Next Article in Journal
Combined MITOchondrial-NUCLEAR (MITO-NUCLEAR) Analysis for Mitochondrial Diseases Diagnosis: Validation and Implementation of a One-Step NGS Method
Next Article in Special Issue
lmo4a Contributes to Zebrafish Inner Ear and Vestibular Development via Regulation of the Bmp Pathway
Previous Article in Journal
Genetic Predictors of Antipsychotic Efflux Impairment via Blood-Brain Barrier: Role of Transport Proteins
Previous Article in Special Issue
Cytoskeletal Keratins Are Overexpressed in a Zebrafish Model of Idiopathic Scoliosis
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

phox2ba: The Potential Genetic Link behind the Overlap in the Symptomatology between CHARGE and Central Congenital Hypoventilation Syndromes

1
Department of Pediatrics, Dalhousie University, Halifax, NS B3K 6R8, Canada
2
Department of Microbiology and Immunology, Dalhousie University, Halifax, NS B3H 4R2, Canada
3
Children’s Hospital of Eastern Ontario Research Institute, Ottawa, ON K1H 8L1, Canada
4
Departments of Pediatrics and Cellular and Molecular Medicine, University of Ottawa, Ottawa, ON K1N 6N5, Canada
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Genes 2023, 14(5), 1086; https://doi.org/10.3390/genes14051086
Submission received: 12 October 2022 / Revised: 6 May 2023 / Accepted: 8 May 2023 / Published: 15 May 2023
(This article belongs to the Special Issue Zebrafish Models for Human Genetic Disease Studies)

Abstract

:
CHARGE syndrome typically results from mutations in the gene encoding chromodomain helicase DNA-binding protein 7 (CHD7). CHD7 is involved in regulating neural crest development, which gives rise to tissues of the skull/face and the autonomic nervous system (ANS). Individuals with CHARGE syndrome are frequently born with anomalies requiring multiple surgeries and often experience adverse events post-anesthesia, including oxygen desaturations, decreased respiratory rates, and heart rate abnormalities. Central congenital hypoventilation syndrome (CCHS) affects ANS components that regulate breathing. Its hallmark feature is hypoventilation during sleep, clinically resembling observations in anesthetized CHARGE patients. Loss of PHOX2B (paired-like homeobox 2b) underlies CCHS. Employing a chd7-null zebrafish model, we investigated physiologic responses to anesthesia and compared these to loss of phox2b. Heart rates were lower in chd7 mutants compared to the wild-type. Exposure to tricaine, a zebrafish anesthetic/muscle relaxant, revealed that chd7 mutants took longer to become anesthetized, with higher respiratory rates during recovery. chd7 mutant larvae demonstrated unique phox2ba expression patterns. The knockdown of phox2ba reduced larval heart rates similar to chd7 mutants. chd7 mutant fish are a valuable preclinical model to investigate anesthesia in CHARGE syndrome and reveal a novel functional link between CHARGE syndrome and CCHS.

1. Introduction

CHARGE is an acronym for ocular coloboma, heart defects, choanal atresia, retardation of growth and development, genitourinary malformation, and ear abnormalities, all of which are common clinical features of CHARGE syndrome [1]. CHARGE syndrome is estimated to occur in 1/10,000 live births [2]. Mutations in the chromodomain helicase DNA binding protein 7 gene (CHD7) [3] occur in 80% of individuals with the syndrome [2,4]. CHD7 is involved in the regulation of neural crest development, a process during embryogenesis giving rise to tissues of the face and skull and forming components of the autonomic nervous system (ANS), which is responsible for modulating the respiratory, cardiovascular, and digestive systems [2,5]. The multiple anomalies, including choanal atresia, tracheoesophageal fistula, and cardiovascular malformations that frequently manifest in CHARGE syndrome, often necessitate surgical repair, requiring anesthesia. CHARGE syndrome patients frequently experience adverse reactions to anesthesia, including heart rate abnormalities, oxygen desaturations, and decreased respiratory rates, which are particularly disconcerting considering the number of procedures under an anesthetic that these individuals often experience [6]. It has been reported that CHARGE patients require higher doses of medication to become anesthetized, suggesting they respond atypically to anesthesia [7].
The paired-like homeobox 2B (PHOX2B) gene is also involved in neural crest development, and loss of function mutations result in Central Congenital Hypoventilation Syndrome (CCHS). CCHS is characterized by dysregulation of the ANS, resulting in the failure of the respiratory system to sense increasing CO2 levels, usually during sleep [5,8,9].
CHARGE syndrome and CCHS share several features. They are both caused by mutations in single genes involved in neural crest development and impair ANS regulation. Like patients with CHARGE syndrome, individuals with CCHS are also at an increased risk of adverse events following anesthesia [10] These clinical similarities and shared developmental origins warrant further investigation into a possible association between CHD7 and PHOX2B and a potential role for PHOX2B in CHARGE syndrome.
Zebrafish are well-recognized as an excellent model for the study of vertebrate development and to model human developmental disorders [11,12]. The larvae are naturally optically transparent, offer inexpensive husbandry, reproduce rapidly, and have many anatomical and physiological features conserved with mammals [13]. Important for the study of CHARGE syndrome, zebrafish neural crest development is highly conserved and well-characterized [14,15]. The zebrafish has served as a model organism for several studies investigating CHARGE syndrome [16,17]. Our group previously employed CRISPR/Cas9 genome editing technology to create a loss of function frameshift mutation in the chd7 gene, generating a zebrafish model of CHARGE [18], which recapitulates many of the features of the human syndrome [19].
We aimed to investigate the expression of phox2ba and phox2bb genes and anesthetic recovery behavior in a zebrafish model of CHARGE syndrome to further understand the causative factors of the adverse events experienced by CHARGE patients undergoing anesthesia and sedation. We observed lower heart rates in our chd7 mutant fish and a difference in time to reach anesthesia, with higher respiratory rates during anesthetic recovery. Knockdown of phox2ba also reduced heart rates in zebrafish larvae. chd7 mutant larvae also had lower expression of phox2ba.

2. Materials and Methods

2.1. Zebrafish Husbandry and Genetic Lines

All zebrafish were housed and maintained in a recirculating commercial housing system (Pentair, Apopka, FL, USA) at 28 °C in 14 h:10 h light:dark conditions and bred according to standard protocol [20]. Embryos were collected and grown in E3 medium (5 mM NaCl, 0.17 mM KCl, 0.33 mM CaCl2, 0.33 mM MgSO4) in incubators maintained at 28 °C. Embryo plates were cleaned every 24 h, removing debris, dead embryos, and chorion material. E3 media was also changed every 24 h. All larvae were used experimentally before 7 days post-fertilization (dpf) unless otherwise noted. The use of zebrafish in this study was approved by the Dalhousie University Committee on Laboratory Animals under protocols #17-131, #17-055, and #17-141. When required for the experiment, embryos and larvae were euthanized by exposure to 10% tricaine solution (0.4%) prepared in E3 media and observed under a dissecting microscope until the heart stopped beating. They were then discarded, as outlined and approved by the Dalhousie University Committee on Laboratory Animals.
A zebrafish model of CHARGE syndrome was created in a Tübingen wild-type (WT) strain background using clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9-mediated mutation of chd7 in our lab, as described previously [18,19]. This resulted in a 2-base pair deletion, resulting in a loss-of-function frameshift mutation in the zebrafish chd7 gene. These chd7 mutant larvae (both chd7+/− and chd7/) exhibit similar developmental abnormalities to those seen in chd7 morphants, including pericardial edema, curvature of the spine, small eyes, and cardiomegaly [19]. WT Tübingen, Casper, and genotyped chd7+/+ animals served as controls in these experiments.

2.2. Genotyping Mutant Lines

Genotyping of the chd7 CRISPR fish was originally done using T7 Endonuclease I (M0302S; New England Biolabs Inc., Ipswich, MA, USA) digestion according to the manufacturer’s instructions. Subsequently, genotyping was completed using a modified heteroduplex mobility assay (HMA) similar to previously published protocols [21]. Larvae were sacrificed, and genomic DNA was extracted using NaOH. For both assays, we used chd7 primers with the following sequences: forward -AGG ACA TGC CAT TCA CTG GT, reverse—GAG CAC ACA TTC CCT GTC CT, producing a 369 bp amplicon. PCR was performed using Taq polymerase (10342020; Invitrogen, Waltham, MA, USA), and the resulting fragment was run on an 8% polyacrylamide gel. An alternative genotyping procedure relied on digestion of the same chd7 PCR reactions by SmlI (M0302S; New England Biolabs Inc., Ipswich, MA, USA) (7 µL of PCR reaction per 20 µL digestion reaction) with wild-type PCR products being completely digestible, heterozygote products being partially resistant and mutant products being completely resistant.

2.3. In Situ Hybridization and Correlation with Genotype

For in situ hybridization, embryos were sacrificed at the indicated time point and fixed in 4% paraformaldehyde overnight at 4 °C. Larvae were then moved to 100% methanol, permeabilized with 10 μg/mL Proteinase K (Roche, Indianapolis, Indiana) for 10–45 min, rinsed in 1X PBS-T and refixed in 4% paraformaldehyde for 20 min. Whole-mount RNA in situ hybridization (WISH) assays were adapted from protocols published previously [22], using digoxigenin (DIG)-labeled RNA probes and BCIP/NBT detection (Roche Diagnostics, Indianapolis, IN, USA). Probes generated for phox2b were synthesized from cDNA according to a previously published report [23]. Due to an evolutionary full genome duplication event, there are two homologs of phox2b in zebrafish—phox2ba and phox2bb. Probes were generated against both homologs. To examine the expression of these genes, WISH was performed on the whole progeny resulting from an incross of chd7+/- fish. Embryo expression patterns of phox2ba were then scored into ‘normal’, ‘high’, or ‘low’ expression categories by three independent blinded researchers. These WISH expression patterns were compared to those seen in WT Tübingen controls. Since genotyping requires a significant portion of larval tissue in a separate set of larvae, the fish were euthanized and split transversely with a clean scalpel blade just posterior to the yolk sac. The cephalic halves were fixed for in situ hybridization, and the caudal halves were processed for genotyping to correlate expression levels of phox2ba in the caudal half with the chd7 genotype. Care was taken to ensure the head and tail of each fish were labeled to ensure consistent correlations.

2.4. Morpholino Injection

Embryos were obtained by breeding adult Casper [24] zebrafish. Casper zebrafish are wholly optically transparent and were used in this project to enhance visualization of the larval heart. Embryos were injected at the one-cell stage under a ZEISS SteREO Discovery.V8 microscope (Carl Zeiss AG, Oberkochen, Germany) with approximately 1 nL of morpholino (MO) solution using a PLI-100 picoinjector (Harvard Apparatus, Holliston, MA, USA). The solution contained either phox2ba MO (GeneTools, AGCCATAAGATTAGAATGCACTGTT), phox2bb MO (GeneTools, ATACATTGAAAAGGCTCAGTGGAGA), or mismatch control MO (GeneTools) at the concentrations indicated in the results section, together with 0.05% phenol red for visualization in deionized water. Following injection, embryos were maintained in normal E3 media at 28 °C until the experimental time point.

2.5. Cloning and Expression of phox2ba-sfGFP Fusion

We first generated cDNA using LunaScript RT Supermix kit (E3010S; New England Biolabs Inc., Ipswich, MA, USA) from 28 hpf wild-type embryo RNA extracted using PureLink RNA Mini Kit (12183018A; Thermo Fisher Scientific, Waltham, MA, USA). The phox2ba coding sequence was amplified using phox2ba_BamHI_ATG_for (ATGCGGATCCAGAAACATGGCTTATGAACGAGGCGT) and phox2ba_BamHI_linker_rev (GATCGGATCCACTGCCTCCACCGCCACACAGGCACACAGAATCAA) from cDNA using Q5 High-Fidelity 2X Master Mix (M0492S; New England Biolabs Inc., Ipswich, MA, USA) using the standard Q5 protocol with 65 °C annealing temperature. The resulting PCR product was digested with BamHI enzyme and cloned into the BamHI site of the pCS2+MCS-P2A-sfGFP plasmid (Addgene, 74668). The resulting pCS2+phox2ba-sfGFP plasmid and pCS2+TagRFP were linearized by digestion with NotI-HF and extracted with phenol-chloroform. mRNA synthesis was performed using the mMESSAGE mMACHINE SP6 Transcription Kit (AM1340; Thermo Fisher Scientific, Waltham, MA, USA), and RNAs were purified using LiCl precipitation according to the manufacturer’s instructions. The phox2ba-sfGFP and TagRFP mRNAs were diluted to 70 and 30 ng/µL, respectively, and 2 nL boli were injected into one-cell stage zebrafish eggs by standard microinjection procedures. Injected embryos were then imaged using the ZEISS Axio Zoom.V16 microscope.

2.6. Selection of Anesthetic Concentration

Adult casper zebrafish (approx. 3 months of age) were exposed to 1.25, 2.5, or 5% of the tricaine stock solution (0.4%) and observed for up to 8 min to determine the experimental concentration of tricaine that effectively anesthetized fish without being fatal. Zebrafish were not fully anesthetized at 1.25%, and death was observed in several fish at 5% tricaine; therefore, 2.5% tricaine was selected as the optimal concentration for this study.

2.7. Opercular Beat Analysis

Adult zebrafish (approx. 3 months of age, chd7+/+, chd7+/, and chd7/ genotypes) were transferred individually to an experimental arena containing 2.5% tricaine. The tank was recorded using an apparatus that suspended an iPhone over the tank so that the entire tank was within view. The video was recorded in real-time, allowing analysis to occur later. Two key metrics were evaluated following the transfer of fish to the tricaine tank: (1) the length of time it took the fish to lose touch response (indicated by a gentle touch on the caudal tail with tweezers), and (2) the length of time it took for the fish to lose a “fin-pinch response” (defined as a pinch on the caudal fin with the tweezers, widely regarded as the fish “surgical plane” of anesthesia [25]). At this time, the fish was moved to a recovery tank with no tricaine, and the iPhone was positioned for recordings as described above. In this tank, the time to recover touch response was noted. The time to recover fin pinch response was not assessed because the fish had already been provoked. Videos were analyzed, and the rate of opercular movement was assessed for 10 s at several time points: (1) following the loss of touch response; (2) following the loss of fin-pinch response; (3) introduction into the recovery tank, and (4) 10 s prior to recovery of touch response as determined by the video recording. A timeline of this experiment is outlined in Figure S1. This opercular movement rate was extrapolated to determine opercular beats per minute.

2.8. Heart Rate Analysis

Heart rate was assessed in WT Tübingen larvae, chd7/ larvae, and morpholino-injected larvae at 3 dpf. Genotype identity was masked to the researcher assessing heart rate to ensure the evaluation remained unbiased. Larvae were transferred one by one to a well of a 96-well plate in 2.5% tricaine to minimize movement for the duration of the analysis. Heart rate was assessed by observing the larva under a dissecting stereomicroscope and manually counting beats for 15 s, with at least 10 larvae/group. This experiment was completed 3 times. The same procedure was applied to the 3 dpf larvae from crosses of chd7+/ fish injected with either phox2ba-sfGFP or TagRFP mRNAs, except that we measured the heart rates for 30 s and used the alternative genotyping method (see above).

2.9. Statistical Analysis

Statistical analyses and graphing were completed in GraphPad Prism (Version 8.1.1(224)). WISH categorical data were assessed with a Chi-squared test, and all other data were assessed using a one-way ANOVA with a Tukey post-test. For this study, a significance threshold was set to p = 0.05.

3. Results

3.1. phox2ba Expression Is Reduced in chd7 Mutants

We sought to determine the expression of the phox2b gene in zebrafish due to the role of this gene in CCHS and the importance of both PHOX2B and CHD7 in normal neural crest development. As a result of full genome duplication events [26], there are two PHOX2B homologs in the zebrafish: phox2ba and phox2bb. We employed whole-mount in situ hybridization (WISH) to qualitatively assess both the spatial and temporal expression of these homologs. Tübingen larvae (WT) were used as controls. WISH was completed for both phox2ba and phox2bb and sox10, another neural crest gene. Sox10 was previously shown to be regulated by Phox2b in a mouse model [2,5]. Larvae all displayed similar expression patterns for phox2bb and sox10, regardless of genotype (Figure S2). We then examined phox2ba expression patterns in WT embryos and all embryos produced from the heterozygous incross (expected to include chd7+/+, chd7+/, and chd7/ larva; Figure 1A). We observed a subset of larvae with low staining levels, some with high staining levels, but the majority with moderate staining. The anticipated difference between the phox2ba expression patterns between the WT and the chd7+/ led us to examine the correlation between gene expression and genotype further.
To directly determine if phox2ba staining intensity correlated with genotype, we simultaneously performed in situ hybridizations of the larval heads (as phox2ba expression is restricted to the head at this time point) and genotyping of the caudal portion of the corresponding larvae. We performed this experiment in larvae collected from pooled clutches of a heterozygote cross (expected to include chd7+/+, chd7+/, and chd7/ larvae) and WT embryos to increase the confidence of the WT data. We performed WISH and scored them into categories of low staining (score = 1), moderate staining (score = 2), or high staining (score = 3) (Figure 1A). The results of the scoring procedure identified an increased proportion of “low” staining scores in the chd7/ mutant group of larvae (Figure 1B).

3.2. Morpholino-Mediated Knockdown of phox2ba Mimics the Decreased Heart Rates Observed in chd7−/− Larvae

To determine if phox2b genes influence the autonomic nervous system function in zebrafish as PHOX2B does in humans, we transiently knocked down the expression of these genes using morpholinos (MOs). To examine the effects of each protein, we designed translation-blocking morpholinos for both phox2ba and phox2bb. Since MOs are only effective for approximately 72 h, we sought to define a larval phenotype that could be detected in both the chd7 mutants and the phox2b morphants. When examining chd7/ mutant larvae, we determined that, in addition to many of the phenotypic developmental abnormalities seen in our previous studies (enlarged heart, smaller eyes, and a curved spine [19]), we also noted a decreased basal/resting heart rate (average of 168 vs. 182 beats per minute) at 3 days post-fertilization (dpf) (Figure 2A). With this larval phenotype established, we sought to determine if phox2b morphants had a similar phenotype. We injected the phox2ba and phox2bb morpholinos at 0.1, 0.25 or 0.5 mM to determine the optimal concentration. Even at the lowest doses, the knockdown of phox2bb resulted in generalized toxicity that impaired heart rate assessment. By contrast, injection of 0.1 mM phox2ba MO significantly reduced the HR in larvae, compared to control MO-injected larvae (Figure 2B). Higher doses of phox2ba MO resulted in mortality.
We then attempted to rescue the heart rate phenotypes of chd7/ mutant larvae with over-expression of phox2ba-sfGFP mRNA (Figure S3). Upon injection, we observed robust expression of the phox2ba-sfGFP fusion at 28 hpf (Figure S3A) in the embryos from the chd7+/− cross, it did not persist until 3 dpf. Nevertheless, given the possible role of early Phox2ba-driven effects, we recorded heart rates of phox2ba-sfGFP mRNA-injected and control (TagRFP mRNA) larvae at 3 dpf in an unbiased manner, genotyped them, and determined that Phox2ba-sfGFP over-expression did not increase the heart rates of chd7/ mutant larvae or alter heart rates of larvae with other genotypes (Figure S3B). This finding suggests that stable transgenic approaches are required to clarify the role of phox2ba in chd7 mutant zebrafish.

3.3. Chd7 Mutant Adults Exhibit Differential Response to Anesthesia and Opercular Rates

Adult zebrafish (previously genotyped as chd7+/+, chd7/+, or chd7/) at approximately 3 months of age were examined for both behavioral and respiratory responses to anesthesia. Only a small number of chd7/ fish were identified in adult stocks of the mutant line, suggesting that most chd7/ fish died in the larval stage. Briefly, fish were put into experimental tanks containing tricaine and videotaped. While the time to loss of touch response was higher in chd7/ fish than both chd7+/+ and chd7+/ fish, there was a high degree of variability (Figure 3A). However, neither time to loss of fin-pinch response nor time to recovery of touch response were significantly different between genotypes (Figure 3B,C).
We next looked at opercular beat rate as a measure of respiratory rate, as reported by others [27]. We recorded opercular rates throughout anesthesia and observed that opercular rates were not significantly different among the three groups of fish at the point of loss of touch response. However, strikingly, later in the experimental timeline, when the surgical plane of anesthesia was achieved (measured by lack of a fin pinch response [25]), and during the initial recovery period, the opercular beat rate in the chd7−/− fish was significantly (p = 0.0009) higher in comparison with the chd7+/− and chd7+/+ fish groups (Figure 4).

4. Discussion

CHARGE syndrome and CCHS share several similarities. Each of these monogenetic syndromes is thought to arise due to mutations in a single gene (CHD7 and PHOX2B, respectively) that regulates neural crest development [28,29]. Each syndrome is associated with debilitating defects in the control of the ANS. In CCHS, patients cannot detect the low oxygen levels in their blood, which often leads to hypoventilation while sleeping, which can result in death [30]. In individuals with CHARGE syndrome, autonomic dysfunction presents in various ways, with gastrointestinal motility issues [10], heart defects, and dysregulated respiration, especially after anesthetic [6]. Additionally, the hypoventilation seen in CCHS is similar to clinical observations of CHARGE patients recovering from anesthesia. It has been reported that these patients exhibit decreased respiratory rates and abnormal breathing patterns during recovery [6]. In several cases, patients have unidentified postoperative airway events that may resemble hypoventilation. Perhaps unsurprisingly, patients with CCHS also are vulnerable to adverse events following anesthesia [10]. Interestingly, a case report describes a neonate with severe mixed apneas requiring respiratory support that was markedly improved by a tracheostomy. Further genetic testing revealed that this infant had CHARGE syndrome [31]. Considering these clinical similarities, the current study utilized a previously established CRISPR-based chd7 knockout zebrafish model of CHARGE syndrome to assess the potential overlap between these two neurocristopathies.
WISH demonstrated that phox2ba, phox2bb, and sox10 were all expressed in zebrafish larvae. There were no differences in phox2bb or sox10 anatomic expression or intensity in the progeny resulting from an incross of chd7+/− fish (expected to include chd7+/+, chd7+/−, and chd7−/− larvae) and WT larvae (Figure S2). In contrast, phox2ba expression differed in our chd7 knockout fish, with a higher percentage of fish showing reduced expression (Figure 1). The differential spatial expression of phox2ba in our zebrafish model of CHARGE syndrome suggests that, in addition to mutations in CHD7, there may be differences in the expression of other genes involved in regulating neural crest development. To our knowledge, this is the first report of a potential association between PHOX2B and CHD7. While there are other valuable zebrafish models of CHARGE syndrome [16,17], we believe this is the first CHARGE model in zebrafish in which behavioral assessment was conducted.
Next, we set out to investigate the physiological effects of phox2ba reduction experimentally using transient gene knockdown. phox2ba knockdown reduced larval heart rates, similar to what is seen in chd7/− larvae at baseline (Figure 2). This suggests that phox2ba and chd7 may play similar roles in the autonomic control of larval heart rate [32]. The lack of effects from Phox2ba-sfGFP fusion over-expression on the heart rates of chd7/− larvae could be explained either by the limited persistence of Phox2ba-sfGFP fusion after mRNA injection or, more likely, by the more complex program involved in heart rate regulation that is affected by chd7 loss.
Behavioral experiments in adult fish demonstrated that chd7/− fish had differential responses to anesthetic compared with WT fish (Figure 3 and Figure 4). Specifically, the chd7/− fish took longer to lose the touch response (Figure 3A). While there was a high degree of variability within this experimental group, this is in keeping with the significant variability in the clinical features of individuals with CHARGE syndrome. Further, while the chd7/− fish reached the surgical plane of anesthesia, their respiratory rates did not decrease to the same degree as their WT counterparts (Figure 4). This fits with clinical observations of CHARGE patients requiring higher anesthetic doses to become anesthetized [7]. It is worth noting that the loss of fin-pinch response is used experimentally in fish as a benchmark for the surgical plane of anesthesia [25]. Thus, while the chd7−/− did reach the surgical plane of anesthesia, their respiratory rate was significantly elevated in comparison with their chd7−/+ and chd7+/+ counterparts, suggesting they may require higher doses of anesthetic to reach the same level of sedation. We used the zebrafish muscle relaxant tricaine as a surrogate for the inhalant anesthetics to which patients with CHARGE syndrome are exposed. While the pharmacologic class of tricaine is that of a local anesthetic, it has systemic effects in fish, as it is absorbed via their gills and integument [33].
Our zebrafish model has provided new insights into the biology underlying how CHARGE patients experience anesthesia. Experimentally, chd7−/− fish respond differently to anesthesia by taking longer to become anesthetized and having significantly higher respiratory rates while within the surgical plane of anesthesia. This suggests that this zebrafish model could be used as a preclinical platform to assess different classes of anesthetics and to optimize anesthetic choice for individuals with CHARGE syndrome. CHARGE syndrome is currently treated symptomatically, with interventions that usually involve procedures and surgeries requiring anesthesia. Our results support the concept of performing multiple surgeries under one anesthetic, thereby reducing risks associated with repeated anesthesia [6]. By investigating the roles of CHD7 and PHOX2B in CHARGE, we have furthered our understanding of disease pathogenesis, with the overall goal of making anesthesia a safer process in individuals with CHARGE syndrome.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/genes14051086/s1, Figure S1: Respiratory rate behavioural experimental timeline; Figure S2: phox2bb and sox10 expression levels appear similar in chd7+/− incross and wild-type (WT) embryos; Figure S3:Expression of phox2ba-sfGFP mRNA does not rescue reduced heart rate in chd7−/− embryos at 3 dpf.

Author Contributions

Conceptualization, J.N.W. and S.V.P.; Methodology, J.N.W., S.L.S. and S.V.P.; Investigation, J.E.M., J.N.W., E.C., S.L., S.L.S., S.V.P. and K.B. (Kevin Ban).; Formal analysis, J.E.M., J.N.W. and S.V.P.; Writing, J.E.M., J.N.W., S.V.P. and J.N.B.; Supervision, K.B. (Kim Blake) and J.N.B.; Funding acquisition, K.B. (Kim Blake) and J.N.B. All authors have read and agreed to the published version of the manuscript.

Funding

The research presented in this manuscript was supported by lab funding from Rare Diseases: Models & Mechanisms (RDMM), Canadian Institutes of Health Research (CIHR), and individual awards from Dalhousie Medical School summer research funding to Jessica MacLean, from the IWK Health Centre Doctoral Award to Jaime Wertman and a CIHR post-doctoral award to Shelby Steele. Funding for this research was also provided by the CHARGE Syndrome Foundation and The Texas Chargers.

Institutional Review Board Statement

The study was conducted according to the guidelines and policies of the Canadian Council on Animal Care and approved by the University Committee on Laboratory Animals of Dalhousie University (15-134).

Data Availability Statement

The raw data presented in this study are available on request from the corresponding author. The data are not publicly available for privacy reasons.

Acknowledgments

We would like to acknowledge our Zebrafish facility managers and staff David Maley, David Malloy, Gretchen Wagner, Emma Cummings, and Benjamin King.

Conflicts of Interest

J.N.B. is on the Scientific Advisory Board of Oxford Immune Algorithmics.

References

  1. Pagon, R.A.; Graham, J.M., Jr.; Zonana, J.; Yong, S.-L. Coloboma, Congenital Heart Disease, and Choanal Atresia with Multiple Anomalies: CHARGE Association. J Pediatr. 1981, 99, 223–227. [Google Scholar] [CrossRef] [PubMed]
  2. Janssen, N.; Bergman, J.E.H.; Swertz, M.A.; Tranebjaerg, L.; Lodahl, M.; Schoots, J.; Hofstra, R.M.W.; van Ravenswaaij-Arts, C.M.A.; Hoefsloot, L.H. Mutation Update on the CHD7 Gene Involved in CHARGE Syndrome. Hum. Mutat. 2012, 33, 1149–1160. [Google Scholar] [CrossRef]
  3. Vissers, L.E.L.M.; van Ravenswaaij, C.M.A.; Admiraal, R.; Hurst, J.A.; de Vries, B.B.A.; Janssen, I.M.; van der Vliet, W.A.; Huys, E.H.L.P.G.; de Jong, P.J.; Hamel, B.C.J.; et al. Mutations in a New Member of the Chromodomain Gene Family Cause CHARGE Syndrome. Nat. Genet. 2004, 36, 955–957. [Google Scholar] [CrossRef] [PubMed]
  4. Blake, K.D.; Prasad, C. CHARGE Syndrome. Orphanet J. Rare Dis. 2006, 1, 34. [Google Scholar] [CrossRef]
  5. Nagashimada, M.; Ohta, H.; Li, C.; Nakao, K.; Uesaka, T.; Brunet, J.F.; Amiel, J.; Trochet, D.; Wakayama, T.; Enomoto, H. Autonomic Neurocristopathy-Associated Mutations in PHOX2B Dysregulate Sox10 Expression. J. Clin. Investig. 2012, 122, 3145–3158. [Google Scholar] [CrossRef] [PubMed]
  6. Blake, K.; MacCuspie, J.; Hartshorne, T.S.; Roy, M.; Davenport, S.L.H.; Corsten, G. Postoperative Airway Events of Individuals with CHARGE Syndrome. Int. J. Pediatr. Otorhinolaryngol. 2009, 73, 219–226. [Google Scholar] [CrossRef]
  7. Trider, C.L.; Blake, K. Anaesthesia Issues in CHARGE Syndrome—What Are the Risks? 2013. Available online: https://www.sense.org.uk/information-and-advice/conditions/charge-syndrome/ (accessed on 11 October 2022).
  8. Bishara, J.; Keens, T.G.; Perez, I.A. The Genetics of Congenital Central Hypoventilation Syndrome: Clinical Implications. Appl. Clin. Genet. 2018, 11, 135–144. [Google Scholar] [CrossRef]
  9. Weese-Mayer, D.E.; Berry-Kravis, E.M.; Ceccherini, I.; Keens, T.G.; Loghmanee, D.A.; Trang, H. An Official ATS Clinical Policy Statement: Congenital Central Hypoventilation Syndrome: Genetic Basis, Diagnosis, and Management. Am. J. Respir. Crit. Care Med. 2010, 181, 626–644. [Google Scholar] [CrossRef]
  10. Chang, G.Y.; Salazar, T.; Karnwal, A.; Kun, S.S.; Ellashek, J.; Shin, C.E.; McComb, J.G.; Keens, T.G.; Perez, I.A. Perioperative Outcomes and the Effects of Anesthesia in Congenital Central Hypoventilation Patients. Sleep Breath. 2022. [Google Scholar] [CrossRef]
  11. Santoriello, C.; Zon, L.I. Science in Medicine Hooked! Modeling Human Disease in Zebrafish. Sci. Med. 2012, 122, 2337–2343. [Google Scholar]
  12. Lele, Z.; Krone, P.H. The Zebrafish as a Model System in Developmental, Toxicological and Transgenic Research. Biotechnol. Adv. 1996, 14, 57–72. [Google Scholar] [CrossRef] [PubMed]
  13. Lieschke, G.J.; Currie, P.D. Animal Models of Human Disease: Zebrafish Swim into View. Nat. Rev. Genet. 2007, 8, 353–367. [Google Scholar] [CrossRef] [PubMed]
  14. Meulemans, D.; Bronner-Fraser, M. Gene-Regulatory Interactions in Neural Crest Evolution and Development. Dev. Cell 2004, 7, 291–299. [Google Scholar] [CrossRef] [PubMed]
  15. Theveneau, E.; Mayor, R. Neural Crest Delamination and Migration: From Epithelium-to-Mesenchyme Transition to Collective Cell Migration. Dev. Biol. 2012, 366, 34–54. [Google Scholar] [CrossRef]
  16. Asad, Z.; Pandey, A.; Babu, A.; Sun, Y.; Shevade, K.; Kapoor, S.; Ullah, I.; Ranjan, S.; Scaria, V.; Bajpai, R.; et al. Rescue of Neural Crest-Derived Phenotypes in a Zebrafish CHARGE Model by Sox10 Downregulation. Hum. Mol. Genet. 2016, 25, 3539–3554. [Google Scholar] [CrossRef]
  17. Patten, S.A.; Jacobs-McDaniels, N.L.; Zaouter, C.; Drapeau, P.; Albertson, R.C.; Moldovan, F. Role of Chd7 in Zebrafish: A Model for CHARGE Syndrome. PLoS ONE 2012, 7, e31650. [Google Scholar] [CrossRef]
  18. Prykhozhij, S.V.; Steele, S.L.; Razaghi, B.; Berman, J.N. A Rapid and Effective Method for Screening, Sequencing and Reporter Verification of Engineered Frameshift Mutations in Zebrafish. Dis. Model. Mech. 2017, 10, 811–822. [Google Scholar] [CrossRef]
  19. Cloney, K.; Steele, S.L.; Stoyek, M.R.; Croll, R.P.; Smith, F.M.; Prykhozhij, S.V.; Brown, M.M.; Midgen, C.; Blake, K.; Berman, J.N. Etiology and Functional Validation of Gastrointestinal Motility Dysfunction in a Zebrafish Model of CHARGE Syndrome. FEBS J. 2018, 285, 2125–2140. [Google Scholar] [CrossRef]
  20. Westerfield, M. The Zebrafish Book; University of Oregon Press: Eugene, OR, USA, 1995. [Google Scholar]
  21. Chen, J.I.; Zhang, X.I.; Wang, T.I.; Li, Z.H.; Guan, G.U.; Hong, Y.U. Efficient Detection, Quantification and Enrichment of Subtle Allelic Alterations. DNA Res. 2012, 19, 423–433. [Google Scholar] [CrossRef]
  22. Bennett, C.M.; Kanki, J.P.; Rhodes, J.; Liu, T.X.; Paw, B.H.; Kieran, M.W.; Langenau, D.M.; Delahaye-brown, A.; Zon, L.I.; Fleming, M.D.; et al. Myelopoiesis in the Zebrafish, Danio Rerio. Blood 2001, 98, 643–651. [Google Scholar] [CrossRef]
  23. Pei, D.; Luther, W.; Wang, W.; Paw, B.H.; Stewart, R.A.; George, R.E. Distinct Neuroblastoma-Associated Alterations of PHOX2B Impair Sympathetic Neuronal Differentiation in Zebrafish Models. PLoS Genet 2013, 9, 1003533. [Google Scholar] [CrossRef] [PubMed]
  24. White, R.M.; Sessa, A.; Burke, C.; Bowman, T.; Leblanc, J.; Ceol, C.; Bourque, C.; Dovey, M.; Goessling, W.; Burns, C.E.; et al. Transparent Adult Zebrafish as a Tool for In Vivo Transplantation Analysis. Cell Stem Cell 2008, 2, 183–189. [Google Scholar] [CrossRef] [PubMed]
  25. Collymore, C.; Tolwani, A.; Lieggi, C.; Rasmussen, S. Efficacy and Safety of 5 Anesthetics in Adult Zebrafish (Danio Rerio). J. Am. Assoc. Lab. Anim. Sci. 2014, 53, 198–203. [Google Scholar] [PubMed]
  26. Taylor, J.S.; Braasch, I.; Frickey, T.; Meyer, A.; Van de Peer, Y. Genome Duplication, a Trait Shared by 22,000 Species of Ray-Finned Fish. Genome Res 2003, 13, 382–390. [Google Scholar] [CrossRef] [PubMed]
  27. Kalueff, A.V.; Gebhardt, M.; Stewart, A.M.; Cachat, J.M.; Brimmer, M.; Chawla, J.S.; Craddock, C.; Kyzar, E.J.; Roth, A.; Landsman, S.; et al. Towards a Comprehensive Catalog of Zebrafish Behavior 1.0 and Beyond. Zebrafish 2013, 10, 70–86. [Google Scholar] [CrossRef] [PubMed]
  28. Bergman, J.E.H.; Janssen, N.; Hoefsloot, L.H.; Jongmans, M.C.J.; Hofstra, R.M.W.; van Ravenswaaij-Arts, C.M.A. CHD7 Mutations and CHARGE Syndrome: The Clinical Implications of an Expanding Phenotype. J. Med. Genet. 2011, 48, 334–342. [Google Scholar] [CrossRef]
  29. Weese-Mayer, D.; Shannon, D.; Keens, T.; Silvestri, J. Idiopathic Congenital Central Hypoventilation Syndrome: Diagnosis and Management. Am. J. Respir. Crit. Care Med. 1999, 160, 368–373. [Google Scholar]
  30. Dobbelsteyn, C.; Peacocke, S.D.; Blake, K.; Crist, W.; Rashid, M. Feeding Difficulties in Children with CHARGE Syndrome: Prevalence, Risk Factors, and Prognosis. Dysphagia 2008, 23, 127–135. [Google Scholar] [CrossRef]
  31. Riedijk, M.A.; König-Jung, A.M.; Van Woensel, J.B.M.; Kruisinga, F.H. A Neonate with Marked Prolonged Mixed Apneas and CHARGE Syndrome: A Case Report. J. Med. Case Rep. 2018, 12, 10–13. [Google Scholar] [CrossRef]
  32. Kasi, A.S.; Li, H.; Harford, K.L.; Lam, H.V.; Mao, C.; Landry, A.M.; Mitchell, S.G.; Clifton, M.S.; Leu, R.M. Congenital Central Hypoventilation Syndrome: Optimizing Care with a Multidisciplinary Approach. J. Multidiscip. Healthc. 2022, 15, 455–469. [Google Scholar] [CrossRef]
  33. Carter, K.M.; Woodley, C.M.; Brown, R.S. A Review of Tricaine Methanesulfonate for Anesthesia of Fish. Rev. Fish. Biol. Fish. 2011, 21, 51–59. [Google Scholar] [CrossRef]
Figure 1. phox2ba expression is reduced in chd7 mutants compared to sibling embryos. (A) Representative images of chd7+/− cross embryos stained for phox2ba at 48 h post−fertilization (hpf) with scored phenotypes. Note that there are variable levels of expression ranging from “low” = 1, “medium” = 2, and “high” = 3. (B) Phenotype fractions bar graph of phox2ba staining in (A). Staining patterns were quantified by scoring based on intensity. The numbers of embryos scored for each genotype are indicated above the graphs. Note the increased proportion of embryos with weak staining patterns in the chd7/ group. (Chi-square p = 0.0363 (indicated by ‘*’ above the mutant bar).
Figure 1. phox2ba expression is reduced in chd7 mutants compared to sibling embryos. (A) Representative images of chd7+/− cross embryos stained for phox2ba at 48 h post−fertilization (hpf) with scored phenotypes. Note that there are variable levels of expression ranging from “low” = 1, “medium” = 2, and “high” = 3. (B) Phenotype fractions bar graph of phox2ba staining in (A). Staining patterns were quantified by scoring based on intensity. The numbers of embryos scored for each genotype are indicated above the graphs. Note the increased proportion of embryos with weak staining patterns in the chd7/ group. (Chi-square p = 0.0363 (indicated by ‘*’ above the mutant bar).
Genes 14 01086 g001
Figure 2. chd7/ and phox2ba morpholino (MO) −injected larvae have lower heart rates than their WT or uninjected counterparts. (A) Heart rates were counted in zebrafish larvae under anesthesia at 72 h post−fertilization (hpf). * p ≤ 0.05, as per the two-tailed unpaired t−test, error bars represent SD, and each point represents an individual larva, green represents chd7+/+, orange represents chd7+/+ (+/+ n = 24, −/− n = 18). (B) Zebrafish Casper embryos were injected with morpholinos (MOs) at the one−cell stage to knock down RNA expression, and heart rates were counted under anesthesia at 72 hpf. Embryos injected with phox2ba MO had significantly lower heart rates than control MO−injected fish. * p < 0.05, as per one−way ANOVA with a Tukey post−test, error bars represent SD, each point represents an individual larva, green represents control MO, orange represents phox2ba MO, blue represents phox2bb MO n ≥ 9 larvae/group.
Figure 2. chd7/ and phox2ba morpholino (MO) −injected larvae have lower heart rates than their WT or uninjected counterparts. (A) Heart rates were counted in zebrafish larvae under anesthesia at 72 h post−fertilization (hpf). * p ≤ 0.05, as per the two-tailed unpaired t−test, error bars represent SD, and each point represents an individual larva, green represents chd7+/+, orange represents chd7+/+ (+/+ n = 24, −/− n = 18). (B) Zebrafish Casper embryos were injected with morpholinos (MOs) at the one−cell stage to knock down RNA expression, and heart rates were counted under anesthesia at 72 hpf. Embryos injected with phox2ba MO had significantly lower heart rates than control MO−injected fish. * p < 0.05, as per one−way ANOVA with a Tukey post−test, error bars represent SD, each point represents an individual larva, green represents control MO, orange represents phox2ba MO, blue represents phox2bb MO n ≥ 9 larvae/group.
Genes 14 01086 g002
Figure 3. chd7−/− fish take longer to lose touch response under anesthetic. Anesthesia was assessed by the time it took adult zebrafish (previously genotyped as chd7+/+ [brown], chd7+/− [purple] or chd7−/− [green]) to lose their response to touch (A) and response to tail−pinch (B). Recovery was measured as the time it took the fish to regain the touch response (C). * p < 0.05, as per one−way ANOVA, with a Tukey post−test.
Figure 3. chd7−/− fish take longer to lose touch response under anesthetic. Anesthesia was assessed by the time it took adult zebrafish (previously genotyped as chd7+/+ [brown], chd7+/− [purple] or chd7−/− [green]) to lose their response to touch (A) and response to tail−pinch (B). Recovery was measured as the time it took the fish to regain the touch response (C). * p < 0.05, as per one−way ANOVA, with a Tukey post−test.
Genes 14 01086 g003
Figure 4. chd7−/− fish have higher respiratory rates under anesthesia than their chd7+/+ counterparts. Adult fish were anesthetized, and respiratory rates (opercular movements) were recorded at the time fish lost their response to touch (time point 1− post loss of touch response) and response to fin−pinch (time point 2− post loss of fin pinch response). Fish were then moved to a recovery tank, and respiratory rates were assessed both upon entering the recovery tank (time point 3− initial recovery tank) and just before the fish recovered the ability to swim (time point 4–10 s prior to recovery). * p < 0.05, as per one-way ANOVA, with a Tukey post-test. Error bars represent standard deviation (SD). n = 7 for chd7−/− and n = 13 for the other two groups.
Figure 4. chd7−/− fish have higher respiratory rates under anesthesia than their chd7+/+ counterparts. Adult fish were anesthetized, and respiratory rates (opercular movements) were recorded at the time fish lost their response to touch (time point 1− post loss of touch response) and response to fin−pinch (time point 2− post loss of fin pinch response). Fish were then moved to a recovery tank, and respiratory rates were assessed both upon entering the recovery tank (time point 3− initial recovery tank) and just before the fish recovered the ability to swim (time point 4–10 s prior to recovery). * p < 0.05, as per one-way ANOVA, with a Tukey post-test. Error bars represent standard deviation (SD). n = 7 for chd7−/− and n = 13 for the other two groups.
Genes 14 01086 g004
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

MacLean, J.E.; Wertman, J.N.; Prykhozhij, S.V.; Chedrawe, E.; Langley, S.; Steele, S.L.; Ban, K.; Blake, K.; Berman, J.N. phox2ba: The Potential Genetic Link behind the Overlap in the Symptomatology between CHARGE and Central Congenital Hypoventilation Syndromes. Genes 2023, 14, 1086. https://doi.org/10.3390/genes14051086

AMA Style

MacLean JE, Wertman JN, Prykhozhij SV, Chedrawe E, Langley S, Steele SL, Ban K, Blake K, Berman JN. phox2ba: The Potential Genetic Link behind the Overlap in the Symptomatology between CHARGE and Central Congenital Hypoventilation Syndromes. Genes. 2023; 14(5):1086. https://doi.org/10.3390/genes14051086

Chicago/Turabian Style

MacLean, Jessica E., Jaime N. Wertman, Sergey V. Prykhozhij, Emily Chedrawe, Stewart Langley, Shelby L. Steele, Kevin Ban, Kim Blake, and Jason N. Berman. 2023. "phox2ba: The Potential Genetic Link behind the Overlap in the Symptomatology between CHARGE and Central Congenital Hypoventilation Syndromes" Genes 14, no. 5: 1086. https://doi.org/10.3390/genes14051086

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop