Transcriptomic Analysis of Hippocampus abdominalis Larvae Under High Temperature Stress
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Materials
2.2. Experimental Method
2.3. Transcriptome Library Construction and Sequencing
2.4. Differentially Expressed Gene Analysis and Functional Annotation
2.5. Verification by Quantitative Real-Time PCR
3. Results
3.1. Transcriptome Sequencing Basic Data
3.2. Transcriptome Sequencing of Differentially Expressed Genes
3.3. GO Enrichment Analysis
3.4. KEGG Enrichment Analysis
3.5. Real-Time Fluorescence Quantitative PCR Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Craig, R.K. Marine biodiversity, climate change, and governance of the oceans. Diversity 2012, 4, 224–238. [Google Scholar] [CrossRef]
- Munday, P.L.; Leis, J.M.; Lough, J.M.; Paris, C.B.; Kingsford, M.J.; Berumen, M.L.; Lambrechts, J. Climate change and coral reef connectivity. Coral Reefs 2009, 28, 379–395. [Google Scholar] [CrossRef]
- Portner, H.O.; Farrell, A.P. Physiology and climate change. Science 2008, 322, 690–692. [Google Scholar] [CrossRef] [PubMed]
- Dinken, C.P.; Keretz, K.R.; Schramm, H.L., Jr.; Petrie-Hanson, L.; Schilling, M.W.; Allen, P.J. The effects of water temperature and simulated angling on the physiological stress response of largemouth bass. Trans. Am. Fish. Soc. 2022, 151, 487–506. [Google Scholar] [CrossRef]
- Luo, H.Y.; Qi, J.F.; Zhen, L.Y.; Wu, S.Q.; Lin, J.B.; Chen, X.X.; Huang, F.Q.; Wang, Q. The temperature tolerance of Hippocampus abdominalis and the effect of different temperatures on its growth. J. Fish. Res. China 2021, 43, 480–486. [Google Scholar] [CrossRef]
- Woods, C.M.C. Factors Affecting Successful Culture of the Seahorse, Hippocampus abdominalis Leeson, 1827. Mar. Ornam. Species Collect. Cult. Conserv. 2008, 25, 275–288. [Google Scholar] [CrossRef]
- Li, E.; Li, C. Use of RNA-seq in Aquaculture research. Poult. Fish. Wildl. Sci. 2014, 2, 476. [Google Scholar] [CrossRef]
- Mu, Y.N.; Li, W.R.; Wu, B.; Chen, J.; Chen, X.H. Transcriptome analysis reveals new insights into immune response to hypoxia challenge of large yellow croaker (Larimichthys crocea). Fish Shellfish Immunol. 2020, 98, 738–747. [Google Scholar] [CrossRef]
- Yang, K.; Huang, Z.H.; Ma, A.J.; Liu, X.F.; Yang, S.S. Transcriptome Study of Kidney of Turbot under High-Temperature Stress. Prog. Fish. Sci. China 2020, 41, 86–95. [Google Scholar] [CrossRef]
- Yang, M.M.; Tu, H.H.; Xing, Q.Q.; Tang, Q.Y.; Yi, S.K.; Xia, Z.L.; Cai, M.Y.; Chen, G.Z.; Lan, X.; Zhong, Z.X.; et al. Transcriptomic responses to acute low temperature stress in giant freshwater prawn Macrobrachium rosenbergii. Acta Hydrobiol. Sin. 2023, 47, 581–593. [Google Scholar] [CrossRef]
- Wang, Y.J.; Bao, X.K.; Wang, W.J.; Xu, X.H.; Liu, X.M.; Li, Z.; Yang, J.M.; Yuan, T.Z. Exploration of anti-stress mechanisms in high temperature exposed juvenile golden cuttlefish (Sepia esculenta) based on transcriptome profiling. Front. Physiol. 2023, 14, 1189375. [Google Scholar] [CrossRef] [PubMed]
- Martinez-Cardenas, L.; Purser, G.J. Effect of temperature on growth and survival in cultured early juvenile pot-bellied seahorses, Hippocampus abdominalis. J. World Aquac. Soc. 2011, 42, 854–862. [Google Scholar] [CrossRef]
- Nie, X.B.; Zhang, C.F.; Jiang, C.X.; Li, S.L.; Hong, W.S.; Chen, S.X.; Zhang, Y.T. Characterizing transcriptome changes in gill tissue of turbot (Scophthalmus maximus) for waterless preservation. Aquaculture 2020, 518, 734830. [Google Scholar] [CrossRef]
- Hou, Z.S.; Wen, H.S.; Li, J.F.; He, F.; Li, Y.; Qi, X. Environmental hypoxia causes growth retardation, osteoclast differentiation and calcium dyshomeostasis in juvenile rainbow trout (Oncorhynchus mykiss). Sci. Total Environ. 2020, 705, 135272. [Google Scholar] [CrossRef]
- Yang, Q.T.; Wu, R.X.; Liang, Y.S.; Niu, S.F.; Miao, B.B.; Liang, Z.B.; Shen, Y.X. Liver transcriptome changes in pearl gentian grouper in response to acute high-temperature stress. Aquaculture 2024, 593, 741336. [Google Scholar] [CrossRef]
- Deng, S.Z.; Han, Z.F.; Chen, X.M.; Li, Q.C.; Xiao, S.J.; Li, J.K.; Liu, X.D. Transcriptome analysis of high-temperature adaptation in large yellow croaker (Larimichthys crocea). J. Fish. China 2018, 42, 1673–1683. [Google Scholar] [CrossRef]
- Qin, G.; Johnson, C.; Zhang, Y.; Zhang, H.X.; Yin, J.P.; Miller, G.; Turingan, R.G.; Guisbert, E.; Lin, Q. Temperature-induced physiological stress and reproductive characteristics of the migratory seahorse Hippocampus erectus during a thermal stress simulation. Biol. Open 2018, 7, bio032888. [Google Scholar] [CrossRef]
- Qian, B.Y.; Xue, L.Y. Liver transcriptome sequencing and de novo annotation of the large yellow croaker (Larimichthy crocea) under heat and cold stress. Mar. Genom. 2016, 25, 95–102. [Google Scholar] [CrossRef]
- Wei, Y.L.; Zhou, Y.; Huang, S.J.; Lu, J.G.; Chen, L.B. Transcriptome analysis of liver tissue of Nile tilapia Oreochromis niloticus exposed to high temperature stress. J. Dalian Ocean Univ. China 2021, 36, 222–228. [Google Scholar] [CrossRef]
- Feng, C.J.; Liu, X.F.; Zhang, Y.; Lv, W.H.; Han, S.C.; Zhang, Y.Q.; Xu, S.J.; Ma, B. Histological structure and transcriptome characteristics in liver of juvenile Amur grayling (Thymallus arcticus grubei) under high temperature stress. J. Dalian Ocean Univ. China 2023, 38, 603–614. [Google Scholar] [CrossRef]
- Bilyk, K.T.; Cheng, C.H.C. RNA-seq analyses of cellular responses to elevated body temperature in the high Antarctic cryopelagic nototheniid fish Pagothenia borchgrevinki. Mar. Genom. 2014, 18, 163–171. [Google Scholar] [CrossRef] [PubMed]
- Huang, S.J.; Zhou, Y.; Wei, Y.L.; Lu, J.G.; Chen, L.B. Response mechanism of male and female Nile tilapia to persistent high temperature. J. Shanghai Ocean Univ. China 2021, 30, 426–434. [Google Scholar] [CrossRef]
- Bennin, D.A.; Don, A.S.A.; Brake, T.; McKenzie, J.L.; Rosenbaum, H.; Ortiz, L.; DePaoli-Roach, A.A.; Horne, M.C. Cyclin G2 associates with protein phosphatase 2A catalytic and regulatory B’ subunits in active complexes and induces nuclear aberrations and a G1/S phase cell cycle arrest. J. Biol. Chem. 2002, 277, 27449–27467. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Z.Q.; Wang, T.; Shi, F.X. Mediation of the Cell Cycle and Apoptosis by FOXO Transcriptional Factors in Mammals. Chin. J. Cell Biol. 2007, 29, 187–190. [Google Scholar] [CrossRef]
- Katoh, M.; Katoh, M. Human FOX gene family (review). Int. J. Oncol. 2004, 25, 1495–1500. [Google Scholar] [CrossRef]
- Eijkelenboom, A.; Burgering, B.M.T. FOXOs: Signalling integrators for homeostasis maintenance. Nat. Rev. Mol. Cell Bio. 2013, 14, 83–97. [Google Scholar] [CrossRef]
- Sanchez, A.M.J.; Candau, R.B.; Bernardi, H. FoxO transcription factors: Their roles in the maintenance of skeletal muscle homeostasis. Cell. Mol. Life Sci. 2014, 71, 1657–1671. [Google Scholar] [CrossRef]
- An, Y.; Zhang, H.; Wang, C.; Jiao, F.T.; Xu, H.Y.; Wang, X.F.; Luan, W.J.; Ma, F.X.; Ni, L.H.; Tang, X.D.; et al. Activation of ROS/MAPKs/NF-κB/NLRP3 and inhibition of efferocytosis in osteoclast-mediated diabetic osteoporosis. FASEB J. 2019, 33, 12515–12527. [Google Scholar] [CrossRef]
- Cao, N.B.; Liu, X.M.; Deng, Y.; Liu, X.C.; Xin, Y.; Yu, W.X. Reactive oxygen species/c-Jun N-terminal kinase/nuclear factor kappa-B signaling molecules are involved in periodontitis-induced liver injury by regulating apoptosis. WCJS China 2022, 40, 532–540. [Google Scholar] [CrossRef]
- Bellot, G.; Garcia-Medina, R.; Gounon, P.; Chiche, J.; Roux, D.; Pouysségur, J.; Mazure, N.M. Hypoxia-Induced Autophagy Is Mediated through Hypoxia-Inducible Factor Induction of BNIP3 and BNIP3L via Their BH3 Domains. Mol. Cell. Biol. 2009, 29, 2570–2581. [Google Scholar] [CrossRef]
- Deosaran, E.; Larsen, K.B.; Hua, R.; Sargent, G.; Wang, Y.Q.; Kim, S.; Lamark, T.; Jauregui, M.; Law, K.; Lippincott-Schwartz, J.; et al. NBR1 acts as an autophagy receptor for peroxisomes. J. Cell Sci. 2013, 126, 939–952. [Google Scholar] [CrossRef]








| Differentially Expressed Genes | Forward Primer Sequence (5′–3′) | Reverse Primer Sequence (5′–3′) | Amplified Length (bp) | Annealing Temperature (°C) | 
|---|---|---|---|---|
| sequestosome-1 | GATTCTACGACGACGAACGG | TTTGCCCAGCAGGTAAGC | 133 | 55 | 
| cyclin-G2 | TTGGAAATAGCCCGTCAC | TCATCCCAGCAGCACTCG | 230 | 55 | 
| ddit3 | GCTATCACCCATTCCCACT | CATACCACGCCTCCAACT | 279 | 55 | 
| fbxo32 | CAGGAAGTGGGAGAAGTT | ACGGCAAGAAGTCAAGTA | 174 | 55 | 
| jun | CTGACTCGCCTGTTTACG | TGGGAAGAGGAGGTGGAT | 163 | 55 | 
| irs2b | CCCCAACGGACTCAACTAC | TGAAGCCCAAGCAAACAT | 137 | 55 | 
| dusp1 | ACTGTCGCTCTTTCCTATCC | AAGTCCCGTCTTTCTTGG | 222 | 55 | 
| foxo4 | CGTGGACTACATCATCAACAG | AATGGAGGAAGAGGCAGAG | 298 | 55 | 
| fdft1 | CACAGTATGGATTTGGGAGA | AACCGTGAACAGGGATTT | 290 | 55 | 
| pcna | CTGTAGTCTCCCGTGTAGC | ATGCCTCCGTGATTAGAT | 263 | 55 | 
| cyp51 | CATCTGGTCCACATTGCT | CACAGGATCGGCTCGTAA | 241 | 55 | 
| ap4b1 | TCTCAGACGCCCTTACCT | CCACAGATTCTCAAACCCT | 155 | 55 | 
| Sample | Raw Bases (G) | Clean Bases (G) | Error Rate (%) | Q20 (%) | Q30 (%) | GC (%) | 
|---|---|---|---|---|---|---|
| A21-1 | 6.35 | 5.93 | 0.02 | 98.11 | 96.47 | 52.32 | 
| A21-2 | 6.52 | 5.92 | 0.02 | 98.21 | 96.66 | 52.91 | 
| A21-3 | 6.80 | 6.39 | 0.02 | 98.30 | 96.62 | 53.35 | 
| B24-1 | 6.47 | 6.16 | 0.02 | 98.19 | 96.34 | 51.87 | 
| B24-2 | 6.77 | 6.37 | 0.02 | 98.17 | 96.51 | 53.16 | 
| B24-3 | 6.19 | 5.79 | 0.02 | 98.23 | 96.61 | 53.25 | 
| C27-1 | 6.92 | 6.45 | 0.02 | 98.15 | 96.49 | 53.20 | 
| C27-2 | 7.25 | 6.75 | 0.02 | 98.24 | 96.69 | 52.65 | 
| C27-3 | 6.92 | 6.55 | 0.02 | 98.13 | 96.44 | 52.51 | 
| D18-1 | 6.96 | 6.41 | 0.02 | 98.18 | 96.57 | 52.06 | 
| D18-2 | 6.94 | 6.49 | 0.02 | 98.21 | 96.41 | 51.56 | 
| D18-3 | 6.87 | 6.42 | 0.02 | 98.38 | 96.46 | 51.29 | 
| Sample | Total Reads | Total Map | Unique Map | MULTI MAP | 
|---|---|---|---|---|
| A21-1 | 39,522,906 | 35,741,630 (90.43%) | 34,030,508 (86.10%) | 1,711,122 (4.33%) | 
| A21-2 | 39,495,652 | 36,563,775 (92.58%) | 34,747,355 (87.98%) | 1,816,420 (4.60%) | 
| A21-3 | 42,595,172 | 38,909,260 (91.35%) | 36,925,817 (86.69%) | 1,983,443 (4.66%) | 
| B24-1 | 41,076,774 | 37,305,596 (90.82%) | 35,314,592 (85.97%) | 1,991,004 (4.85%) | 
| B24-2 | 42,468,594 | 39,150,508 (92.19%) | 37,209,326 (87.62%) | 1,941,182 (4.57%) | 
| B24-3 | 38,581,618 | 35,541,904 (92.12%) | 33,568,929 (87.01%) | 1,972,975 (5.11%) | 
| C27-1 | 42,973,976 | 39,843,386 (92.72%) | 37,734,076 (87.81%) | 2,109,310 (4.91%) | 
| C27-2 | 44,986,444 | 41,277,431 (91.76%) | 39,002,262 (86.70%) | 2,275,169 (5.06%) | 
| C27-3 | 43,647,230 | 40,331,388 (92.40%) | 38,000,786 (87.06%) | 2,330,602 (5.34%) | 
| D18-1 | 42,729,370 | 39,206,413 (91.76%) | 36,909,079 (86.38%) | 2,297,334 (5.38%) | 
| D18-2 | 43,289,626 | 38,184,351 (88.21%) | 36,290,236 (83.83%) | 1,894,115 (4.38%) | 
| D18-3 | 42,780,498 | 38,476,968 (89.94%) | 36,470,173 (85.25%) | 2,006,795 (4.69%) | 
| Sample | Exon | Intron | Intergenic | 
|---|---|---|---|
| A21-1 | 4,459,275,023 (83.70%) | 231,829,881 (4.35%) | 636,605,765 (11.95%) | 
| A21-2 | 4,616,877,493 (84.65%) | 207,458,093 (3.80%) | 629,610,344 (11.54%) | 
| A21-3 | 4,930,294,140 (84.93%) | 195,471,967 (3.37%) | 679,379,047 (11.70%) | 
| B24-1 | 4,611,514,520 (82.87%) | 201,496,249 (3.62%) | 751,744,739 (13.51%) | 
| B24-2 | 4,986,874,869 (85.40%) | 180,454,218 (3.09%) | 672,152,429 (11.51%) | 
| B24-3 | 4,492,933,276 (84.74%) | 167,665,253 (3.16%) | 641,209,683 (12.09%) | 
| C27-1 | 4,977,719,258 (83.75%) | 190,662,245 (3.21%) | 775,051,432 (13.04%) | 
| C27-2 | 5,100,358,883 (82.86%) | 213,417,513 (3.47%) | 841,764,754 (13.67%) | 
| C27-3 | 4,983,132,473 (82.82%) | 219,867,981 (3.65%) | 814,149,096 (13.53%) | 
| D18-1 | 4,884,014,252 (83.54%) | 221,703,904 (3.79%) | 740,588,148 (12.67%) | 
| D18-2 | 4,776,421,053 (83.87%) | 246,803,023 (4.33%) | 671,942,060 (11.80%) | 
| D18-3 | 4,744,164,998 (82.63%) | 245,979,219 (4.28%) | 751,205,096 (13.08%) | 
| Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. | 
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xiao, W.; Guo, B.; Tan, J.; Liu, C.; Jiang, D.; Yu, H.; Geng, Z. Transcriptomic Analysis of Hippocampus abdominalis Larvae Under High Temperature Stress. Genes 2024, 15, 1345. https://doi.org/10.3390/genes15101345
Xiao W, Guo B, Tan J, Liu C, Jiang D, Yu H, Geng Z. Transcriptomic Analysis of Hippocampus abdominalis Larvae Under High Temperature Stress. Genes. 2024; 15(10):1345. https://doi.org/10.3390/genes15101345
Chicago/Turabian StyleXiao, Wenjie, Baoying Guo, Jie Tan, Changlin Liu, Da Jiang, Hao Yu, and Zhen Geng. 2024. "Transcriptomic Analysis of Hippocampus abdominalis Larvae Under High Temperature Stress" Genes 15, no. 10: 1345. https://doi.org/10.3390/genes15101345
APA StyleXiao, W., Guo, B., Tan, J., Liu, C., Jiang, D., Yu, H., & Geng, Z. (2024). Transcriptomic Analysis of Hippocampus abdominalis Larvae Under High Temperature Stress. Genes, 15(10), 1345. https://doi.org/10.3390/genes15101345
 
        
 
       