De Novo Mining and Validating Novel Microsatellite Markers to Assess Genetic Diversity in Maruca vitrata (F.), a Legume Pod Borer
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Insect Sampling and DNA Extraction
2.3. SSR Mining and Primer Designing
2.4. Polymerase Chain Reaction (PCR) Amplification
2.5. Genetic Diversity and Population Structure Assessment
3. Results
3.1. Identification and Characterization of EST-SSR Motifs
3.2. Microsatellite Polymorphisms
3.3. Population Genetic Diversity
3.4. Population Genetic Differentiation and Variation
3.5. Analysis of Molecular Variance (AMOVA)
3.6. Mantel Test for Isolation by Distance (IBD)
3.7. Genetic Structure
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ba, M.; Huesing, J.E.; Dabire-Binso, C.; Tamo, M.; Pittendrigh, B.R.; Murdock, L.L. The legume pod borer, Maruca vitrata Fabricius (Lepidoptera: Crambidae), an important insect pest of cowpea: A review emphasizing West Africa. Int. J. Trop. Insect Sci. 2019, 39, 93–106. [Google Scholar] [CrossRef] [Scilit]
- Srinivasan, R.; Tamò, M.; Malini, P. Emergence of Maruca vitrata as a major pest of food legumes and evolution of management practices in Asia and Africa. Annu. Rev. Entomol. 2021, 66, 141–161. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Taggar, G.K.; Singh, R.; Cheema, H.K.; Singh, P. Relative abundance, population dynamics and damage potential of spotted pod borer, Maruca vitrata (Fabricius) on early pigeonpea in Punjab. Int. J. Trop. Insect Sci. 2019, 39, 229–234. [Google Scholar] [CrossRef] [Scilit]
- Chatterjee, M.; Yadav, J.; Vennila, S.; Shashank, P.R.; Jaiswal, N.; Sreevathsa, R.; Rao, U. Diversity analysis reveals genetic homogeneity among Indian populations of legume pod borer, Maruca vitrata (F.). 3 Biotech 2019, 9, 319. [Google Scholar] [CrossRef] [Scilit]
- Mahalle, R.M.; Chakravarty, S.; Srivastava, C.P. Population genetic differentiation and structure of Maruca vitrata (Lepidoptera: Crambidae) in India. Diversity 2022, 14, 546. [Google Scholar] [CrossRef] [Scilit]
- Mahalle, R.; Taggar, G. Insecticides against Maruca vitrata (Fabricius) (Lepidoptera: Crambidae) on pigeonpea. Pestic. Res. J. 2018, 30, 235. [Google Scholar] [CrossRef] [Scilit]
- Padwal, K.G.; Chakravarty, S.; Srivastava, C.P. Genetic variability and population structure of Leucinodes orbonalis (Guenée), a severe insect pest of brinjal in India. J. Environ. Biol. 2018, 43, 59–65. [Google Scholar] [CrossRef] [Scilit]
- Wei, S.J.; Shi, B.C.; Gong, Y.J.; Gui, H.J.; Chen, X.X.; Meng, X.F. Genetic structure and demographic history reveal migration of the diamondback moth Plutella xylostella (Lepidoptera: Plutellidae) from the southern to northern regions of China. PLoS ONE 2013, 8, e59654. [Google Scholar] [CrossRef] [Scilit]
- Chakravarty, S.; Padwal, K.G.; Srivastava, C.P. Molecular characterization of intraspecific variations in Helicoverpa armigera (Hübner) populations across India. J. Environ. Biol. 2021, 42, 1320–1329. [Google Scholar] [CrossRef] [Scilit]
- Periasamy, M.; Schafleitner, R.; Muthukalingan, K.; Ramasamy, S. Phylogeographical structure in mitochondrial DNA of legume pod borer (Maruca vitrata) population in tropical Asia and sub-Saharan Africa. PLoS ONE 2015, 10, e0124057. [Google Scholar] [CrossRef] [Scilit]
- Margam, V.M.; Coates, B.S.; Ba, M.N.; Sun, W.; Binso-Dabire, C.L.; Baoua, I.; Ishiyaku, M.F.; Shukle, J.T.; Hellmich, R.L.; Covas, F.G.; et al. Geographic distribution of phylogenetically distinct legume pod borer, Maruca vitrata (Lepidoptera: Pyraloidea: Crambidae). Mol. Biol. Rep. 2011, 38, 893–903. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Galtier, N.; Nabholz, B.; Glémin, S.; Hurst, G.D.D. Mitochondrial DNA as a marker of molecular diversity: A reappraisal. Mol. Ecol. 2009, 18, 4541–4550. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sethuraman, A.; Janzen, F.J.; Weisrock, D.W.; Obrycki, J.J. Insights from population genomics to enhance and sustain biological control of insect pests. Insects 2020, 11, 462. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, K.S.; Ratcliffe, S.T.; French, B.W.; Liu, L.; Sappington, T.W. Utility of EST-derived SSRs as population genetic markers in a beetle. J. Hered. 2008, 99, 112–124. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Agunbiade, T.A.; Coates, B.S.; Kim, K.S.; Forgacs, D.; Margam, V.M.; Murdock, L.L.; Ba, M.N.; Binso-Dabire, C.L.; Baoua, I.; Ishiyaku, M.F.; et al. The spatial genetic differentiation of the legume pod borer, Maruca vitrata F. (Lepidoptera: Crambidae) populations in West Africa. Bull. Entomol. Res. 2012, 102, 589–599. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Anuradha, U.; Anuradha, S.K.; Priya, C.; Karibasappa, G.S.. Microsatellite and RAPD analysis of grape (Vitis spp.) accessions and identification of duplicates/misnomers in germplasm collection. Indian J. Hortic. 2010, 67, 8–15. [Google Scholar]
- Tian, R.; Zhang, C.; Huang, Y.; Guo, X.; Chen, M. A novel software and method for the efficient development of polymorphic SSR loci based on transcriptome data. Genes 2019, 10, 917. [Google Scholar] [CrossRef] [Scilit]
- Sun, J.T.; Zhang, Y.K.; Ge, C.; Hong, X.Y. Mining and characterization of sequence tagged microsatellites from the brown plant hopper Nilaparvata lugens. J. Insect Sci. 2011, 11, 134. [Google Scholar] [CrossRef] [Scilit]
- Cao, L.J.; Li, Z.M.; Wang, Z.H.; Zhu, L.; Gong, Y.J.; Chen, M.; Wei, S.J. Bulk development and stringent selection of microsatellite markers in the western flower thrips Frankliniella occidentalis. Sci. Rep. 2016, 6, 26512. [Google Scholar] [CrossRef] [Scilit]
- Margam, V.M.; Coates, B.S.; Hellmich, R.L.; Agunbiade, T.; Seufferheld, M.J.; Sun, W.; Ba, M.N.; Sanon, A.; Binso-Dabire, C.L.; Baoua, I.; et al. Transcriptome sequencing, and rapid development and application of SNP markers for the legume pod borer Maruca vitrata (Lepidoptera: Crambidae). PLoS ONE 2011, 6, e21388. [Google Scholar] [CrossRef] [Scilit]
- Beier, S.; Thiel, T.; Münch, T.; Scholz, U.; Mascher, M. MISA-web: A web server for microsatellite prediction. Bioinformatics 2017, 33, 2583–2585. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- You, F.M.; Huo, N.; Gu, Y.Q.; Luo, M.-C.; Ma, Y.; Hane, D.; Lazo, G.R.; Dvorak, J.; Anderson, O.D. BatchPrimer3: A high throughput web application for PCR and sequencing primer design. BMC Bioinform. 2008, 9, 253. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, K.; Muse, S.V. PowerMarker: Integrated analysis environment for genetic marker data. BMC Bioinform. 2005, 21, 2128–2129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research—An update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [Scilit]
- Van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.; Shipley, P. Micro-checker: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar] [CrossRef] [Scilit]
- Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of population structure using multilocus genotype data. Genetics 2000, 155, 945–959. [Google Scholar] [CrossRef] [Scilit]
- Earl, D.A.; VonHoldt, B.M. Structure Harvester: A website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv. Genet. Res. 2012, 4, 359–361. [Google Scholar] [CrossRef] [Scilit]
- Takezaki, N.; Nei, M.; Tamura, K. POPTREE2: Software for constructing population trees from allele frequency data and computing other population statistics with Windows interface. Mol. Biol. Evol. 2010, 27, 747–752. [Google Scholar] [CrossRef] [Scilit]
- Slatkin, M. Gene flow and the geographic structure of natural populations. Science 1987, 236, 787–792. [Google Scholar] [CrossRef] [Scilit]
- Chen, C.; Chu, Y.; Ding, C.; Su, X.; Huang, Q. Genetic diversity and population structure of black cottonwood (Populus deltoides) revealed using simple sequence repeat markers. BMC Genet. 2020, 21, 2. [Google Scholar] [CrossRef] [Scilit]
- Wright, S. The genetical structure of populations. Ann. Eugen. 1949, 15, 323–354. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Renuka, P.; Madhav, M.S.; Padmakumari, A.P.; Barbadikar, K.M.; Mangrauthia, S.K.; Rao, K.V.S.; Marla, S.S.; Babu, V.R. RNA-seq of rice yellow stem borer Scirpophaga incertulas reveals molecular insights during four larval developmental stages. G3 Genes Genomes Genet. 2017, 7, 3031–3045. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.J.; Hao, Y.; Si, F.; Ren, S.; Hu, G.; Shen, L.; Chen, B. The de novo transcriptome and its analysis in the worldwide vegetable pest, Delia antiqua (Diptera: Anthomyiidae). G3 Genes Genomes Genet. 2014, 4, 851–859. [Google Scholar] [CrossRef] [Scilit]
- Weng, Y.; Azhaguvel, P.; Michels, G.J., Jr.; Rudd, J.C. Cross-species transferability of microsatellite markers from six aphid (Hemiptera: Aphididae) species and their use for evaluating biotypic diversity in two cereal aphids. Insect Mol. Biol. 2007, 16, 613–622. [Google Scholar] [CrossRef] [Scilit]
- Ma, L.; Cao, L.J.; Gong, Y.J.; Hoffmann, A.; Zeng, A.P.; Wei, S.J.; Zhou, Z.S. Development of novel microsatellites for population genetic analysis of Phenacoccus solenopsis Tinsley (Hemipeta: Pseudoccoccidae) based on genomic analysis. Int. J. Biol. Macromol. 2019, 121, 1135–1144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bosamia, T.C.; Mishra, G.P.; Thankappan, R.; Dobaria, J.R. Novel and stress relevant EST derived SSR markers developed and validated in peanut. PLoS ONE 2015, 10, e0129127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, P.; Huang, C.L.; Luo, M.X.; Hsu, Y.F.; Wang, R.J. Development and characterization of novel microsatellite markers in chestnut tiger butterfly Parantica sita (Lepidoptera: Nymphalidae) using next-generation sequencing. Appl. Entomol. Zool. 2020, 55, 281–286. [Google Scholar] [CrossRef] [Scilit]
- Kamimura, Y.; Abe, J.; Ferreira, R.L.; Yoshizawa, K. Microsatellite markers developed using a next-generation sequencing technique for Neotrogla spp. (Psocodea: Prionoglarididae), cave dwelling insects with sex-reversed genitalia. Entomol. Sci. 2019, 22, 48–55. [Google Scholar] [CrossRef] [Scilit]
- Jun, T.H.; Michel, A.P.; Mian, M.R. Development of soybean aphid genomic SSR markers using next generation sequencing. Genome 2011, 54, 360–367. [Google Scholar] [CrossRef] [Scilit]
- Luo, M.; Zhang, H.; Bin, S.; Lin, J. High-throughput discovery of SSR genetic markers in the mealybug, Phenacoccus solenopsis (Hemiptera: Pseudococcidae), from its transcriptome database. Acta Entomol. Sin. 2014, 57, 395–400. [Google Scholar]
- Jing, S.; Liu, B.; Peng, X.; Zhu, L.; Fu, Q.; He, G. Development and use of EST-SSR markers for assessing genetic diversity in the brown planthopper (Nilaparvata lugens Stal). Bull. Entomol. Res. 2012, 102, 113–122. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Malausa, T.; Gilles, A.; Meglécz, E.; Blanquart, H.; Duthoy, S.; Costeduat, C.; Dubut, V.; Pech, N.; Castagnone-Sereno, P.; Délye, C.; et al. High-throughput microsatellite isolation through 454 GS-FLX Titanium pyrosequencing of enriched DNA libraries. Mol. Ecol. Resour. 2011, 11, 638–644. [Google Scholar] [CrossRef] [Scilit]
- Qian, J.; Xu, H.; Song, J.; Xu, J.; Zhu, Y.; Chen, S. Genome-wide analysis of simple sequence repeats in the model medicinal mushroom Ganoderma lucidum. Gene 2013, 512, 331–336. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hinge, V.R.; Shaikh, I.M.; Chavhan, R.L.; Deshmukh, A.S.; Shelake, R.M.; Ghuge, S.A.; Dethe, A.M.; Suprasanna, P.; Kadam, U.S. Assessment of genetic diversity and volatile content of commercially grown banana (Musa spp.) cultivars. Sci. Rep. 2022, 12, 7979. [Google Scholar] [CrossRef] [Scilit]
- Upadhyay, A.; Kadam, U.S.; Chacko, P.M.; Aher, L.; Karibasappa, G.M. Microsatellite analysis to differentiate clones of Thompson seedless grapevine. Indian J. Hortic. 2010, 67, 260–263. [Google Scholar]
- Zhu, J.Y.; Ze, S.Z.; Cao, L.J.; Yang, B. Development of microsatellite markers for the plant bug, Pachypeltis micranthus (Hemiptera: Miridae). Appl. Entomol. Zool. 2016, 51, 327–331. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.Z.; Cao, L.J.; Zhu, J.Y.; Wei, S.J. Development and characterization of novel microsatellite markers for the peach fruit moth Carposina sasakii (Lepidoptera: Carposinidae) using next-generation sequencing. Int. J. Mol. Sci. 2016, 17, 362. [Google Scholar] [CrossRef] [Scilit]
- Duan, X.L.; Zhao, B.A.; Liu, Y.; Xiong, M.Q.; He, N.; Huang, S.K.; Huang, W.F.; Li, J.H. Development and characterization of six novel microsatellite markers for honey bee parasitic mite Varroa destructor (Mesostigmata: Varroidae). Syst. Appl. Acarol. 2020, 25, 1733–1744. [Google Scholar] [CrossRef] [Scilit]
- Duan, X.; Wang, K.; Su, S.; Tian, R.; Li, Y.; Chen, M. De novo transcriptome analysis and microsatellite marker development for population genetic study of a serious insect pest, Rhopalosiphum padi (L.) (Hemiptera: Aphididae). PLoS ONE 2017, 12, e0172513. [Google Scholar] [CrossRef] [Scilit]
- Hu, L.; Zhao, Y.; Yang, Y.; Niu, D.; Wang, R.; Cheng, J.; Yang, F. De novo RNA-Seq and functional annotation of Sarcoptes scabieicanis. Parasitol. Res. 2016, 115, 2661–2670. [Google Scholar] [CrossRef] [Scilit]
- Niu, D.; Wang, R.; Zhao, Y.; Yang, R.; Hu, L. De novo RNA-seq and functional annotation of Ornithonyssus bacoti. Exp. Appl. Acarol. 2018, 75, 191–208. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.T.; Zhang, Y.J.; Qiao, L.; Chen, B. Comparative analyses of simple sequence repeats (SSRs) in 23 mosquito species genomes: Identification, characterization and distribution (Diptera: Culicidae). Insect Sci. 2019, 26, 607–619. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meglécz, E.; Nève, G.; Biffin, E.; Gardner, M.G. Breakdown of phylogenetic signal: A survey of microsatellite densities in 454 shotgun sequences from 154 non model eukaryote species. PLoS ONE 2012, 7, e40861. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tóth, G.; Gáspári, Z.; Jurka, J. Microsatellites in different eukaryotic genomes: Survey and analysis. Genome Res. 2000, 10, 967–981. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Botstein, D.; White, R.L.; Skolnick, M.; Davis, R.W. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet. 1980, 32, 314–331. [Google Scholar] [PubMed]
- Silva, C.S.; Cordeiro, E.M.G.; Corrêa, A.S. Isolation and characterization of microsatellite markers for soybean looper (Lepidoptera: Noctuidae). J. Insect Sci. 2019, 19, 22. [Google Scholar] [CrossRef] [Scilit]
- Meglécz, E.; Anderson, S.J.; Bourguet, D.; Butcher, R.; Caldas, A.; Cassel-Lundhagen, A.; d’Acier, A.C.; Dawson, D.A.; Faure, N.; Fauvelot, C.; et al. Microsatellite flanking region similarities among different loci within insect species. Insect Mol. Biol. 2007, 16, 175–185. [Google Scholar] [CrossRef] [Scilit]
- Tay, W.T.; Behere, G.T.; Batterham, P.; Heckel, D.G. Generation of microsatellite repeat families by RTE retrotransposons in lepidopteran genomes. BMC Evol. Biol. 2010, 10, 144. [Google Scholar] [CrossRef] [Scilit]
- Van’t Hof, A.E.; Brakefield, P.M.; Saccheri, I.J.; Zwaan, B.J. Evolutionary dynamics of multilocus microsatellite arrangements in the genome of the butterfly Bicyclus anynana, with implications for other Lepidoptera. Heredity 2007, 98, 320–328. [Google Scholar] [CrossRef] [Scilit]
- Coates, B.S.; Sumerford, D.V.; Hellmich, R.L.; Lewis, L.C. A Helitron-like transposon superfamily from Lepidoptera disrupts (GAAA)n microsatellites and is responsible for flanking sequence similarity within a microsatellite family. J. Mol. Evol. 2010, 70, 275–288. [Google Scholar] [CrossRef] [Scilit]
- Francischini, F.J.B.; de Campos, J.B.; Alves-Pereira, A.; Viana, J.P.G.; Grinter, C.C.; Clough, S.J.; Zucchi, M.I. Morphological and molecular characterization of Brazilian populations of Diatraea saccharalis (Fabricius, 1794) (Lepidoptera: Crambidae) and the evolutionary relationship among species of Diatraea guilding. PLoS ONE 2017, 12, e0186266. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, J.; Tian, L.; Xu, B.; Xie, W.; Wang, S.; Zhang, Y.; Wang, X.; Wu, Q. Insight into the migration routes of Plutella xylostella in China using mt COI and ISSR markers. PLoS ONE 2015, 10, e0130905. [Google Scholar] [CrossRef] [Scilit]
- Kim, I.S.; Bae, J.S.; Lee, K.S.; Kim, E.S.; Lee, H.S.; Ryu, K.S.; Yoon, H.J.; Jin, B.R.; Moon, B.U.; Sohn, H.D. Mitochondrial COI gene sequence-based population genetic structure of the diamondback moth, Plutella xylostella, in Korea. Genes Genom. 2003, 25, 155–172. [Google Scholar]
- Capriol, M.A.; Tabashnik, B.E. Allozymes used to estimate gene flow among populations of diamondback moth (Lepidoptera: Plutellidae) in Hawaii. Environ. Entomol. 1992, 21, 808–816. [Google Scholar] [CrossRef] [Scilit]
- Chang, W.X.Z.; Tabashnik, B.E.; Artelt, B.; Malvar, T.; Ballester, V.; Ferré, J.; Roderick, G.K. Mitochondrial DNA sequence variation among geographic strains of diamondback moth (Lepidoptera: Plutellidae). Ann. Entomol. Soc. Am. 1997, 90, 590–595. [Google Scholar] [CrossRef] [Scilit]
- Endersby, N.M.; McKechnie, S.W.; Ridland, P.M.; Weeks, A.R. Microsatellites reveal a lack of structure in Australian populations of the diamondback moth, Plutella xylostella (L.). Mol. Ecol. 2006, 15, 107–118. [Google Scholar] [CrossRef] [Scilit]
- Li, M.M.; Li, B.L.; Jiang, S.X.; Zhao, Y.W.; Xu, X.L.; Wu, J.X. Microsatellite-based analysis of genetic structure and gene flow of Mythimna separata (Walker) (Lepidoptera: Noctuidae) in China. Ecol. Evol. 2019, 9, 13426–13437. [Google Scholar] [CrossRef] [Scilit]
- Elameen, A.; Klütsch, C.F.C.; Floystad, I.; Knudsen, G.K.; Tasin, M.; Hagen, S.B.; Eiken, H.G. Large-scale genetic admixture suggests high dispersal in an insect pest, the apple fruit moth. PLoS ONE 2020, 15, e0236509. [Google Scholar] [CrossRef] [Scilit]
- Srivastava, C.P.; Pimbert, M.P.; Jadhav, D.R. Monitoring adult populations of Maruca testulalis (Geyer) with light traps at Patancheru and Hisar in India. Int. Pigeonpea Newsl. 1992, 15, 27–28. [Google Scholar]
- Chaitanya, T.; Sreedevi, K.; Navatha, L.; Krishna, T.M.; Prasanti, L. Bionomics and population dynamics of legume pod borer, Maruca vitrata (Geyer) in Cajanus cajan (L.) Millsp. Curr. Biot. 2012, 5, 446–453. [Google Scholar]
- Sampathkumar, S.; Durairaj, C. Relative abundance of legume pod borer, Maruca vitrata Geyer (Lepidoptera: Crambidae) on pigeonpea and its relationship with weather parameters. Madras Agric. J. 2015, 102, 67–70. [Google Scholar]
- Sreekanth, M.; Lakshmi, M.S.M.; Koteswara, R.Y. Efficacy and economics of certain new generation novel insecticides against legume pod borer, Maruca vitrata (Geyer) on pigeonpea (Cajanus cajan L.). J. Appl. Biol. Biotech. 2015, 3, 7–10. [Google Scholar]




| Zones | Location | Code | State | Latitude | Longitude |
|---|---|---|---|---|---|
| North East Plain Zone (NEPZ) | Dimapur | DMV | Nagaland | 25.0454° N | 93.0330° E |
| Agartala | AGTL | Tripura | 23.9137° N | 91.3203° E | |
| Varanasi | BSB | Uttar Pradesh | 25.2677° N | 82.9913° E | |
| Kalyani | KYI | West Bengal | 22.9452° N | 88.5336° E | |
| North West Plain Zone (NWPZ) | Kanpur | CNB | Uttar Pradesh | 26.4400° N | 80.3300° E |
| Ludhiana | LDH | Punjab | 30.9010° N | 75.8071° E | |
| Hisar | HSR | Haryana | 29.1416° N | 75.7112° E | |
| New Delhi | NDLS | Delhi | 28.6377° N | 77.1571° E | |
| Pantnagar | PBW | Uttarakhand | 29.0222° N | 79.4908° E | |
| Central Zone (CZ) | Jabalpur | JBP | Madhya Pradesh | 23.2072° N | 79.9540° E |
| Raipur | R | Chhattisgarh | 21.2382° N | 81.7048° E | |
| Dapoli | DPLI | Maharashtra | 17.7496° N | 73.1785° E | |
| Latur | LUR | Maharashtra | 18.4186° N | 76.6161° E | |
| Dantiwada | DWZ | Gujarat | 24.3217° N | 72.3177° E | |
| South Zone (SZ) | Bhubaneswar | BBS | Orissa | 20.2650° N | 85.8115° E |
| Hyderabad | HYB | Telangana | 17.3148° N | 78.1612° E | |
| Guntur | GNT | Andhra Pradesh | 16.3611° N | 80.4348° E | |
| Raichur | RC | Karnataka | 16.2043° N | 77.3345° E | |
| Dharwad | DWR | Karnataka | 15.4889° N | 74.9813° E | |
| Kalaburagi | KLBG | Karnataka | 17.3204° N | 76.8397° E |
| Primer ID | Forward (5′−3′) | Length (bp) | Tm (°C) | Reverse (5′−3′) | Length (bp) | Tm (°C) | Expected Product Size (bp) | Motif |
|---|---|---|---|---|---|---|---|---|
| MvR1 | GGACGAAAAGGATGTGGAGA | 20 | 60.05 | GATGCCTCGCTGCTAACACT | 20 | 60.57 | 173 | (CG)6 |
| MvR2 | TGGCAGTCTCAGAAGCAGTG | 20 | 60.33 | GATGTCGGACTGGTTGTTCC | 20 | 60.37 | 177 | (CG)6 |
| MvR3 | ATGGGCCACACGACATAAAA | 20 | 61.15 | GCCTTGGCAGTCTCAGAAAT | 20 | 59.43 | 151 | (AC)6 |
| MvR4 | GGACGCACACAGACAAACAC | 20 | 60.21 | GCTCAAAGATTGCCGGTCTA | 20 | 60.35 | 188 | (AC)6 |
| MvR5 | GTGCCTTGGCAGTCTCAGTT | 20 | 60.45 | TAGGAACCCCTTCACAATGG | 20 | 59.78 | 178 | (CTT)5 |
| MvR6 | AAACTCAACAAAATGCTACCAAA | 23 | 57.94 | CAGCAGTGGAACGGAAATG | 19 | 60.25 | 199 | (ATC)8 |
| MvR7 | CTTGGCAGTCTCAGAGCACA | 20 | 60.33 | TTGACGTCGTAGGGGATGAC | 20 | 60.92 | 186 | (ATC)7 |
| MvR8 | GTAGTCGAACATCCCGCACT | 20 | 60.14 | CGCGTCATCAGGCATAGTAA | 20 | 59.86 | 171 | (TGA)5 |
| MvR9 | TGGCGACTCTATTGCCTTCT | 20 | 59.98 | GTTGGCTGACACATCATTGC | 20 | 60.13 | 181 | (GAG)6 |
| MvR10 | GGTGTGTGAAGCCATGTCAG | 20 | 60.16 | GGCCCCTTAGGCAAAGTAAC | 20 | 59.97 | 172 | (AAG)5 |
| MvR11 | TTGTGTGGTGACTGCGAAAT | 20 | 60.16 | CGTGTAATTTGCGTTCGTGA | 20 | 60.70 | 176 | (GAT)6 |
| MvR12 | CCGACTTTCACACAAAAGCA | 20 | 59.88 | CGCCCTAGTTTAGGGTAGGC | 20 | 60.11 | 176 | (ATC)8 |
| MvR13 | ACCCACGACTCTTGGCATAA | 20 | 60.52 | ACCAACCTGCACTTTTCCAG | 20 | 60.15 | 177 | (ATC)8 |
| MvR14 | CCACCATTTCCGTTGTTGTC | 20 | 61.20 | TATCCCCGGAATGTTGATTG | 20 | 60.52 | 173 | (TTG)5 |
| MvR15 | CCACCATTTCCGTTGTTCTC | 20 | 60.35 | GACTATCCCCGGAATGTTGA | 20 | 59.75 | 176 | (TTG)5 |
| MvR16 | TGACTGGCTGGAGTCATCTG | 20 | 59.98 | CTCCGATGGCAACTCATCTT | 20 | 60.22 | 175 | (CGA)6 |
| MvR17 | CGATGATGATGACGAAGACG | 20 | 60.22 | ACGTCTTTTTGCGATGGTTT | 20 | 59.61 | 176 | (GAT)8 |
| MvR18 | TGCAGCTGTTCTGGTATTGG | 20 | 59.86 | CAGCGGTCCGACTATTGTTT | 20 | 60.13 | 191 | (AAG)5 |
| MvR19 | GACGAATATCAAGGCGAACG | 20 | 60.61 | CGATGACAATCCCAGCACTT | 20 | 61.07 | 163 | (AATA)6 |
| MvR20 | GACAAGAGTGGCCATTACGG | 20 | 60.52 | TTCCGTGTCTGGGTGTGTTA | 20 | 60.00 | 181 | (TAAA)5 |
| MvR21 | GGCAGTCGGTTAGAAGTAGCC | 21 | 60.28 | GAGGGAAAACATGAGCTGGA | 20 | 60.20 | 172 | (ACAG)5 |
| MvR22 | CAGATTGCGTCCACTTTTCA | 20 | 59.84 | GAACTGTGGACCGCTGAGAG | 20 | 61.01 | 175 | (ATAC)5 |
| MvR23 | GTAACAGCCGTTCCGACAAC | 20 | 60.56 | TCAGGACTCCAGGTCTCACC | 20 | 60.24 | 192 | (AC)8(CA)9ctgacacatacacac tcacacacactgacacact(CA)7 |
| MvR24 | CCTCGCTACAAGCTCACCAT | 20 | 60.42 | ATCTGCGCGTATGTGTGTGT | 20 | 60.22 | 164 | (CA)6cg(CA)20cg(CA)5 |
| MvR25 | CCTTCGATGAGTCCCTGAGT | 20 | 59.25 | TGTGTGTGTGTGTGTGTGTGA | 21 | 59.00 | 166 | (AC)8tcacacactcact(CA)19 ctcact(CA)18cttt(CA)6 |
| Features | Values |
|---|---|
| Total number of sequences examined | 10,053 |
| Total size of examined sequences (bp) | 5,328,011 |
| Total number of identified SSRs | 234 (2.33%) |
| Number of SSR-containing sequences | 196 (1.95%) |
| Number of sequences containing more than one SSR | 24 (10.26%) |
| Number of SSRs present in compound formation | 13 (5.56%) |
| Motif Length | Repeats Number | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 15 | 18 | 19 | 20 | 23 | Total | % | |
| Dinucleotide | 0 | 24 | 2 | 5 | 5 | 6 | 1 | 3 | 1 | 3 | 2 | 1 | 2 | 55 | 23.50 |
| Trinucleotide | 74 | 52 | 9 | 8 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 144 | 61.53 |
| Tetranucleotide | 17 | 17 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 35 | 14.95 |
| Total | 91 | 93 | 11 | 13 | 5 | 8 | 1 | 3 | 1 | 3 | 2 | 1 | 2 | 234 | - |
| Frequency (%) | 38.89 | 39.74 | 4.70 | 5.56 | 2.14 | 3.42 | 0.42 | 1.28 | 0.42 | 1.28 | 0.85 | 0.43 | 0.85 | - | - |
| Repeat Motif | Repeats Number | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| 5 | 6 | 7 | 8 | 9 | 10 | >11 | Total | Frequency (%) | |
| Dinucleotide | |||||||||
| AC/GT | 0 | 8 | 2 | 5 | 2 | 1 | 13 | 31 | 56.36 |
| AT/AT | 0 | 12 | 0 | 0 | 3 | 5 | 0 | 20 | 36.36 |
| CG/CG | 0 | 4 | 0 | 0 | 0 | 0 | 0 | 4 | 7.27 |
| Total | 0 | 24 (43.6%) | 2 (3.6%) | 5 (9.1%) | 5 (9.1%) | 6 (10.9%) | 13 (23.6%) | 55 | - |
| Trinucleotide | |||||||||
| AAC/GTT | 6 | 1 | 0 | 0 | 0 | 1 | 0 | 8 | 5.56 |
| AAG/CTT | 15 | 1 | 2 | 0 | 0 | 0 | 0 | 18 | 12.50 |
| AAT/ATT | 30 | 4 | 4 | 0 | 0 | 0 | 0 | 38 | 26.39 |
| ACG/CGT | 0 | 38 | 0 | 0 | 0 | 0 | 0 | 38 | 26.39 |
| ACT/AGT | 2 | 0 | 0 | 0 | 0 | 0 | 0 | 2 | 1.39 |
| AGC/CTG | 7 | 0 | 0 | 0 | 0 | 0 | 0 | 7 | 4.86 |
| AGG/CCT | 1 | 2 | 0 | 0 | 0 | 0 | 0 | 3 | 2.08 |
| ATC/ATG | 12 | 6 | 3 | 8 | 0 | 0 | 0 | 29 | 20.14 |
| CCG/CGG | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.69 |
| Total | 74 (51.4%) | 52 (36.1%) | 9 (6.3%) | 8 (5.6%) | 0 | 1 (0.7%) | 0 | 144 | - |
| Tetranucleotide | |||||||||
| AAAG/CTTT | 3 | 0 | 0 | 0 | 0 | 0 | 0 | 3 | 8.57 |
| AAAT/ATTT | 6 | 16 | 0 | 0 | 0 | 1 | 0 | 23 | 65.71 |
| AATG/ATTC | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 2.86 |
| ACAG/CTGT | 4 | 0 | 0 | 0 | 0 | 0 | 0 | 4 | 11.43 |
| ACAT/ATGT | 3 | 0 | 0 | 0 | 0 | 0 | 0 | 3 | 8.57 |
| ACTC/AGTG | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 | 2.86 |
| Total | 17 (48.6%) | 17 (48.6%) | 0 | 0 | 0 | 1 (2.9%) | 0 | 35 | |
| Marker/ Locus | Na | Ne | I | Ho | He | uHe | F | PIC | MAF | H | HWE | Null Allele |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| MvR1 | 2 | 1.53 | 0.53 | 0.22 | 0.35 | 0.37 | 0.36 | 0.51 | 0.53 | 0.59 | 0.28 | no |
| MvR2 | 2 | 1.96 | 0.68 | 0.00 | 0.49 | 0.51 | 1.00 | 0.59 | 0.40 | 0.66 | 0.21 | yes |
| MvR3_locus1 | 3 | 1.16 | 0.31 | 0.10 | 0.14 | 0.14 | −0.29 | 0.14 | 0.93 | 0.14 | 0.33 | no |
| MvR3_locus2 | 3 | 1.53 | 0.63 | 0.24 | 0.34 | 0.35 | 0.32 | 0.47 | 0.68 | 0.50 | 0.24 | no |
| MvR4_locus1 | 2 | 1.98 | 0.69 | 0.50 | 0.50 | 0.51 | −0.01 | 0.37 | 0.55 | 0.50 | 0.96 | no |
| MvR4_locus2 | 4 | 2.77 | 1.14 | 0.65 | 0.64 | 0.66 | −0.02 | 0.57 | 0.45 | 0.64 | 0.57 | no |
| MvR6_locus1 | 2 | 1.23 | 0.34 | 0.21 | 0.19 | 0.19 | −0.12 | 0.25 | 0.85 | 0.27 | 0.61 | no |
| MvR6_locus2 | 5 | 2.12 | 1.06 | 0.68 | 0.53 | 0.54 | −0.29 | 0.54 | 0.63 | 0.57 | 0.88 | no |
| MvR6_locus3 | 2 | 1.43 | 0.48 | 0.37 | 0.30 | 0.31 | −0.23 | 0.33 | 0.78 | 0.37 | 0.32 | no |
| MvR7 | 3 | 1.49 | 0.58 | 0.40 | 0.33 | 0.34 | −0.22 | 0.29 | 0.80 | 0.33 | 0.74 | no |
| MvR8_locus1 | 3 | 2.11 | 0.90 | 0.61 | 0.53 | 0.54 | −0.16 | 0.56 | 0.58 | 0.61 | 0.34 | no |
| MvR8_locus2 | 2 | 1.97 | 0.69 | 0.29 | 0.49 | 0.51 | −0.04 | 0.53 | 0.48 | 0.61 | 0.10 | no |
| MvR9 | 2 | 1.41 | 0.46 | 0.35 | 0.29 | 0.30 | −0.21 | 0.25 | 0.83 | 0.29 | 0.34 | no |
| MvR10 | 3 | 1.63 | 0.70 | 0.12 | 0.39 | 0.40 | −0.07 | 0.50 | 0.65 | 0.53 | 0.18 | no |
| MvR11 | 2 | 1.10 | 0.20 | 0.10 | 0.10 | 0.10 | −0.05 | 0.09 | 0.95 | 0.10 | 0.81 | no |
| MvR13_locus1 | 4 | 2.71 | 1.15 | 0.56 | 0.63 | 0.65 | 0.12 | 0.18 | 0.90 | 0.19 | 0.15 | no |
| MvR13_locus2 | 4 | 3.27 | 1.25 | 0.57 | 0.69 | 0.72 | −0.18 | 0.65 | 0.48 | 0.69 | 0.00 *** | yes |
| MvR14 | 2 | 1.92 | 0.67 | 0.80 | 0.48 | 0.49 | −0.67 | 0.72 | 0.30 | 0.76 | 0.00 ** | yes |
| MvR15 | 3 | 1.11 | 0.23 | 0.10 | 0.10 | 0.10 | −0.04 | 0.36 | 0.60 | 0.48 | 1.00 | no |
| MvR17 | 4 | 3.02 | 1.22 | 0.27 | 0.67 | 0.69 | 0.60 | 0.09 | 0.95 | 0.10 | 0.55 | no |
| MvR18_locus1 | 3 | 2.80 | 1.06 | 0.17 | 0.64 | 0.67 | 0.74 | 0.71 | 0.35 | 0.75 | 0.00 ** | yes |
| MvR18_locus2 | 2 | 2.00 | 0.69 | 0.25 | 0.50 | 0.53 | 0.50 | 0.37 | 0.55 | 0.50 | 0.16 | no |
| MvR19_locus1 | 2 | 1.15 | 0.26 | 0.00 | 0.13 | 0.14 | 1.00 | 0.66 | 0.40 | 0.71 | 0.00 *** | yes |
| MvR19_locus2 | 5 | 2.75 | 1.22 | 0.78 | 0.64 | 0.65 | −0.22 | 0.50 | 0.60 | 0.56 | 0.00 ** | no |
| MvR19_locus3 | 3 | 2.11 | 0.90 | 0.39 | 0.53 | 0.54 | −0.26 | 0.41 | 0.65 | 0.49 | 0.08 | no |
| MvR24 | 3 | 1.38 | 0.54 | 0.13 | 0.28 | 0.28 | 0.55 | 0.63 | 0.50 | 0.68 | 0.01 ** | yes |
| MvR25_locus1 | 3 | 2.55 | 1.01 | 0.29 | 0.61 | 0.63 | 0.52 | 0.56 | 0.58 | 0.61 | 0.03 * | yes |
| MvR25_locus2 | 2 | 1.46 | 0.49 | 0.39 | 0.31 | 0.32 | −0.24 | 0.45 | 0.68 | 0.50 | 0.31 | no |
| Mean | 2.86 | 1.92 | 0.72 | 0.34 | 0.42 | 0.43 | 0.18 | 0.45 | 0.63 | 0.49 | - |
| Zones | N | Na | Ne | I | Ho | He | uHe | FIS | PAL | % P |
|---|---|---|---|---|---|---|---|---|---|---|
| NEPZ | 16 | 1.90 | 1.60 | 0.47 | 0.29 | 0.31 | 0.36 | 0.09 | 2 | 72.41 |
| NWPZ | 20 | 2.17 | 1.72 | 0.55 | 0.32 | 0.34 | 0.38 | 0.02 | 4 | 79.31 |
| CZ | 20 | 2.21 | 1.80 | 0.58 | 0.34 | 0.36 | 0.41 | 0.04 | 4 | 75.86 |
| SZ | 24 | 2.28 | 1.76 | 0.60 | 0.35 | 0.37 | 0.43 | 0.08 | 3 | 86.21 |
| Mean | 20 | 2.14 | 1.72 | 0.55 | 0.32 | 0.34 | 0.40 | 0.06 | - | 68.97 |
| Zones | NEPZ | NWPZ | CZ | SZ |
|---|---|---|---|---|
| NEPZ | - | 3.681 | 3.576 | 4.489 |
| NWPZ | 0.064 | - | 4.859 | 8.505 |
| CZ | 0.065 | 0.049 | - | 7.932 |
| SZ | 0.053 | 0.029 | 0.031 | - |
| Source | df | Sum of Squares | Variance of Components | Percentage Variation (%) | F Statistics |
|---|---|---|---|---|---|
| Among populations | 3 | 41.558 | 0.353 | 5 | FIS = 0.415 (p < 0.001) |
| Among locations within populations | 16 | 165.492 | 3.034 | 40 | FST = 0.046 (p < 0.005) |
| Within locations | 20 | 85.500 | 4.275 | 56 | FIT = 0.442 (p < 0.001) |
| Total | 39 | 292.550 | 7.662 | 100 | - |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mahalle, R.M.; Bosamia, T.C.; Chakravarty, S.; Srivastava, K.; Meena, R.S.; Kadam, U.S.; Srivastava, C.P. De Novo Mining and Validating Novel Microsatellite Markers to Assess Genetic Diversity in Maruca vitrata (F.), a Legume Pod Borer. Genes 2023, 14, 1433. https://doi.org/10.3390/genes14071433
Mahalle RM, Bosamia TC, Chakravarty S, Srivastava K, Meena RS, Kadam US, Srivastava CP. De Novo Mining and Validating Novel Microsatellite Markers to Assess Genetic Diversity in Maruca vitrata (F.), a Legume Pod Borer. Genes. 2023; 14(7):1433. https://doi.org/10.3390/genes14071433
Chicago/Turabian StyleMahalle, Rashmi Manohar, Tejas C. Bosamia, Snehel Chakravarty, Kartikeya Srivastava, Radhe S. Meena, Ulhas Sopanrao Kadam, and Chandra P. Srivastava. 2023. "De Novo Mining and Validating Novel Microsatellite Markers to Assess Genetic Diversity in Maruca vitrata (F.), a Legume Pod Borer" Genes 14, no. 7: 1433. https://doi.org/10.3390/genes14071433
APA StyleMahalle, R. M., Bosamia, T. C., Chakravarty, S., Srivastava, K., Meena, R. S., Kadam, U. S., & Srivastava, C. P. (2023). De Novo Mining and Validating Novel Microsatellite Markers to Assess Genetic Diversity in Maruca vitrata (F.), a Legume Pod Borer. Genes, 14(7), 1433. https://doi.org/10.3390/genes14071433

