Heart Morphogenesis Requires Smyd1b for Proper Incorporation of the Second Heart Field in Zebrafish
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Zebrafish Husbandry, Strain Maintenance, and Animal Use
2.3. In Situ Hybridization and Immunostaining
2.4. RNA Extractions and Quantitative PCR
3. Results
3.1. Smyd1b Mutant Hearts Fail to Complete Morphogenesis
3.2. SMYD1b Is Necessary for Proper Regulation of the Cardiac Transcriptional Network
3.3. Still Heart Mutant Hearts Lack Contribution from the Second Heart Field
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hoffman, J.I.E. Incidence of Congenital Heart Disease: II. Prenatal Incidence. Pediatr. Cardiol. 1995, 16, 155–165. [Google Scholar] [CrossRef] [PubMed]
- Olson, E.N. Gene Regulatory Networks in the Evolution and Development of the Heart. Science (1979) 2006, 313, 1922–1927. [Google Scholar] [CrossRef] [PubMed]
- Srivastava, D. Making or Breaking the Heart: From Lineage Determination to Morphogenesis. Cell 2006, 126, 1037–1048. [Google Scholar] [CrossRef]
- Buckingham, M.; Meilhac, S.; Zaffran, S. Building the Mammalian Heart from Two Sources of Myocardial Cells. Nat. Rev. Genet. 2005, 6, 826–835. [Google Scholar] [CrossRef]
- Kelly, R.G. The Second Heart Field. Curr. Top. Dev. Biol. 2012, 100, 33–65. [Google Scholar] [CrossRef]
- Black, B.L. Transcriptional Pathways in Second Heart Field Development. Semin. Cell Dev. Biol. 2007, 18, 67–76. [Google Scholar] [CrossRef]
- Zhao, K.; Yang, Z. The Second Heart Field: The First 20 Years. Mamm. Genome 2023, 34, 216–228. [Google Scholar] [CrossRef]
- Guijarro, C.; Kelly, R.G. On the Involvement of the Second Heart Field in Congenital Heart Defects. Comptes Rendus Biol. 2024, 347, 9–18. [Google Scholar] [CrossRef]
- Ward, C.; Stadt, H.; Hutson, M.; Kirby, M.L. Ablation of the Secondary Heart Field Leads to Tetralogy of Fallot and Pulmonary Atresia. Dev. Biol. 2005, 284, 72–83. [Google Scholar] [CrossRef] [PubMed]
- Schoenwolf, G.C.; Bleyl, S.B.; Brauer, P.R.; Francis-West, P.H.; Larsen, W.J. Larsen’s Human Embryology, 6th ed.; Elsevier Health Sciences: Amsterdam, The Netherlands, 2020; ISBN 9780323696043. [Google Scholar]
- Rochais, F.; Mesbah, K.; Kelly, R.G. Signaling Pathways Controlling Second Heart Field Development. Circ. Res. 2009, 104, 933–942. [Google Scholar] [CrossRef]
- Kelly, R.G.; Brown, N.A.; Buckingham, M.E. The Arterial Pole of the Mouse Heart Forms from Fgf10-Expressing Cells in Pharyngeal Mesoderm. Dev. Cell 2001, 1, 435–440. [Google Scholar] [CrossRef]
- Robertson, E.J.; Charatsi, I.; Joyner, C.J.; Koonce, C.H.; Morgan, M.; Islam, A.; Paterson, C.; Lejsek, E.; Arnold, S.J.; Kallies, A.; et al. Blimp1 Regulates Development of the Posterior Forelimb, Caudal Pharyngeal Arches, Heart and Sensory Vibrissae in Mice. Development 2007, 134, 4335–4345. [Google Scholar] [CrossRef] [PubMed]
- Dyer, L.A.; Kirby, M.L. The Role of Secondary Heart Field in Cardiac Development. Dev. Biol. 2009, 336, 137–144. [Google Scholar] [CrossRef] [PubMed]
- Cai, C.L.; Liang, X.; Shi, Y.; Chu, P.H.; Pfaff, S.L.; Chen, J.; Evans, S. Isl1 Identifies a Cardiac Progenitor Population That Proliferates Prior to Differentiation and Contributes a Majority of Cells to the Heart. Dev. Cell 2003, 5, 877–889. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Fulcoli, F.G.; Tang, S.; Baldini, A. Tbx1 Regulates Proliferation and Differentiation of Multipotent Heart Progenitors. Circ. Res. 2009, 105, 842–851. [Google Scholar] [CrossRef]
- Schneider, V.A.; Mercola, M. Wnt Antagonism Initiates Cardiogenesis in Xenopus Laevis. Genes. Dev. 2001, 15, 304–315. [Google Scholar] [CrossRef]
- Lin, Q.; Schwarz, J.; Bucana, C.; Olson, E.N. Control of Mouse Cardiac Morphogenesis and Myogenesis by Transcription Factor MEF2C. Science 1997, 276, 1404–1407. [Google Scholar] [CrossRef]
- Lints, T.J.; Parsons, L.M.; Hartley, L.; Lyons, I.; Harvey, R.P. Nkx-2.5: A Novel Murine Homeobox Gene Expressed in Early Heart Progenitor Cells and Their Myogenic Descendants. Development 1993, 119, 419–431. [Google Scholar] [CrossRef]
- Srivastava, D.; Thomas, T.; Kirby, M.L.; Brown, D.; Olson, E.N. Regulation of Cardiac Mesodermal and Neural Crest Development by the BHLH Transcription Factor, DHAND. Nat. Genet. 1997, 16, 154–160. [Google Scholar] [CrossRef]
- Lyons, I.; Parsons, L.M.; Hartley, L.; Li, R.; Andrews, J.E.; Robb, L.; Harvey, R.P. Myogenic and Morphogenetic Defects in the Heart Tubes of Murine Embryos Lacking the Homeo Box Gene Nkx2-5. Genes. Dev. 1995, 9, 1654–1666. [Google Scholar] [CrossRef] [PubMed]
- Gottlieb, P.D.; Pierce, S.A.; Sims Iii, R.J.; Yamagishi, H.; Weihe, E.K.; Harriss, J.V.; Maika, S.D.; Kuziel, W.A.; King, H.L.; Olson, E.N.; et al. Bop Encodes a Muscle-Restricted Protein Containing MYND and SET Domains and Is Essential for Cardiac Differentiation and Morphogenesis. Nat. Genet. 2002, 31, 25–32. [Google Scholar] [CrossRef] [PubMed]
- Sims, R.J.; Weihe, E.K.; Zhu, L.; O’Malley, S.; Harriss, J.V.; Gottlieb, P.D. M-Bop, a Repressor Protein Essential for Cardiogenesis, Interacts with SkNAC, a Heart- and Muscle-Specific Transcription Factor. J. Biol. Chem. 2002, 277, 26524–26529. [Google Scholar] [CrossRef] [PubMed]
- Prill, K.; Reid, P.W.; Wohlgemuth, S.L.; Pilgrim, D.B. Still Heart Encodes a Structural HMT, SMYD1b, with Chaperone-like Function during Fast Muscle Sarcomere Assembly. PLoS ONE 2015, 10, e0142528. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Xie, Y.; Zhang, H.; Feng, Z.; Huang, J.; Huang, J.; Hu, S.; Wei, Y. Multiple Genetic Variants in Adolescent Patients with Left Ventricular Noncompaction Cardiomyopathy. Int. J. Cardiol. 2020, 302, 117–123. [Google Scholar] [CrossRef]
- Tracy, C.M.; Warren, J.S.; Szulik, M.; Wang, L.; Garcia, J.; Makaju, A.; Russell, K.; Miller, M.; Franklin, S. The Smyd Family of Methyltransferases: Role in Cardiac and Skeletal Muscle Physiology and Pathology. Curr. Opin. Physiol. 2018, 1, 140–152. [Google Scholar] [CrossRef]
- Coyan, G.N.; Zinn, M.D.; West, S.C.; Sharma, M.S. Heart Transplantation from Biventricular Support in Infant with Novel SMYD1 Mutation. Pediatr. Cardiol. 2019, 40, 1745–1747. [Google Scholar] [CrossRef] [PubMed]
- Szulik, M.W.; Reyes-Múgica, M.; Marker, D.F.; Gomez, A.M.; Zinn, M.D.; Walsh, L.K.; Ochoa, J.P.; Franklin, S.; Ghaloul-Gonzalez, L. Identification of Two Homozygous Variants in MYBPC3 and SMYD1 Genes Associated with Severe Infantile Cardiomyopathy. Genes 2023, 14, 659. [Google Scholar] [CrossRef] [PubMed]
- Cai, M.; Han, L.; Liu, L.; He, F.; Chu, W.; Zhang, J.; Tian, Z.; Du, S. Defective Sarcomere Assembly in Smyd1a and Smyd1b Zebrafish Mutants. FASEB J. 2019, 33, 6209–6225. [Google Scholar] [CrossRef]
- Just, S.; Meder, B.; Berger, I.M.; Etard, C.; Trano, N.; Patzel, E.; Hassel, D.; Marquart, S.; Dahme, T.; Vogel, B.; et al. The Myosin-Interacting Protein SMYD1 Is Essential for Sarcomere Organization. J. Cell Sci. 2011, 124, 3127–3136. [Google Scholar] [CrossRef]
- Etard, C.; Behra, M.; Fischer, N.; Hutcheson, D.; Geisler, R.; Strähle, U. The UCS Factor Steif/Unc-45b Interacts with the Heat Shock Protein Hsp90a during Myofibrillogenesis. Dev. Biol. 2007, 308, 133–143. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Zhong, Y.; Wang, Z.; Gao, J.; Xu, J.; Chu, W.; Zhang, J.; Fang, S.; Du, S.J. Smyd1b Is Required for Skeletal and Cardiac Muscle Function in Zebrafish. Mol. Biol. Cell 2013, 24, 3511–3521. [Google Scholar] [CrossRef]
- Geach, T.J.; Zimmerman, L.B. Paralysis and Delayed Z-Disc Formation in the Xenopus Tropicalis Unc45b Mutant Dicky Ticker. BMC Dev. Biol. 2010, 10, 75. [Google Scholar] [CrossRef] [PubMed]
- Schoenebeck, J.J.; Yelon, D. Illuminating Cardiac Development: Advances in Imaging Add New Dimensions to the Utility of Zebrafish Genetics. Semin. Cell Dev. Biol. 2007, 18, 27. [Google Scholar] [CrossRef] [PubMed]
- Bakkers, J. Zebrafish as a Model to Study Cardiac Development and Human Cardiac Disease. Cardiovasc. Res. 2011, 91, 279–288. [Google Scholar] [CrossRef]
- Scott, I.C.; Yelon, D. Cardiac Development in the Zebrafish. In Heart Development and Regeneration; Academic Press: New York, NY, USA, 2010; Volume 1, pp. 103–120. ISBN 9780123813329. [Google Scholar]
- Felker, A.; Prummel, K.D.; Merks, A.M.; Mickoleit, M.; Brombacher, E.C.; Huisken, J.; Panáková, D.; Mosimann, C. Continuous Addition of Progenitors Forms the Cardiac Ventricle in Zebrafish. Nat. Commun. 2018, 9, 2001. [Google Scholar] [CrossRef]
- Guner-Ataman, B.; Paffett-Lugassy, N.; Adams, M.S.; Nevis, K.R.; Jahangiri, L.; Obregon, P.; Kikuchi, K.; Poss, K.D.; Burns, C.E.; Burns, C.G. Zebrafish Second Heart Field Development Relies on Progenitor Specification in Anterior Lateral Plate Mesoderm and Nkx2.5 Function. Development 2013, 140, 1353–1363. [Google Scholar] [CrossRef]
- Witzel, H.R.; Cheedipudi, S.; Gao, R.; Stainier, D.Y.R.; Dobreva, G.D. Isl2b Regulates Anterior Second Heart Field Development in Zebrafish. Sci. Rep. 2017, 7, 41043. [Google Scholar] [CrossRef] [PubMed]
- Hami, D.; Grimes, A.C.; Tsai, H.J.; Kirby, M.L. Zebrafish Cardiac Development Requires a Conserved Secondary Heart Field. Development 2011, 138, 2389–2398. [Google Scholar] [CrossRef] [PubMed]
- Phan, D.; Rasmussen, T.L.; Nakagawa, O.; McAnally, J.; Gottlieb, P.D.; Tucker, P.W.; Richardson, J.A.; Bassel-Duby, R.; Olson, E.N. BOP, a Regulator of Right Ventricular Heart Development, Is a Direct Transcriptional Target of MEF2C in the Developing Heart. Development 2005, 132, 2669–2678. [Google Scholar] [CrossRef]
- Codina, M.; Li, J.; Gutiérrez, J.; Kao, J.P.Y.; Du, S.J. Loss of Smyhc1 or Hsp90α1 Function Results in Different Effects on Myofibril Organization in Skeletal Muscles of Zebrafish Embryos. PLoS ONE 2010, 5, e8416. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.N.; Haffter, P.; Odenthal, J.; Vogelsang, E.; Brand, M.; Van Eeden, F.J.M.; Furutani-Seiki, M.; Granato, M.; Hammerschmidt, M.; Heisenberg, C.P.; et al. Mutations Affecting the Cardiovascular System and Other Internal Organs in Zebrafish. Development 1996, 123, 293–302. [Google Scholar] [CrossRef] [PubMed]
- Westerfield, M. The Zebrafish Book. A Guide for the Laboratory Use of Zebrafish (Danio Rerio), 5th ed.; University of Oregon Press: Eugene, OR, USA, 2007; ISBN 9994860577. [Google Scholar]
- Granato, M.; Van Eeden, F.J.M.; Schach, U.; Trowe, T.; Brand, M.; Furutani-Seiki, M.; Haffter, P.; Hammerschmidt, M.; Heisenberg, C.P.; Jiang, Y.J.; et al. Genes Controlling and Mediating Locomotion Behavior of the Zebrafish Embryo and Larva. Development 1996, 123, 399–413. [Google Scholar] [CrossRef] [PubMed]
- Gongal, P.A.; Waskiewicz, A.J. Zebrafish Model of Holoprosencephaly Demonstrates a Key Role for TGIF in Regulating Retinoic Acid Metabolism. Hum. Mol. Genet. 2008, 17, 525–538. [Google Scholar] [CrossRef]
- Lagendijk, A.K.; Goumans, M.J.; Burkhard, S.B.; Bakkers, J. MicroRNA-23 Restricts Cardiac Valve Formation by Inhibiting Has2 and Extracellular Hyaluronic Acid Production. Circ. Res. 2011, 109, 649–657. [Google Scholar] [CrossRef] [PubMed]
- Small, E.M.; Krieg, P.A. Transgenic Analysis of the Atrialnatriuretic Factor (ANF) Promoter: Nkx2-5 and GATA-4 Binding Sites Are Required for Atrial Specific Expression of ANF. Dev. Biol. 2003, 261, 116–131. [Google Scholar] [CrossRef]
- Camenisch, T.D.; Spicer, A.P.; Brehm-Gibson, T.; Biesterfeldt, J.; Augustine, M.L.; Calabro, A.; Kubalak, S.; Klewer, S.E.; McDonald, J.A. Disruption of Hyaluronan Synthase-2 Abrogates Normal Cardiac Morphogenesis and Hyaluronan-Mediated Transformation of Epithelium to Mesenchyme. J. Clin. Investig. 2000, 106, 349–360. [Google Scholar] [CrossRef] [PubMed]
- Xu, R.; Li, S.; Chien, C.J.; Zhong, Y.; Xiao, H.; Fang, S.; Du, S. Expression of Smyd1b_tv1 by Alternative Splicing in Cardiac Muscle Is Critical for Sarcomere Organization in Cardiomyocytes and Heart Function. Mol. Cell Biol. 2024, 44, 543–561. [Google Scholar] [CrossRef] [PubMed]
- George, V.; Colombo, S.; Targoff, K.L. An Early Requirement for Nkx2.5 Ensures the First and Second Heart Field Ventricular Identity and Cardiac Function into Adulthood. Dev. Biol. 2015, 400, 10–22. [Google Scholar] [CrossRef]
- Kelly, R.G. The Heart Field Transcriptional Landscape at Single-Cell Resolution. Dev. Cell 2023, 58, 257–266. [Google Scholar] [CrossRef]
- Tsuchihashi, T.; Maeda, J.; Shin, C.H.; Ivey, K.N.; Black, B.L.; Olson, E.N.; Yamagishi, H.; Srivastava, D. Hand2 Function in Second Heart Field Progenitors Is Essential for Cardiogenesis. Dev. Biol. 2011, 351, 62–69. [Google Scholar] [CrossRef] [PubMed]
- Waldo, K.L.; Hutson, M.R.; Stadt, H.A.; Zdanowicz, M.; Zdanowicz, J.; Kirby, M.L. Cardiac Neural Crest Is Necessary for Normal Addition of the Myocardium to the Arterial Pole from the Secondary Heart Field. Dev. Biol. 2005, 281, 66–77. [Google Scholar] [CrossRef] [PubMed]
- Rasmussen, T.L.; Ma, Y.; Park, C.Y.; Harriss, J.; Pierce, S.A.; Dekker, J.D.; Valenzuela, N.; Srivastava, D.; Schwartz, R.J.; Stewart, M.D.; et al. Smyd1 Facilitates Heart Development by Antagonizing Oxidative and ER Stress Responses. PLoS ONE 2015, 10, e0121765. [Google Scholar] [CrossRef] [PubMed]
- Töpf, A.; Griffin, H.R.; Glen, E.; Soemedi, R.; Brown, D.L.; Hall, D.; Rahman, T.J.; Eloranta, J.J.; Jüngst, C.; Stuart, A.G.; et al. Functionally Significant, Rare Transcription Factor Variants in Tetralogy of Fallot. PLoS ONE 2014, 9, e95453. [Google Scholar] [CrossRef] [PubMed]
- Gordon, D.M.; Cunningham, D.; Zender, G.; Lawrence, P.J.; Penaloza, J.S.; Lin, H.; Fitzgerald-Butt, S.M.; Myers, K.; Duong, T.; Corsmeier, D.J.; et al. Exome Sequencing in Multiplex Families with Left-Sided Cardiac Defects Has High Yield for Disease Gene Discovery. PLoS Genet. 2022, 18, e1010236. [Google Scholar] [CrossRef]
- Wang, E.; Fan, X.; Nie, Y.; Zheng, Z.; Hu, S. Single-Nucleotide Polymorphisms in Exonic and Promoter Regions of Transcription Factors of Second Heart Field Associated with Sporadic Congenital Cardiac Anomalies. Balkan J. Med. Genet. 2022, 24, 39–47. [Google Scholar] [CrossRef]
- Fan, L.L.; Ding, D.B.; Huang, H.; Chen, Y.Q.; Jin, J.Y.; Xia, K.; Xiang, R. A de Novo Mutation of SMYD1 (p.F272L) Is Responsible for Hypertrophic Cardiomyopathy in a Chinese Patient. Clin. Chem. Lab. Med. 2019, 57, 532–539. [Google Scholar] [CrossRef] [PubMed]
- Chaturvedi, R.R.; Herron, T.; Simmons, R.; Shore, D.; Kumar, P.; Sethia, B.; Chua, F.; Vassiliadis, E.; Kentish, J.C. Passive Stiffness of Myocardium from Congenital Heart Disease and Implications for Diastole. Circulation 2010, 121, 979–988. [Google Scholar] [CrossRef]
- Heras-Bautista, C.O.; Mikhael, N.; Lam, J.; Shinde, V.; Katsen-Globa, A.; Dieluweit, S.; Molcanyi, M.; Uvarov, V.; Jütten, P.; Sahito, R.G.A.; et al. Cardiomyocytes Facing Fibrotic Conditions Re-Express Extracellular Matrix Transcripts. Acta Biomater. 2019, 89, 180–192. [Google Scholar] [CrossRef]
- Morikawa, Y.; Cserjesi, P. Cardiac Neural Crest Expression of Hand2 Regulates Outflow and Second Heart Field Development. Circ. Res. 2008, 103, 1422–1429. [Google Scholar] [CrossRef] [PubMed]
- Park, C.Y.; Pierce, S.A.; Von Drehle, M.; Ivey, K.N.; Morgan, J.A.; Blau, H.M.; Srivastava, D. SkNAC, a Smyd1-Interacting Transcription Factor, Is Involved in Cardiac Development and Skeletal Muscle Growth and Regeneration. Proc. Natl. Acad. Sci. USA 2010, 107, 20750–20755. [Google Scholar] [CrossRef]
- Wang, Z.; Schwartz, R.J.; Liu, J.; Sun, F.; Li, Q.; Ma, Y. Smyd1 Orchestrates Early Heart Development Through Positive and Negative Gene Regulation. Front. Cell Dev. Biol. 2021, 9, 654682. [Google Scholar] [CrossRef]
- Shi, W.; Wasson, L.K.; Dorr, K.M.; Robbe, Z.L.; Wilczewski, C.M.; Hepperla, A.J.; Davis, I.J.; Seidman, C.E.; Seidman, J.G.; Conlon, F.L. CHD4 and SMYD1 Repress Common Transcriptional Programs in the Developing Heart. Development 2024, 151, dev202505. [Google Scholar] [CrossRef] [PubMed]
- Warren, J.S.; Tracy, C.M.; Miller, M.R.; Makaju, A.; Szulik, M.W.; Oka, S.I.; Yuzyuk, T.N.; Cox, J.E.; Kumar, A.; Lozier, B.K.; et al. Histone Methyltransferase Smyd1 Regulates Mitochondrial Energetics in the Heart. Proc. Natl. Acad. Sci. USA 2018, 115, E7871–E7880. [Google Scholar] [CrossRef] [PubMed]
- McFadden, D.G.; Charité, J.; Richardson, J.A.; Srivastava, D.; Firulli, A.B.; Olson, E.N. A GATA-Dependent Right Ventricular Enhancer Controls DHAND Transcription in the Developing Heart. Development 2000, 127, 5331–5341. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.; Shioi, T.; Kasahara, H.; Jobe, S.M.; Wiese, R.J.; Markham, B.E.; Izumo, S. The Cardiac Tissue-Restricted Homeobox Protein Csx/Nkx2.5 Physically Associates with the Zinc Finger Protein GATA4 and Cooperatively Activates Atrial Natriuretic Factor Gene Expression. Mol. Cell Biol. 1998, 18, 3120–3129. [Google Scholar] [CrossRef]
- McCulley, D.J.; Black, B.L. Transcription Factor Pathways and Congenital Heart Disease. Curr. Top. Dev. Biol. 2012, 100, 253–277. [Google Scholar] [CrossRef]
- Chang, Y.; Bai, R.; Zhang, Y.; Lu, W.J.; Ma, S.; Zhu, M.; Lan, F.; Jiang, Y. SMYD1 Modulates the Proliferation of Multipotent Cardiac Progenitor Cells Derived from Human Pluripotent Stem Cells during Myocardial Differentiation through GSK3β/β-Catenin&ERK Signaling. Stem Cell Res. Ther. 2024, 15, 350. [Google Scholar] [CrossRef]
- Szulik, M.W.; Valdez, S.; Walsh, M.; Davis, K.; Bia, R.; Horiuchi, E.; O’Very, S.; Laxman, A.K.; Sandaklie-Nicolova, L.; Eberhardt, D.R.; et al. SMYD1a Protects the Heart from Ischemic Injury by Regulating OPA1-Mediated Cristae Remodeling and Supercomplex Formation. Basic. Res. Cardiol. 2023, 118, 20. [Google Scholar] [CrossRef]
Gene | Forward Primer (5′→ 3′) | Reverse Primer (5′→ 3′) |
---|---|---|
has2 | CAAATATGAGTCGTGGGTCTCC | CATTGAACGCACCCGAAATATG |
hand2 | GCCAAAGAAGAAAGGCGAAAG | AGCTCCAATGCCCAAACA |
tbx20 | CTCACGGATATTGAGAGGGAAAG | TGTCCTTCTTCTCCCAGAGT |
tbx5a | GGAGCCATAAGCTCACAGTATT | CCTCTTGATGCAGTGGTAGTC |
tbx5b | ACTGTCTCTCTCGGTCTGAATA | AGTTGGGTCATGAATGCTAGG |
nkx2.5 | AGACACGTCCACTTACAACAC | CGACGGATAGTTGCATGAGTAG |
gata4 | TGTCAGACTACCACAACAACTC | GTGTCTGAATGCCCTCTTTCT |
gata5 | GACAACACTGTGGAGGAGAAA | TTTGCGTTTCCTTGTCTGAATG |
tbx2b | GTCCCTTTCCCTTTCATCTGT | GCGGCCATGTAGGTGTAG |
amhc | TCTGGAGCAAACCGAAAGAG | GATCCGACTCTTGCTTCTTCTT |
vmhc | GCTGAAGAAGGAGCAGGATAC | GCCTCCCTTCATAGCGATTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Prill, K.; Windsor Reid, P.; Pilgrim, D. Heart Morphogenesis Requires Smyd1b for Proper Incorporation of the Second Heart Field in Zebrafish. Genes 2025, 16, 52. https://doi.org/10.3390/genes16010052
Prill K, Windsor Reid P, Pilgrim D. Heart Morphogenesis Requires Smyd1b for Proper Incorporation of the Second Heart Field in Zebrafish. Genes. 2025; 16(1):52. https://doi.org/10.3390/genes16010052
Chicago/Turabian StylePrill, Kendal, Pamela Windsor Reid, and Dave Pilgrim. 2025. "Heart Morphogenesis Requires Smyd1b for Proper Incorporation of the Second Heart Field in Zebrafish" Genes 16, no. 1: 52. https://doi.org/10.3390/genes16010052
APA StylePrill, K., Windsor Reid, P., & Pilgrim, D. (2025). Heart Morphogenesis Requires Smyd1b for Proper Incorporation of the Second Heart Field in Zebrafish. Genes, 16(1), 52. https://doi.org/10.3390/genes16010052