Whole Genome Sequencing and Comparative Genomics Analysis of Goat-Derived Klebsiella oxytoca
Abstract
:1. Introduction
2. Materials and Methods
2.1. Strains
2.2. Whole Genome Sequencing
2.3. ONT and Illumina Sequencing
2.4. Genome Assembly
2.5. Genome Annotation and Bioinformatics Analysis
2.6. Gene Function Annotation
2.7. Genome Visualization Analysis
2.8. Colinearity Analysis and SNP, InDels, and SV Statistics
2.9. ANI, Gene Family Analysis, and Phylogenomic Tree Construction
2.10. Virulence Gene Detection
3. Results
3.1. General Characteristics of KOHN1 Genome
3.2. Gene Function Annotation Results
3.3. Results of CAZy Database Annotation
3.4. Results of Drug Resistance Gene Annotation
3.5. The Results of the TNSS and Virulence Gene Analysis
3.6. The Collinearity Analysis Results of the Five Strains
3.7. ANI Analysis and Phylogenetic Tree Analysis
3.8. Gene Family Analysis and Data Results of SNPs, InDels, and SV
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
ONT | Oxford Nanopore Technologies |
AMR | Antibiotic resistance |
WGS | Whole genome sequencing |
PCR | Polymerase chain reaction |
COG | Cluster of Orthologous Groups of proteins |
GO | Gene Ontology |
KEGG | Kyoto Encyclopedia of Genes and Genomes |
NR | Non-Redundant Protein Database |
CAZy | Carbohydrate-Active enZYmes Database |
TNSS | Type N secretion systems, Type I-VII |
VFDB | Virulence Factors of Pathogenic Bacteria |
CARD | Comprehensive Antibiotic Research Database |
SNP | Single nucleotide polymorphisms |
SV | Structural variation |
ANI | Average Nucleotide Identity |
GH | Glycoside Hydrolases |
GT | Glycosyl Transferases |
PL | Polysaccharide Lyases |
AA | Auxiliary Activities |
CE | Carbohydrate Esterases |
CBM | Carbohydrate-Binding Modules |
References
- Stewart, J.; Judd, L.M.; Jenney, A.; Holt, K.E.; Wyres, K.L.; Hawkey, J. Epidemiology and genomic analysis of Klebsiella oxytoca from a single hospital network in Australia. BMC Infect. Dis. 2022, 22, 704. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Long, H.; Hu, Y.; Feng, Y.; McNally, A.; Zong, Z. Klebsiella oxytoca Complex: Update on Taxonomy, Antimicrobial Resistance, and Virulence. Clin. Microbiol. Rev. 2022, 35, e0000621. [Google Scholar] [CrossRef] [PubMed]
- Osbelt, L.; Almási, É.D.H.; Wende, M.; Kienesberger, S.; Voltz, A.; Lesker, T.R.; Muthukumarasamy, U.; Knischewski, N.; Nordmann, E.; Bielecka, A.A.; et al. Klebsiella oxytoca inhibits Salmonella infection through multiple microbiota-context-dependent mechanisms. Nat. Microbiol. 2024, 9, 1792–1811. [Google Scholar] [CrossRef] [PubMed]
- Podschun, R.; Ullmann, U. Klebsiella spp. as nosocomial pathogens: Epidemiology, taxonomy, typing methods, and pathogenicity factors. Clin. Microbiol. Rev. 1998, 11, 589–603. [Google Scholar] [CrossRef]
- Neog, N.; Phukan, U.; Puzari, M.; Sharma, M.; Chetia, P. Klebsiella oxytoca and Emerging Nosocomial Infections. Curr. Microbiol. 2021, 78, 1115–1123. [Google Scholar] [CrossRef]
- Lee, D.; Oh, J.Y.; Sum, S.; Park, H.M. Prevalence and antimicrobial resistance of Klebsiella species isolated from clinically ill companion animals. J. Vet. Sci. 2021, 22, e17. [Google Scholar] [CrossRef]
- Harada, K.; Shimizu, T.; Mukai, Y.; Kuwajima, K.; Sato, T.; Usui, M.; Tamura, Y.; Kimura, Y.; Miyamoto, T.; Tsuyuki, Y.; et al. Phenotypic and Molecular Characterization of Antimicrobial Resistance in Klebsiella spp. Isolates from Companion Animals in Japan: Clonal Dissemination of Multidrug-Resistant Extended-Spectrum β-Lactamase-Producing Klebsiella pneumoniae. Front. Microbiol. 2016, 7, 1021. [Google Scholar] [CrossRef]
- Marques, C.; Menezes, J.; Belas, A.; Aboim, C.; Cavaco-Silva, P.; Trigueiro, G.; Telo Gama, L.; Pomba, C. Klebsiella pneumoniae causing urinary tract infections in companion animals and humans: Population structure, antimicrobial resistance and virulence genes. J. Antimicrob. Chemother. 2019, 74, 594–602. [Google Scholar] [CrossRef]
- Cuénod, A.; Wüthrich, D.; Seth-Smith, H.M.B.; Ott, C.; Gehringer, C.; Foucault, F.; Mouchet, R.; Kassim, A.; Revathi, G.; Vogt, D.R.; et al. Whole-genome sequence-informed MALDI-TOF MS diagnostics reveal importance of Klebsiella oxytoca group in invasive infections: A retrospective clinical study. Genome Med. 2021, 13, 150. [Google Scholar] [CrossRef]
- McNerney, R.; Zignol, M.; Clark, T.G. Use of whole genome sequencing in surveillance of drug resistant tuberculosis. Expert Rev. Anti Infect. Ther. 2018, 16, 433–442. [Google Scholar] [CrossRef]
- Massé, J.; Dufour, S.; Archambault, M. Characterization of Klebsiella isolates obtained from clinical mastitis cases in dairy cattle. J. Dairy Sci. 2020, 103, 3392–3400. [Google Scholar] [CrossRef] [PubMed]
- Hua, M.; Duan, A.; Li, Q.; Yue, J.; Liu, X.; Yuan, L.; Liu, J.; Chen, C. Alteration of microbiota and immune response of mice gavaged with Klebsiella oxytoca. Microbes Infect. 2022, 24, 104977. [Google Scholar] [CrossRef] [PubMed]
- Ghasemian, A.; Mohabati Mobarez, A.; Najar Peerayeh, S.; Talebi Bezmin Abadi, A.; Khodaparast, S.; Mahmood, S.S. Expression of adhesin genes and biofilm formation among Klebsiella oxytoca clinical isolates from patients with antibiotic-associated haemorrhagic colitis. J. Med Microbiol. 2019, 68, 978–985. [Google Scholar] [CrossRef] [PubMed]
- García-Pérez, A.N.; de Jong, A.; Junker, S.; Becher, D.; Chlebowicz, M.A.; Duipmans, J.C.; Jonkman, M.F.; van Dijl, J.M. From the wound to the bench: Exoproteome interplay between wound-colonizing Staphylococcus aureus strains and co-existing bacteria. Virulence 2018, 9, 363–378. [Google Scholar] [CrossRef]
- Levkova, M.; Chervenkov, T.; Angelova, L.; Dzenkov, D. Oxford Nanopore Technology and its Application in Liquid Biopsies. Curr. Genom. 2023, 24, 337–344. [Google Scholar] [CrossRef]
- Brisse, S.; Fevre, C.; Passet, V.; Issenhuth-Jeanjean, S.; Tournebize, R.; Diancourt, L.; Grimont, P. Virulent clones of Klebsiella pneumoniae: Identification and evolutionary scenario based on genomic and phenotypic characterization. PLoS ONE 2009, 4, e4982. [Google Scholar] [CrossRef]
- Nasser, K.; Mustafa, A.S.; Khan, M.W.; Purohit, P.; Al-Obaid, I.; Dhar, R.; Al-Fouzan, W. Draft Genome Sequences of Six Multidrug-Resistant Clinical Strains of Acinetobacter baumannii, Isolated at Two Major Hospitals in Kuwait. Genome Announc. 2018, 6, e00264-18. [Google Scholar] [CrossRef]
- Singh, R.; Kusalik, A.; Dillon, J.R. Bioinformatics tools used for whole-genome sequencing analysis of Neisseria gonorrhoeae: A literature review. Brief. Funct. Genom. 2022, 21, 78–89. [Google Scholar] [CrossRef]
- Safar, H.A.; Alatar, F.; Nasser, K.; Al-Ajmi, R.; Alfouzan, W.; Mustafa, A.S. The impact of applying various de novo assembly and correction tools on the identification of genome characterization, drug resistance, and virulence factors of clinical isolates using ONT sequencing. BMC Biotechnol. 2023, 23, 26. [Google Scholar] [CrossRef]
- Campos-Madueno, E.I.; Sigrist, T.; Flückiger, U.M.; Risch, L.; Bodmer, T.; Endimiani, A. First report of a blaVIM-1 metallo-β-lactamase-possessing Klebsiella michiganensis. J. Glob. Antimicrob. Resist. 2021, 25, 310–314. [Google Scholar] [CrossRef]
- Dieckmann, R.; Hammerl, J.A.; Hahmann, H.; Wicke, A.; Kleta, S.; Dabrowski, P.W.; Nitsche, A.; Stämmler, M.; Al Dahouk, S.; Lasch, P. Rapid characterisation of Klebsiella oxytoca isolates from contaminated liquid hand soap using mass spectrometry, FTIR and Raman spectroscopy. Faraday Discuss. 2016, 187, 353–375. [Google Scholar] [CrossRef] [PubMed]
- Lo, S.; Lolom, I.; Goldstein, V.; Petitjean, M.; Rondinaud, E.; Bunel-Gourdy, V.; Tran Dinh, A.; Wicky, P.H.; Ruppé, E.; d’Humières, C.; et al. Simultaneous Hospital Outbreaks of New Delhi Metallo-β-Lactamase-Producing Enterobacterales Unraveled Using Whole-Genome Sequencing. Microbiol. Spectr. 2022, 10, e0228721. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Jiang, J.; He, M.; Li, H.; Cheng, Y.; An, Q.; Chen, S.; Du, L.; Man, C.; Chen, Q.; et al. First Report and Comparative Genomic Analysis of a Mycoplasma mycoides Subspecies capri HN-A in Hainan Island. Microorganisms 2022, 10, 1908. [Google Scholar] [CrossRef] [PubMed]
- Holt, K.E.; Parkhill, J.; Mazzoni, C.J.; Roumagnac, P.; Weill, F.X.; Goodhead, I.; Rance, R.; Baker, S.; Maskell, D.J.; Wain, J.; et al. High-throughput sequencing provides insights into genome variation and evolution in Salmonella Typhi. Nat. Genet. 2008, 40, 987–993. [Google Scholar] [CrossRef] [PubMed]
- Clawson, M.L.; Keen, J.E.; Smith, T.P.; Durso, L.M.; McDaneld, T.G.; Mandrell, R.E.; Davis, M.A.; Bono, J.L. Phylogenetic classification of Escherichia coli O157:H7 strains of human and bovine origin using a novel set of nucleotide polymorphisms. Genome Biol. 2009, 10, R56. [Google Scholar] [CrossRef]
- Rossing, M.; Sørensen, C.S.; Ejlertsen, B.; Nielsen, F.C. Whole genome sequencing of breast cancer. APMIS 2019, 127, 303–315. [Google Scholar] [CrossRef]
- Wang, R.; Li, J.; Zhou, X.; Mao, Y.; Wang, W.; Gao, S.; Wang, W.; Gao, Y.; Chen, K.; Yu, S.; et al. Single-cell genomic and transcriptomic landscapes of primary and metastatic colorectal cancer tumors. Genome Med. 2022, 14, 93. [Google Scholar] [CrossRef]
- Quiñones, K.J.O.; Gentallan, R.P., Jr.; Timog, E.B.S.; Cruz, J.R.A.V.; Macabecha, C.G.A.; Papa, I.A.; Coronado, N.B.; Bartolome, M.C.B.; Ceribo, D.B.; Madayag, R.E.; et al. Liquid-nitrogen-free CTAB DNA extraction method from silica-dried specimens for next-generation sequencing and assembly. MethodsX 2024, 12, 102758. [Google Scholar] [CrossRef]
- Galperin, M.Y.; Makarova, K.S.; Wolf, Y.I.; Koonin, E.V. Expanded microbial genome coverage and improved protein family annotation in the COG database. Nucleic Acids Res. 2015, 43, D261–D269. [Google Scholar] [CrossRef]
- Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T.; et al. Gene ontology: Tool for the unification of biology. The Gene Ontology Consortium. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef]
- Kanehisa, M.; Goto, S.; Hattori, M.; Aoki-Kinoshita, K.F.; Itoh, M.; Kawashima, S.; Katayama, T.; Araki, M.; Hirakawa, M. From genomics to chemical genomics: New developments in KEGG. Nucleic Acids Res. 2006, 34, D354–D357. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Jaroszewski, L.; Godzik, A. Tolerating some redundancy significantly speeds up clustering of large protein databases. Bioinformatics 2002, 18, 77–82. [Google Scholar] [CrossRef] [PubMed]
- Singh, R.P.; Kumari, K. Bacterial type VI secretion system (T6SS): An evolved molecular weapon with diverse functionality. Biotechnol. Lett. 2023, 45, 309–331. [Google Scholar] [CrossRef]
- Jia, B.; Raphenya, A.R.; Alcock, B.; Waglechner, N.; Guo, P.; Tsang, K.K.; Lago, B.A.; Dave, B.M.; Pereira, S.; Sharma, A.N.; et al. CARD 2017: Expansion and model-centric curation of the comprehensive antibiotic resistance database. Nucleic Acids Res. 2017, 45, D566–D573. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Xiong, Z.; Sun, L.; Yang, J.; Jin, Q. VFDB 2012 update: Toward the genetic diversity and molecular evolution of bacterial virulence factors. Nucleic Acids Res. 2012, 40, D641–D645. [Google Scholar] [CrossRef] [PubMed]
- Zhang, A.; Han, Y.; Huang, Y.; Hu, X.; Liu, P.; Liu, X.; Kan, B.; Liang, W. vgrG is separately transcribed from hcp in T6SS orphan clusters and is under the regulation of IHF and HapR. Biochem. Biophys. Res. Commun. 2021, 559, 15–20. [Google Scholar] [CrossRef]
- Omer, F.H.; Al-Khafaji, N.S.K.; Al-Alaq, F.T.; Al-Dahmoshi, H.O.M.; Memariani, M.; Saki, M. Synergistic effects of silybin and curcumin on virulence and carbapenemase genes expression in multidrug resistant Klebsiella oxytoca. BMC Res. Notes 2022, 15, 330. [Google Scholar] [CrossRef]
- Hu, Y.Y.; Chen, S.; Zhang, Y.D.; Lu, Q.W.; Wang, F.; Ren, A.; Liu, C.X. Value of T6SS Core Gene hcp in Acinetobacter baumannii Respiratory Tract Infection. Indian J. Microbiol. 2023, 63, 291–298. [Google Scholar] [CrossRef]
- Luo, G.; Xu, X.; Zhao, L.; Qin, Y.; Huang, L.; Su, Y.; Yan, Q. clpV is a key virulence gene during in vivo Pseudomonas plecoglossicida infection. J. Fish Dis. 2019, 42, 991–1000. [Google Scholar] [CrossRef]
- Lin, W.H.; Wang, M.C.; Tseng, C.C.; Ko, W.C.; Wu, A.B.; Zheng, P.X.; Wu, J.J. Clinical and microbiological characteristics of Klebsiella pneumoniae isolates causing community-acquired urinary tract infections. Infection 2010, 38, 459–464. [Google Scholar] [CrossRef]
- Candan, E.D.; Aksöz, N. Klebsiella pneumoniae: Characteristics of carbapenem resistance and virulence factors. Acta Biochim. Pol. 2015, 62, 867–874. [Google Scholar] [CrossRef] [PubMed]
- Turton, J.F.; Perry, C.; Elgohari, S.; Hampton, C.V. PCR characterization and typing of Klebsiella pneumoniae using capsular type-specific, variable number tandem repeat and virulence gene targets. J. Med. Microbiol. 2010, 59 Pt 5, 541–547. [Google Scholar] [CrossRef] [PubMed]
- Dong, M.B.; Tang, K.; Zhou, X.; Zhou, J.J.; Chen, S. Tumor immunology CRISPR screening: Present, past, and future. Trends Cancer 2022, 8, 210–225. [Google Scholar] [CrossRef] [PubMed]
- de Jong, A.; Garch, F.E.; Simjee, S.; Moyaert, H.; Rose, M.; Youala, M.; Siegwart, E.; VetPath Study Group. Monitoring of antimicrobial susceptibility of udder pathogens recovered from cases of clinical mastitis in dairy cows across Europe: VetPath results. Vet. Microbiol. 2018, 213, 73–81. [Google Scholar] [CrossRef]
- Vuillemin, M.; Muschiol, J.; Zhang, Y.; Holck, J.; Barrett, K.; Preben Morth, J.; Meyer, A.S.; Zeuner, B. Discovery of Lacto-N-Biosidases and a Novel N-Acetyllactosaminidase Activity in the CAZy Family GH20: Functional Diversity and Structural Insights. ChemBioChem 2024, e202400710. [Google Scholar] [CrossRef]
- Storey, D.; McNally, A.; Åstrand, M.; Sa-Pessoa Graca Santos, J.; Rodriguez-Escudero, I.; Elmore, B.; Palacios, L.; Marshall, H.; Hobley, L.; Molina, M.; et al. Klebsiella pneumoniae type VI secretion system-mediated microbial competition is PhoPQ controlled and reactive oxygen species dependent. PLoS Pathog. 2020, 16, e1007969. [Google Scholar] [CrossRef]
- Meir, A.; Macé, K.; Vegunta, Y.; Williams, S.M.; Waksman, G. Substrate recruitment mechanism by gram-negative type III, IV, and VI bacterial injectisomes. Trends Microbiol. 2023, 31, 916–932. [Google Scholar] [CrossRef]
- Sana, T.G.; Flaugnatti, N.; Lugo, K.A.; Lam, L.H.; Jacobson, A.; Baylot, V.; Durand, E.; Journet, L.; Cascales, E.; Monack, D.M. Salmonella Typhimurium utilizes a T6SS-mediated antibacterial weapon to establish in the host gut. Proc. Natl. Acad. Sci. USA 2016, 113, E5044–E5051. [Google Scholar] [CrossRef]
- Joshi, A.; Kostiuk, B.; Rogers, A.; Teschler, J.; Pukatzki, S.; Yildiz, F.H. Rules of Engagement: The Type VI Secretion System in Vibrio cholerae. Trends Microbiol. 2017, 25, 267–279. [Google Scholar] [CrossRef]
- Liu, Q.; Zhu, J.; Liu, N.; Sun, W.; Yu, B.; Niu, H.; Liu, D.; Ouyang, P.; Ying, H.; Chen, Y.; et al. Type I fimbriae subunit fimA enhances Escherichia coli biofilm formation but affects L-threonine carbon distribution. Front. Bioeng. Biotechnol. 2022, 10, 904636. [Google Scholar] [CrossRef]
- Stahlhut, S.G.; Chattopadhyay, S.; Kisiela, D.I.; Hvidtfeldt, K.; Clegg, S.; Struve, C.; Sokurenko, E.V.; Krogfelt, K.A. Structural and population characterization of MrkD, the adhesive subunit of type 3 fimbriae. J. Bacteriol. 2013, 195, 5602–5613. [Google Scholar] [CrossRef] [PubMed]
- Douzi, B.; Brunet, Y.R.; Spinelli, S.; Lensi, V.; Legrand, P.; Blangy, S.; Kumar, A.; Journet, L.; Cascales, E.; Cambillau, C. Structure and specificity of the Type VI secretion system ClpV-TssC interaction in enteroaggregative Escherichia coli. Sci. Rep. 2016, 6, 34405. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Mao, Y.; Song, Y.; Dou, M.; Shang, K.; Yu, Z.; Ding, K.; Chen, S. Refined egoist: The toxin-antitoxin immune system of T6SS. Microb. Pathog. 2024, 196, 106991. [Google Scholar] [CrossRef] [PubMed]
Virulence Gene | Primer Sequences (5′-3′) | Annealing Temperature (°C) | Reference |
---|---|---|---|
vgrG | F: GCATCTTCCAACTCAACAC | 55 | Zhang A et al., 2021 [36] |
R: GTACACCAGCCCTTCTTC | |||
fimA | F: GCACCGCGATTGACAGC | 61 | Omer FH et al., 2022 [37] |
R: CGAAGGTTGCGCCATCCAG | |||
fimH | F: GCTCTGGCCGATACCACGACGG | 55 | Brisse S et al., 2009 [16] |
R: GCGAAGTAACGTGCCTGGAACGG | |||
mrkD | F: TAT TGGCTTAATGGCGCTGG | 60 | Brisse S et al., 2009 [16] |
R: TAATCGTACGTCAGGTTAAAGACC | |||
hcp | F: TGCTGAACGTGTTGAACATT | 58 | Hu YY et al., 2023 [38] |
R: TAACAGCACCTTTAGCAGTA | |||
clpV | F: CGAGGTCATTAAAGTTGCCCAATC | 60 | Luo G et al., 2019 [39] |
R: CGCCGAAACCGACATACCCT | |||
cf29a | F: GACTCTGATTGCACTGGCTGTG | 51 | Brisse S et al., 2009 [16] |
R: GTTATAAGTTACTGCCACGTTC | |||
wabG | F: CGGACTGGCAGATCCATATC | 58 | Lin WH et al., 2010 [40] |
R: ACCATCGGCCATTTGATAGA | |||
entB | F: ATTTCCTCAACTTCTGGGGC | 56 | Candan ED et al., 2015 [41] |
R: AGCATCGGTGGCGGTGGTCA | |||
rmpA | F: CGTATGAAGGCTCGATGGAT | 60 | Turton GF et al., 2010 [42] |
R: TGTGCACCATTTTTCATCAG |
Item | Number | Item | Number |
---|---|---|---|
Genome size (bp) | 5,817,806 | Number of rRNA genes | 25 |
Total length of gene (pb) | 5,087,988 | Number of tRNA genes | 85 |
Genome GC content (3%) | 55.14 | Number of sRNA genes | 53 |
Average length of gene (bp) | 32,936.12 | Number of DNA elements | 13 |
Number of genes | 5227 | Number of short interspersed elements | 33 |
Number of gene islands | 8 | Number of long interspersed repeated sequences | 27 |
Total length of coding region (%) | 87.46 | Total potential CRISPRs | 7 |
Total length of gene island (bp) | 263,489 | Number of prophages | 1 |
Number of tandem repeats | 106 | Total length of prophages (pb) | 59,576 |
Strain Name | Total Genes Number | Number of Genes in the Family | Number of Specific Families | Unclustered Genes Number | Families |
---|---|---|---|---|---|
ATTC 13182 | 5311 | 5057 | 254 | 254 | 5010 |
ASM381292 | 5332 | 5161 | 171 | 171 | 5094 |
ASM2573217 | 5388 | 5255 | 164 | 133 | 5162 |
ASM3386047 | 5312 | 5118 | 195 | 194 | 5081 |
KOHN1 | 5227 | 5116 | 113 | 111 | 5071 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Y.; Zhang, Z.; Wang, Z.; Chen, Y.; Liao, L.; Du, L.; Gao, H.; Chen, Q.; Man, C.; Chen, S.; et al. Whole Genome Sequencing and Comparative Genomics Analysis of Goat-Derived Klebsiella oxytoca. Genes 2025, 16, 13. https://doi.org/10.3390/genes16010013
Zhang Y, Zhang Z, Wang Z, Chen Y, Liao L, Du L, Gao H, Chen Q, Man C, Chen S, et al. Whole Genome Sequencing and Comparative Genomics Analysis of Goat-Derived Klebsiella oxytoca. Genes. 2025; 16(1):13. https://doi.org/10.3390/genes16010013
Chicago/Turabian StyleZhang, Yu, Zhenxing Zhang, Ziying Wang, Yimei Chen, Lianjie Liao, Li Du, Hongyan Gao, Qiaoling Chen, Churiga Man, Si Chen, and et al. 2025. "Whole Genome Sequencing and Comparative Genomics Analysis of Goat-Derived Klebsiella oxytoca" Genes 16, no. 1: 13. https://doi.org/10.3390/genes16010013
APA StyleZhang, Y., Zhang, Z., Wang, Z., Chen, Y., Liao, L., Du, L., Gao, H., Chen, Q., Man, C., Chen, S., & Wang, F. (2025). Whole Genome Sequencing and Comparative Genomics Analysis of Goat-Derived Klebsiella oxytoca. Genes, 16(1), 13. https://doi.org/10.3390/genes16010013