitive sequences between the genera Plebeia and Friesella in part of the heterochromatin.
However, the identity of the sequences constituting heterochromatin remained unknown until recently. With the advent of cytogenomic approaches—which integrate genomic information, chromosomal data, and bioinformatics tools—a deeper understanding of the composition and evolution of heterochromatin in Meliponini has begun to emerge [12,13]. The first study using this approach in stingless bees was conducted in the genus Melipona, showing that despite sharing several satDNA families between species, the most abundant satDNA is unique within the subgenera Michmelia and Melipona, which have very disparate heterochromatin patterns, i.e., high and low heterochromatin content, respectively [12]. In addition, although the satellitome (the set of satDNAs in the genome) of these species shows homology in eleven satDNA families, these sequences have undergone different amplification and retraction processes over time [12]. These findings are consistent with the library hypothesis, which proposes that a group of related species may share satDNA families inherited from a common ancestor, but these families can evolve differently in each species [14].
Similar results were observed with the characterization of the stingless bee Trigona hyalinata satellitome [13]. The authors demonstrated that T. hyalinata heterochromatin is also composed of a predominant satDNA (ThyaSat01-301) that is highly abundant in this region. By associating phylogenetic and cytogenomic data [13,15], the reults showed that this satDNA is shared with other Trigona species of the same clade but not observed in species of the sister clade, indicating a divergent evolution of heterochromatin in the two clades of Trigona. Thus, cytogenomic studies on Melipona and Trigona have suggested that evolutionary events related to the diversification and amplification of the satellitome may reflect the structuring of phylogenetic clades in the Meliponini tribe [12,13].
Recently, genome sequencing data from the stingless bee F. varia became available, revealing a large proportion of repetitive components [16], presenting an opportunity to use this data in cytogenomic analyses. Cytogenetic studies on F. varia show that this species has 2n = 30 chromosomes, with heterochromatin distributed in the centromeric region of the chromosomes and along one arm in most pairs [5,16,17]. Additionally, 12 other taxa of Frieseomelitta have been studied cytogenetically, showing a conserved chromosome number of 2n = 30, with the exception of Frieseomelitta longipes, with 2n = 34 [5,16,17,18,19,20]. C-banding data for some of these species show a high heterochromatic content similar to the pattern observed in F. varia [5,16,17,18,19].
In this study, we performed a genomic analysis in F. varia to identify different satDNA families in its genome and to characterize these sequences in terms of their abundance and divergence. We performed chromosomal mapping of the most abundant satDNA family of F. varia across three Frieseomelitta taxa to determine if this sequence is the main constituent of heterochromatin in these taxa and whether it is shared within the genus. Additionally, we investigated the presence of this predominant satDNA in other Meliponini genera, both phylogenetically close to and distant from Frieseomelitta, according to the molecular phylogeny proposed by Rasmussen and Cameron [21]. The results obtained from these experiments provided new insights into the evolution of satDNA in the Meliponini tribe.

2. Materials and Methods

2.1. Analysis of satDNA in the Genome of the Stingless Bee F. varia

The raw genome data of F. varia were obtained from the publicly accessible database Sequence Read Archive (SRA)-NCBI, with the accession number SRX6799462. The authors used NGS on the Illumina HiSeq2500 platform to generate a library of short paired-end reads (2 × 101 bp) [16]. The quality of the genomic data was inspected using the FastQC Read Quality Reports tool, implemented on the public platform Galaxy (https://repeatexplorer-elixir.cerit-sc.cz/galaxy, accessed on 1 February 2022). The satDNAs from the genome of F. varia were identified using RepeatExplorer2 (Galaxy Version 2.3.8.1), available on the Galaxy platform (accessed on 3 February 2022). These analyses followed the protocol of Novák et al. [22]. The pre-processing of the paired-end reads was performed, which included trimming, quality filtering, Cutadapt filtering, and interlacing of genomic reads. RepeatExplorer2 clustering was performed with default parameters using a random sample of one million reads. After this, the identification of satDNAs was performed using the TAREAN tool [23]. We compared the identified satDNA sequences to check a possible common identity between them using the Geneious software V4.8 [24]. Considering their level of sequence identity, satDNA sequences were classified according to the methods of Ruiz-Ruano et al. [25] into families (>80%) and superfamilies (>60%). In addition, the nomenclature of the identified satDNAs was performed according to the methods of Ruiz-Ruano et al. [25]. These sequences were deposited in GenBank with the following accession numbers: PQ390412, PQ390413, PQ390414, PQ390415, PQ390416, PQ390417, and PQ390418.
The abundance and divergence of each satDNA family was estimated by means of RepeatMasker [26] using the Cross_match. A total of ten million randomly selected reads were used for this analysis. The abundance of each satDNA family was estimated based on its proportion in the genome, and the sum of the mapped nucleotides belonging to one specific satDNA was divided by the total number of nucleotides in the library. The divergence of the satDNAs was determined using the Kimura two-parameter (K2P) model using the alcDivergenceFromAlign.pl script in RepeatMasker software v4.1.4 [26]. The repeat landscapes were generated by comparing the sequence divergence versus the abundance of each satDNA family.

2.2. Obtaining Metaphase Chromosomes and Heterochromatin Distribution Patterns in Meliponini Species

Mitotic chromosomes from different stingless bee species (Table 1) were obtained from the cerebral ganglia of larvae after meconium elimination, following the protocol described by Imai et al. [27]. In total, 17 species were analyzed, covering the three clades of Neotropical Meliponini: Trigonisca clade (Clade 1), Melipona clade (Clade 2), and the remaining clade that includes the other Neotropical genera (Clade 3), according to the molecular phylogeny proposed by Rasmussen and Cameron [21].
To determine heterochromatin distribution patterns, the C-banding technique was performed according to the methods of Sumner [28], with adaptations regarding incubation times in specific solutions: 1 min in HCl, 6 min in Ba(OH)2, and 5 min in 2 × SSC for Frieseomelitta species; 1 min in HCl, 4 min in Ba(OH)2, and 4 min in 2 × SSC for Duckeola ghilianii; and 1 min in HCl, 6 min Ba(OH)2, and 6 min in 2 × SSC for Partamona helleri. In addition, sometimes, conventional staining with 4% Giemsa, without any pretreatment with hydrochloric acid, barium hydroxide, and saline, is sufficient to observe heterochromatin distribution patterns in chromosomes [27,29], which was the case for the other stingless bee species (Table 1).

2.3. Chromosomal Mapping of the Most Abundant satDNA Family from the F. varia Genome Using Fluorescent In Situ Hybridization (FISH)

In order to investigate the presence of the most abundant satDNA family (FvarSat01-306) of the F. varia genome in the karyotypes of other species of Frieseomelitta and other Meliponini genera (Table 1), we produced a probe of this satDNA via polymerase chain reaction (PCR) using the following manually designed specific primers: F- 5′ATTTCGTGTTTCTCGATGCCA 3′ and R- 5′ATTTCGGCTAGATTCGAAGATA 3′. The genomic DNA of F. varia was extracted using the DNeasy Kit (Qiagen Inc., Redwood City, CA, USA), following the manufacturer’s instructions. The PCR solutions totaling 10 μL contained 5.52 μL of H2O, 1 μL of template DNA (100 ng/μL), 0.4 μL of each primer (10 mmol/L) (forward and reverse), 2 μL of 5 × Color-less GoTaq Flexi buffer, 0.08 μL of dNTPs (20 mmol/L), 0.4 μL of MgCl2 (25 mmol/L), and 0.2 μL of GoTaq Flexi DNA Polymerase (5 U/μL) (Promega, Maddison, WI, USA). The PCR conditions included an initial denaturation step at 94 °C for 5 min and 30 cycles at 94 °C (30 s), 60 °C (30 s), and 72 °C (80 s), plus a final extension at 72 °C for 5 min. The PCR products were checked using a 1% agarose gel.
Mapping of the FvarSat01-306 probe was performed using the FISH technique, according to the methods of Pinkel et al. [30]. The FvarSat01 probe was labeled using the indirect method with digoxigenin-11-dUTP using the Dig-Nick-Translation Mix kit (Roche Applied Science, Mannheim, Germany). The identification of probe signals was performed using anti-digoxigenin-rhodamine (Roche Applied Science, Mannheim, Germany). The chromosomes were counterstained with 4′,6-Diamidino-2-Phenylindole (DAPI) (Sigma-Aldrich, Darmstadt, Germany). The metaphases were captured on an Olympus BX53F microscope equipped with an Olympus XM10 camera using CellSens imaging software v1.12 and WG (510–550 nm) filters for rhodamine and WU (330–385 nm) filters for DAPI. At least 30 metaphases per species were used to determine the patterns, employing the FISH technique. The karyotypes were organized using Adobe Photoshop® CS6 software.
Additionally, we performed a parallel analysis to investigate the presence of the most abundant satDNA family from the T. hyalinata genome (ThyaSat01-301) in the chromosomes of closely related genera, including Cephalotrigona, Scaptotrigona, Tetragona, and Geotrigona. These species form a branch within Clade 3, according to the molecular phylogeny proposed by Rasmussen and Cameron [21]. The satDNA ThyaSat01-301 probe was produced using specific primers designed by Pereira et al. [13] and template DNA from T. hyalinata. The preparation of this probe, as well as the FISH assays, followed the methodologies described previously.

3. Results

3.1. Genomic Analysis of satDNAs in F. varia

Bioinformatic analyses identified seven satDNA families, which together totaled an abundance of 11.223% of the F. varia genome, considering the genomic fraction analyzed (Table 2). The most abundant satDNA family (FvarSat01-306) represented 9.971% of the genome, while the other satDNAs together corresponded to only 1.252%. Therefore, the FvariaSat01-306 satDNA is approximately eight times more abundant in the F. varia genome compared to all other satDNA families combined. The lowest abundance was observed in the satDNA family FvariaSat07-145, with 0.014% (Table 2).
The length of the monomers varied from 131 to 1445 bp. The three most abundant satDNA families, namely FvarSat01, FvarSat02, and FvarSat03, possessed the largest monomers, with 306 bp, 449 bp, and 1145 bp, respectively. The A + T base pair content of the satDNA families ranged from 53.2 to 72.5%, with an average of 62.15% (Table 2). These values show a predominance of A+T base pairs in the different satDNA families identified, which follows the whole genome pattern of F. varia, with an estimated A+T base content of 63%, see [16]. Comparative analysis between the satDNA sequences showed a homology greater than 50% between two families (FvarSat04-145 and FvarSat06-145), allowing them to be grouped into the same superfamily (SF1).
The divergence between satDNA families ranged from 2.9% to 22.09%, with an average of 10.07% (Table 2). According to the landscape graph (abundance versus divergence), five satDNA families, including the most abundant in the F. varia genome, showed an abundance peak at low divergence (around 5%), indicating recent amplifications of these families with high sequence homogenization (Figure 1A and Figure S1). However, the satDNA families FvarSat04-145 and FvarSat06-145, which are included in the same superfamily, showed an abundance peak at higher divergence values, indicating the accumulation of mutations in these sequences (Figure 1B,C and Figure S1).

3.2. Chromosomal Analysis: C-Banding and Physical Mapping of the Most Abundant satDNA Family (FvarSat01-306) in Different Meliponini Species

In general, the distribution of heterochromatin observed in the studied species was predominantly located at the centromeres and along one chromosome arm (either short or long) in most or all chromosomes (Figure 2 and Figure 3). However, a few chromosome pairs exhibited heterochromatin only in the centromeric region, as seen in F. varia (pairs 5th m, 7th m, 6th sm, and 1st st) (Figure 2A), Frieseomelitta trichocerata (pairs 4th m, 6th m, and 9th m) (Figure 2C,E), Frieseomelitta sp. (pairs 4th m, 6th m, 8th m, and 1st st) (Figure 2G), and D. ghilianii (pairs 2nd m, 6th m, and 6th sm) (Figure 2I). Additionally, some specific patterns in heterochromatin distribution were observed in Schwarziana quadripunctata, Scaura latitarsis, and P. helleri. The former species displayed eight larger chromosome pairs (1 to 8) with very long heterochromatic arms and nine smaller pairs with short heterochromatic arms (Figure 3C). The second species showed two larger pairs (1 and 8) with very long heterochromatic arms, while the rest of the chromosomes were smaller with short heterochromatic arms (Figure 3E). The last species exhibited two heterochromatic regions with varying intensities: the centromere showed darker staining, while the short arms of some chromosomes displayed lighter staining. Additionally, most of the B chromosome observed in this species was heterochromatic, except for one end, which was euchromatic (Figure 3I).
FISH assays with the FvarSat01-306 probe revealed different hybridization patterns among the analyzed stingless bee species (Figure 2 and Figure 3). This satDNA family was present in almost all the heterochromatin of F. varia (Figure 2B) and in the centromeric/pericentromeric heterochromatin of all chromosomes, as well as in the short arm of only one pair in F. trichocerata (Figure 2D,F) and Frieseomelitta sp. (Figure 2H). The probe showed positive signals exclusively in the centromeric heterochromatin of D. ghilianii (Figure 2J), Tetragonisca angustula (Figure 2L), and S. latitarsis (Figure 3F), while marking all the heterochromatin in Friesella schrottkyi (Figure 3B) and Scaptotrigona xanthotricha (Figure 3H). In S. quadripunctata, FvarSat01-306 was present at the centromeres of all chromosomes and along the long heterochromatic arms of the eight largest pairs (Figure 3D). Lastly, P. helleri showed positive signals in the centromeric/pericentromeric heterochromatin of all chromosomes and in most of the heterochromatin of the B chromosome (Figure 3J).
No hybridization signal with the FvarSat01-306 probe was observed in the chromosomes of Geotrigona subterranea, Tetragona elongata, Trigona spinipes, or Cephalotrigona capitata, which also belong to Clade 3, nor in Leurotrigona muelleri, Melipona quadrifasciata, or Melipona mondury (Figure S2), which are included in the other two Neotropical clades. In addition, no hybridization signal with the satDNA family ThyaSat01-301 probe from the Trigona hyalinata genome was observed in the chromosomes of G. subterranea, T. elongata, C. capitata, and S. xanthotricha (Figure S3).
Figure 4 summarizes the data on the chromosomal location of the most abundant satDNA family FvarSat01-306 in the heterochromatin of the analyzed stingless bees associated with the phylogenetic relationships of these species, according to Rasmussen and Cameron [21].

4. Discussion

Bioinformatic analysis recovered seven satDNA families in the F. varia genome that varied in abundance. The satDNA family FvarSat01-306 constituted 88.8% of this class of repetitive DNA in the analyzed genomic fraction of F. varia. FISH analysis showed that satDNA family FvarSat01-306 comprises almost the entire heterochromatin of F. varia located in centromeric/pericentromeric regions of all the chromosomes and the short arms of some pairs. In addition, this satDNA family showed a high abundance in low divergence values, indicating that it underwent a recent amplification process and sequence homogenization [25,31] in the heterochromatin of F. varia. Similar results were observed in the stingless bees of the Melipona and Trigona genera, which have a significant amount of heterochromatin. Their satellitomes were predominantly composed of a specific satDNA family that was recently amplified and homogenized in the heterochromatin, becoming the main constituent of this chromosome region [12,13]. This pattern may represent a trend in Meliponini, and the increase in studied species through cytogenomics may confirm this hypothesis.
Our FISH experiments also showed that this satDNA family is shared with other species of the same genus, i.e., F. trichocerata and Frieseomelitta sp., indicating an amplification event in Frieseomelitta. However, in these two species, the distribution of this satDNA was somewhat more restricted, indicating variations between these species that may reflect phylogenetic structures within the genus. As observed in Melipona species, other satDNA families and/or transposable elements may constitute the remainder of the heterochromatin [12]. A robust phylogeny for Frieseomelitta, along with the cytogenomic analysis of other species, may clarify these questions.
The above-mentioned species belong to Clade 3 in the molecular phylogenetic analyses of the Meliponini tribe [21]. Therefore, we also investigated the presence of satDNA family FvarSat01-306 in different representatives of the branches that comprise this clade, revealing an unprecedented sharing of this satDNA among different genera and an independent amplification and loss of this sequence in some taxa (see Figure 4). The most frequent pattern was the presence of this satDNA family exclusively in the centromeric heterochromatin (i.e., Partamona, Scaura, Nannotrigona, Tetragonisca, and Duckeola), indicating that, in these genera, a different satDNA family constitutes the main portion of the heterochromatin. However, this satDNA family was independently amplified to compose the main heterochromatic sequence in Schwarziana, Friesella, and Scaptotrigona. Interestingly, the other genera that comprise the branch to which Scaptotrigona belongs, i.e., Cephalotrigona, Trigona, Tetragona, and Geotrigona, lost the satDNA FvarSat01-306.
The satDNA FvarSat01-306 must have appeared in the ancestral representative of Clade 3 around 44 MYA [21], since it is not present in the species of Clades 1 and 2, i.e., Leurotrigona and Melipona, respectively (Figure 4). After the diversification of Clade 3, this satDNA evolved independently by differential contractions and amplification processes, as predicted by the library hypothesis [14]. Although satDNA can be shared between species, its abundance changes stochastically through expansion and reduction, resulting in interspecifically distinct profiles, which are even observed between lineages/populations within a species [31,32,33,34,35,36,37,38,39]. Recently, Camacho et al. [31] discussed a model for the evolution of satDNAs, suggesting that satellites undergo repeated amplification–degeneration cycles that can maintain them in the genome for a long period of time through unequal crossing-over or can lead to their disappearance by sequence degeneration through point mutations.
Alternatively, Fry and Salser [40] proposed that the acquisition of a biological function is a determining factor for a satDNA to be maintained over time in the library during long evolutionary periods. The presence of satDNA family FvarSat01-306 in the centromeric heterochromatin of species for at least 44 MYA leads us to speculate regarding whether or not this sequence possesses a possible function that would cause it to be maintained by natural selection for such a long period of time. SatDNAs are known to be involved in functional interactions necessary for centromere stability and evolution (reviewed in [41]).
In Trigona, which is subdivided into two clades that diversified around 19 MYA [15], cytogenomic analysis showed that the satDNA ThyaSat01-301 is shared by species of the same clade, but no signals were found in species belonging to the sister clade [13]. Since Trigona, Cephalotrigona, Tetragona, and Geotrigona did not show any signals of FvarSat01-306 in their chromosomes, we tested to determine whether satDNA ThyaSat01-301 (from Trigona hyalinata) could be the sequence amplified in this branch of species. This satellite probe hybridized only in Trigona chromosomes, showing no signals in Cephalotrigona, Tetragona, Geotrigona, nor in Scaptotrigona, indicating diversification in the composition of heterochromatin in different Meliponini branches. Future studies should identify the main constituent of heterochromatin in these species.
The present study showed the evolution of one satDNA family with an ancient origin in Clade 3 of Neotropical Meliponini, with stochastic amplification and loss in different taxa. The available body of data point to the important role of satDNA in the evolution of heterochromatin in this group of bees and its possible role in species diversification. These results reinforce the relevance of further efforts to elucidate and understand the mechanisms that lead to the evolution of these sequences, as well as their biological role.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/genes16010086/s1, Figure S1. Landscapes (abundance versus divergence) for each satellite DNA family identified on the genome of Frieseomelitta varia; Figure S2. Fluorescent in situ hybridization with the most abundant satDNA family probe FvarSa01-306 in different stingless bee species: (A) Geotrigona subterranea, (B) Tetragona elongata, (C) Cephalotrigona capitata, (D) Trigona spinipes, (E) Leurotrigona muelleri, (F) Melipona quadrifasciata, and (G) Melipona mondury; Figure S3. Fluorescent in situ hybridization with the most abundant satDNA family probe (ThyaSat01-301) from Trigona hyalinata genome in different stingless bee species: (A) Geotrigona subterranea, (B) Tetragona elongata, (C) Cephalotrigona capitata, and (D) Scaptotrigona xanthotricha. The probe did not hybridize to any region of the chromosomes in these species. Chromosomes were counterstained with DAPI. Bars = 5 µm. The probe did not hybridize to any region of the chromosomes in these species. Chromosomes were counterstained with DAPI. Bars = 5 µm.

Author Contributions

Conceptualization, Z.B.M.V. and D.M.L.; methodology, Z.B.M.V., G.A.T. and J.A.P.; formal analysis, Z.B.M.V., G.A.T. and M.S.C.; investigation, Z.B.M.V., G.A.T. and M.S.C.; writing—original draft preparation, Z.B.M.V., G.A.T. and M.S.C.; writing—review and editing, all authors; visualization, all authors; supervision, D.M.L.; project administration, D.M.L.; funding acquisition, D.M.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by Fundação de Amparo à Pesquisa do Estado de Minas Gerais (FAPEMIG—APQ-01369-22). Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) provided funding to G.A.T. (postdoctoral scholarship, process number 151445/2024-9).

Institutional Review Board Statement

No ethics approval was required for this study.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article and Supplementary Material. Further inquiries can be directed to the corresponding author.

Acknowledgments

The authors would like to thank the Insect Cytogenomics Group at UNESP–Universidade Estadual Paulista, Rio Claro, for providing technical support.

Conflicts of Interest

The authors have no competing interests to declare.

References

  1. Grewal, S.I.; Jia, S. Heterochromatin revisited. Nat. Rev. Genet. 2007, 8, 35–46. [Google Scholar] [CrossRef] [PubMed]
  2. Allshire, R.C.; Madhani, H.D. Ten principles of heterochromatin formation and function. Nat. Rev. Mol. Cell Biol. 2018, 19, 229–244. [Google Scholar] [CrossRef]
  3. Saksouk, N.; Simboeck, E.; Déjardin, J. Constitutive heterochromatin formation and transcription in mammals. Epigenet. Chromatin 2015, 8, 3. [Google Scholar] [CrossRef]
  4. Penagos-Puig, A.; Furlan-Magaril, M. Heterochromatin as an Important Driver of Genome Organization. Front. Cell Dev. Biol. 2020, 18, 579137. [Google Scholar] [CrossRef]
  5. Cunha, M.S.; Soares, F.A.F.; Clarindo, W.R.; Campos, L.A.O.; Lopes, D.M. Robertsonian rearrangements in Neotropical Meliponini karyotype evolution (Hymenoptera: Apidae: Meliponini). Insect Mol. Biol. 2021, 30, 379–389. [Google Scholar] [CrossRef]
  6. Tavares, M.G.; Carvalho, C.R.; Soares, F.A.F.; Campos, L.A.O. Genome size diversity in stingless bees (Hymenoptera: Apidae, Meliponini). Apidologie 2012, 43, 731–736. [Google Scholar] [CrossRef]
  7. Lopes, D.M.; Fernandes, A.; Diniz, D.; Scudeler, P.E.S.; Foresti, F.; Campos, L.A.O. Similarity of heterochromatic regions in the stingless bees (Hymenoptera: Meliponini) revealed by chromosome painting. Caryologia 2014, 67, 222–226. [Google Scholar] [CrossRef]
  8. Piccoli, M.C.A.; Bardella, V.B.; Cabral-de-Mello, D.C. Repetitive DNAs in Melipona scutellaris (Hymenoptera: Apidae: Meliponidae): Chromosomal distribution and test of multiple heterochromatin amplification in the genus. Apidologie 2018, 49, 497–504. [Google Scholar] [CrossRef]
  9. Cunha, M.S.; Campos, L.A.O.; Lopes, D.M. Insights into the heterochromatin evolution in the genus Melipona (Apidae: Meliponini). Insectes Soc. 2020, 67, 391–398. [Google Scholar] [CrossRef]
  10. Pereira, J.A.; Salomão, T.M.F.; Lopes, D.M. Different repetitive DNA sequences make up heterochromatin in Meliponini. Apidologie 2020, 51, 855–860. [Google Scholar] [CrossRef]
  11. Campos, C.L.; Teixeira, G.A.; Lopes, D.M.; Waldschmidt, A.M. Molecular cytogenetics reveals insights into heterochromatin composition and karyotype evolution in species of the Plebeia group (Apidae: Meliponini). Insectes Soc. 2024. submitted. [Google Scholar]
  12. Pereira, J.A.; Milani, D.; Ferretti, A.B.S.M.; Bardella, V.B.; Cabral-de-Mello, D.C.; Lopes, D.M. The extensive amplification of heterochromatin in Melipona bees revealed by high throughput genomic and chromosomal analysis. Chromosoma 2021, 130, 251–262. [Google Scholar] [CrossRef]
  13. Pereira, J.A.; Cabral-de-Mello, D.C.; Lopes, D.M. The Satellite DNAs Populating the Genome of Trigona hyalinata and the Sharing of a Highly Abundant satDNA in Trigona Genus. Genes 2023, 14, 418. [Google Scholar] [CrossRef]
  14. Salser, W.; Bowen, S.; Browne, D.; El-Adli, F.; Fedoroff, N.; Fry, K.; Heindell, H.; Paddock, G.; Poon, R.; Wallace, B.; et al. Investigation of the organization of mammalian chromosomes at the DNA sequence level. Fed. Proc. 1976, 35, 23–35. [Google Scholar] [PubMed]
  15. Rasmussen, C.; Camargo, J.M.F. A molecular phylogeny and the evolution of nest architecture and behavior in Trigona s.s. (Hymenoptera: Apidae: Meliponini). Apidologie 2008, 39, 102–118. [Google Scholar] [CrossRef]
  16. De Paula-Freitas, F.C.; Lourenço, A.P.; Nunes, F.M.; Paschoal, A.R.; Abreu, F.C.; Barbin, F.O.; Bataglia, L.; Cardoso-Júnior, C.A.M.; Cervoni, M.S.; Silva, S.R.; et al. The nuclear and mitochondrial genomes of Frieseomelitta varia—A highly eusocial stingless bee (Meliponini) with a permanently sterile worker caste. BMC Genom. 2020, 21, 386. [Google Scholar] [CrossRef]
  17. Rocha, M.; Pompolo, S.; Campos, L.A.O. Citogenética da Tribo Meliponini (Hymenoptera, Apidae). In Apoidea Neotropica: Homenagem aos 90 anos de Jesus Santiago Moure; UNESC: Criciúma, Brazil, 2003; pp. 311–320. [Google Scholar]
  18. Santos, J.M.; Diniz, D.; Rodrigues, T.A.S.; Cioffi, M.D.B.; Waldschmidt, A.M. Heterochromatin Distribution and Chromosomal Mapping of Microsatellite Repeats in the Genome of Frieseomelitta Stingless Bees (Hymenoptera: Apidae: Meliponini). Fla. Entomol. 2018, 101, 33–39. [Google Scholar] [CrossRef]
  19. Carvalho, A.F.; Costa, M.A. Cytogenetic characterization of two species of Frieseomelitta Ihering, 1912 (Hymenoptera, Apidae, Meliponini). Genet. Mol. Biol. 2011, 34, 237–239. [Google Scholar] [CrossRef] [PubMed]
  20. Do Nascimento, R.M.; Carvalho, A.F.; Santana, W.C.; Barth, A.; Costa, M.A. Karyotype diversity of stingless bees of the genus Frieseomelitta (Hymenoptera, Apidae, Meliponini). Caryologia 2020, 73, 121–126. [Google Scholar]
  21. Rasmussen, C.; Cameron, S.A. Global stingless bee phylogeny supports ancient divergence, vicariance, and long distance dispersal. Biol. J. Linn. Soc. 2010, 99, 206–232. [Google Scholar] [CrossRef]
  22. Novák, P.; Neumann, P.; Macas, J. Global analysis of repetitive DNA from unassembled sequence reads using RepeatExplorer2. Nat. Protoc. 2020, 15, 3745–3776. [Google Scholar] [CrossRef] [PubMed]
  23. Novák, P.; Ávila Robledillo, L.; Koblížková, A.; Vrbová, I.; Neumann, P.; Macas, J. TAREAN: A computational tool for identification and characterization of satellite DNA from unassembled short reads. Nucleic Acids Res. 2017, 45, e111. [Google Scholar] [CrossRef]
  24. Drummond, A.; Ashton, B.; Cheung, M.; Helid, J.; Kearse, M.; Moir, R.; Stones-Havas, S.; Thierer, T.; Wilson, S. Geneious v4.8. 2009. Available online: http://www.geneious.com (accessed on 22 February 2022.).
  25. Ruiz-Ruano, F.J.; López-León, M.D.; Cabrero, J.; Camacho, J.P.M. High-throughput analysis of the satellitome illuminates satellite DNA evolution. Sci. Rep. 2016, 6, 28333. [Google Scholar] [CrossRef]
  26. Smit, A.; Hubley, R.; Green, P. RepeatMasker Open-4.0. 2013–2015. 2017. Available online: http://www.repeatmasker.org/ (accessed on 22 February 2022).
  27. Imai, H.T.; Taylor, R.W.; Crozier, R.H. Modes of spontaneous chromosomal mutation and karyotype evolution in ants with reference to the minimum interaction hypothesis. Jpn. J. Genet. 1988, 63, 159–185. [Google Scholar] [CrossRef] [PubMed]
  28. Sumner, A.T. A simple technique for demonstrating centromeric heterochromatin. Exp. Cell Res. 1972, 83, 304–306. [Google Scholar] [CrossRef]
  29. Imai, H.T. Mutability of constitutive heterochromatin (C-bands) during eukaryotic chromosomal evolution and their cytological meaning. Jpn. J. Genet. 1991, 66, 635–661. [Google Scholar] [CrossRef]
  30. Pinkel, D.; Straume, T.; Gray, J.W. Cytogenetic analysis using quantitative, high-sensitivity, fluorescence hybridization. Proc. Natl. Acad. Sci. USA 1986, 83, 2934–2938. [Google Scholar] [CrossRef]
  31. Camacho, J.P.M.; Cabrero, J.; López-León, M.D.; Martín-Peciña, M.; Perfectti, F.; Garrido-Ramos, M.A.; Ruiz-Ruano, F.J. Satellitome comparison of two oedipodine grasshoppers highlights the contingent nature of satellite DNA evolution. BMC Biol. 2022, 20, 36. [Google Scholar]
  32. Mestrović, N.; Plohl, M.; Mravinac, B.; Ugarković, D. Evolution of satellite DNAs from the genus Palorus—Experimental evidence for the “library” hypothesis. Mol. Biol. Evol. 1998, 15, 1062–1068. [Google Scholar] [CrossRef]
  33. Bolsheva, N.L.; Melnikova, N.V.; Kirov, I.V.; Dmitriev, A.A.; Krasnov, G.S.; Amosova, A.V.; Samatadze, T.E.; Yurkevich, O.Y.; Zoshchuk, A.S.; Kudryavtseva, A.V.; et al. Characterization of repeated DNA sequences in genomes of blue-flowered flax. BMC Evol. Biol. 2019, 19, 79–88. [Google Scholar] [CrossRef]
  34. Palacios-Gimenez, O.M.; Milani, D.; Song, H.; Marti, D.A.; López-León, M.D.; Ruiz-Ruano, F.J.; Camacho, J.P.M.; Cabral-de-Mello, D.C. Eight million years of satellite DNA evolution in grasshoppers of the genus Schistocerca illuminate the ins and outs of the library hypothesis. Genome Biol. Evol. 2020, 12, 88–102. [Google Scholar] [CrossRef] [PubMed]
  35. Lima, L.G.; Ruiz-Ruano, F.J. In-depth satellitome analyses of 37 Drosophila species illuminate repetitive DNA evolution in the Drosophila genus. Genome Biol. Evol. 2022, 14, evac064. [Google Scholar]
  36. Anjos, A.; Milani, D.; Bardella, V.B.; Paladini, A.; Cabral-de-Mello, D.C. Evolution of satDNAs on holocentric chromosomes: Insights from hemipteran insects of the genus Mahanarva. Chromosome Res. 2023, 31, 5. [Google Scholar] [CrossRef]
  37. Mora, P.; Rico-Porras, J.M.; Palomeque, T.; Montiel, E.E.; Pita, S.; Cabral-de-Mello, D.C.; Lorite, P. Satellitome Analysis of Adalia bipunctata (Coleoptera): Revealing Centromeric Turnover and Potential Chromosome Rearrangements in a Comparative Interspecific Study. Int. J. Mol. Sci. 2024, 25, 9214. [Google Scholar] [CrossRef] [PubMed]
  38. Félix, A.P.; de Amorim, I.C.; Milani, D.; Cabral-de-Mello, D.C.; Moura, R.C. Differential amplification and contraction of satellite DNAs in the distinct lineages of the beetle Euchroma gigantea. Gene 2024, 927, 148723. [Google Scholar] [CrossRef]
  39. Cabral-de-Mello, D.C.; Palacios-Gimenez, O.M. Repetitive DNAs: The “invisible” regulators of insect adaptation and speciation. Curr. Opin. Insect Sci. 2024, 67, 101295. [Google Scholar] [CrossRef] [PubMed]
  40. Fry, K.; Salser, W. Nucleotide sequences of HS-α satellite DNA from kangaroo rat Dipodomys ordii and characterization of similar sequences in other rodents. Cell 1977, 12, 1069–1084. [Google Scholar] [CrossRef]
  41. Plohl, M.; Meštrović, N.; Mravinac, B. Centromere identity from the DNA point of view. Chromosoma 2014, 123, 313–325. [Google Scholar] [CrossRef] [PubMed]
Genes 16 00086 g001
Figure 1. Landscape (abundance versus divergence) for the satDNA families identified in the F. varia genome (A). Note in (A) the predominance of the FvarSat01-306 family in relation to the other satDNAs. This family showed an abundance peak at low divergence values (about 5%), revealing its recent amplification and high sequence homogenization. Landscapes in (B,C) for the FvarSat04-145 and FvarSat06-145 families, respectively, show an abundance peak at high divergence values, indicating the accumulation of mutations in these sequences.
Figure 1. Landscape (abundance versus divergence) for the satDNA families identified in the F. varia genome (A). Note in (A) the predominance of the FvarSat01-306 family in relation to the other satDNAs. This family showed an abundance peak at low divergence values (about 5%), revealing its recent amplification and high sequence homogenization. Landscapes in (B,C) for the FvarSat04-145 and FvarSat06-145 families, respectively, show an abundance peak at high divergence values, indicating the accumulation of mutations in these sequences.
Genes 16 00086 g001
Genes 16 00086 g002
Figure 2. Karyotypes of five stingless bee species showing heterochromatin distribution patterns (darker regions) in (A,C,E,G,I,K). Karyotypes subjected to fluorescent in situ hybridization with the most abundant satDNA family probe FvarSat01-306 (red regions) and counterstaining with DAPI (blue regions) in (B,D,F,H,J,L). Chromosomal classification: m = metacentric, sm = submetacentric, and st = subtelocentric. Bars = 5 µm.
Figure 2. Karyotypes of five stingless bee species showing heterochromatin distribution patterns (darker regions) in (A,C,E,G,I,K). Karyotypes subjected to fluorescent in situ hybridization with the most abundant satDNA family probe FvarSat01-306 (red regions) and counterstaining with DAPI (blue regions) in (B,D,F,H,J,L). Chromosomal classification: m = metacentric, sm = submetacentric, and st = subtelocentric. Bars = 5 µm.
Genes 16 00086 g002
Genes 16 00086 g003
Figure 3. Karyotypes of five stingless bee species showing heterochromatin distribution patterns (darker regions) in (A,C,E,G,I). Karyotypes subjected to fluorescent in situ hybridization with the most abundant satDNA family probe FvarSat01-306 (red regions) and counterstaining with DAPI (blue regions) in (B,D,F,H,J). Chromosomal classification: m = metacentric, sm = submetacentric, and st = subtelocentric. The letter “B” in P. helleri karyotypes indicates the B chromosome. Bars = 5 µm.
Figure 3. Karyotypes of five stingless bee species showing heterochromatin distribution patterns (darker regions) in (A,C,E,G,I). Karyotypes subjected to fluorescent in situ hybridization with the most abundant satDNA family probe FvarSat01-306 (red regions) and counterstaining with DAPI (blue regions) in (B,D,F,H,J). Chromosomal classification: m = metacentric, sm = submetacentric, and st = subtelocentric. The letter “B” in P. helleri karyotypes indicates the B chromosome. Bars = 5 µm.
Genes 16 00086 g003
Genes 16 00086 g004
Figure 4. Data on the chromosomal location of the most abundant satDNA family FvarSat01-306 in the heterochromatin of the analyzed stingless bees associated with the phylogenetic relationships of these species, according to Rasmussen and Cameron (2010). Symbols represent hypotheses about evolutionary events related to the satDNA FvarSat01-306 across Clade 3 species: the green rectangle indicates the presence of this family in the ancestor of Clade 3; the green triangle signifies the loss of this family in the ancestor of the branch that includes genera Geotrigona, Tetragona, Trigona, and Cephalotrigona; the purple, orange, black, and yellow circles represents independent amplifications of this family in the heterochromatin of distinct genera.
Figure 4. Data on the chromosomal location of the most abundant satDNA family FvarSat01-306 in the heterochromatin of the analyzed stingless bees associated with the phylogenetic relationships of these species, according to Rasmussen and Cameron (2010). Symbols represent hypotheses about evolutionary events related to the satDNA FvarSat01-306 across Clade 3 species: the green rectangle indicates the presence of this family in the ancestor of Clade 3; the green triangle signifies the loss of this family in the ancestor of the branch that includes genera Geotrigona, Tetragona, Trigona, and Cephalotrigona; the purple, orange, black, and yellow circles represents independent amplifications of this family in the heterochromatin of distinct genera.
Genes 16 00086 g004
Table 1. Stingless bee species (Meliponini) analyzed in the cytogenetic experiments. Species are distributed in the three main clades (Clade 1: Trigonisca, Clade 2: Melipona, and Clade 3: most Neotropical Meliponini genera), according to the phylogeny proposed by Rasmussen and Cameron [21], and their respective geographic locations: Brazilian states, MG—Minas Gerais, AM—Amazonas, PA—Pará, and DF—Distrito Federal.
Table 1. Stingless bee species (Meliponini) analyzed in the cytogenetic experiments. Species are distributed in the three main clades (Clade 1: Trigonisca, Clade 2: Melipona, and Clade 3: most Neotropical Meliponini genera), according to the phylogeny proposed by Rasmussen and Cameron [21], and their respective geographic locations: Brazilian states, MG—Minas Gerais, AM—Amazonas, PA—Pará, and DF—Distrito Federal.
SpeciesPhylogenetic CladesLocality
Frieseomelitta varia Lepeletier, 1836Clade 3Uberlândia, MG, Brazil
Frieseomelitta trichocerata Moure, 1990Clade 3Redenção, PA, Brazil;
Presidente Figueiredo, AM, Brazil
Frieseomelitta sp.Clade 3 Brasília, DF, Brazil
Duckeola ghilianii Spinola, 1853Clade 3 Presidente Figueiredo, AM, Brazil
Tetragonisca angustula Latreille, 1811Clade 3Mutum, MG, Brazil
Friesella schrottkyi Friese, 1900Clade 3 Rio Paranaíba, MG, Brazil
Schwarziana quadripunctata Latreille, 1836Clade 3 Viçosa, MG, Brazil
Scaura latitarsis Friese, 1900Clade 3Presidente Figueiredo, AM, Brazil
Scaptotrigona xanthotricha Moure, 1950Clade 3Viçosa, MG, Brazil
Geotrigona subterranea Friese, 1901 Clade 3Passos, MG, Brazil
Tetragona elongata Lepeletier & Serville, 1828Clade 3Viçosa, MG, Brazil
Trigona spinipes Fabricius, 1793Clade 3Januária, MG, Brazil
Cephalotrigona capitata Smith, 1854Clade 3Viçosa, MG, Brazil
Partamona helleri Friese, 1900Clade 3Viçosa, MG, Brazil
Melipona quadrifasciata Lepeletier, 1836Clade 2Viçosa, MG, Brazil
Melipona mondury Smith, 1863Clade 2 Viçosa, MG, Brazil
Leurotrigona muelleri Friese, 1900Clade 1Passos, MG, Brazil
Table 2. Main characteristics of satellite DNA (satDNA) families identified in the genome of F. varia.
Table 2. Main characteristics of satellite DNA (satDNA) families identified in the genome of F. varia.
SatDNA FamilySFMLA + T%Divergence %Abundance %
FvarSat01-306 306664.629.971%
FvarSat02-449 44953.22.920.803%
FvarSat03-1145 114558.47.730.245%
FvarSat04-145114554.522.090.117%
FvarSat05-131 13172.58.670.054%
FvarSat06-145114559.318.360.019%
FvarSat07-170 17071.26.130.014%
Total 11.223%
SF = superfamilies; ML = monomer length; A + T% = content A + T.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Vignati, Z.B.M.; Teixeira, G.A.; Cunha, M.S.; Pereira, J.A.; Lopes, D.M. Cytogenomics of Frieseomelitta varia (Hymenoptera: Apidae) and the Sharing of a Satellite DNA Family in Several Neotropical Meliponini Genera. Genes 2025, 16, 86. https://doi.org/10.3390/genes16010086

AMA Style

Vignati ZBM, Teixeira GA, Cunha MS, Pereira JA, Lopes DM. Cytogenomics of Frieseomelitta varia (Hymenoptera: Apidae) and the Sharing of a Satellite DNA Family in Several Neotropical Meliponini Genera. Genes. 2025; 16(1):86. https://doi.org/10.3390/genes16010086

Chicago/Turabian Style

Vignati, Zulemara B. M., Gisele A. Teixeira, Marina S. Cunha, Jaqueline A. Pereira, and Denilce M. Lopes. 2025. "Cytogenomics of Frieseomelitta varia (Hymenoptera: Apidae) and the Sharing of a Satellite DNA Family in Several Neotropical Meliponini Genera" Genes 16, no. 1: 86. https://doi.org/10.3390/genes16010086

APA Style

Vignati, Z. B. M., Teixeira, G. A., Cunha, M. S., Pereira, J. A., & Lopes, D. M. (2025). Cytogenomics of Frieseomelitta varia (Hymenoptera: Apidae) and the Sharing of a Satellite DNA Family in Several Neotropical Meliponini Genera. Genes, 16(1), 86. https://doi.org/10.3390/genes16010086

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop