Polymorphisms and mRNA Expression Levels of IGF-1, FGF5, and KAP 1.4 in Tibetan Cashmere Goats
by
Tianzeng Song
1,†,
Yao Tan
2,†,
Renqing Cuomu
1,
Yacheng Liu
2,
Gui Ba
1,
Langda Suo
1,
Yujiang Wu
1,
Xiaohan Cao
1,2,* and
Xianyin Zeng
2,* 1
Institute of Animal Science, Tibet Academy of Agricultural and Animal Husbandry Science, Lhasa 850009, China
2
Isotope Research Laboratory, Sichuan Agricultural University, Ya’an 625014, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this paper.
Genes 2023, 14(3), 711; https://doi.org/10.3390/genes14030711
Submission received: 13 February 2023
/
Revised: 10 March 2023
/
Accepted: 11 March 2023
/
Published: 14 March 2023
(This article belongs to the Special Issue Evolution, Molecular Ecology, Phylogeography, and Phylogenetics of Mammals)
Abstract
:The Tibetan cashmere goat is a precious breed in China and its cashmere is widely used in clothing and textiles. The genes IGF-1, FGF5, and KAP 1.4 have been shown to be crucial regulators of cashmere growth. In this study, we examined mRNA expression levels of these three genes and detected IGF-1, FGF5, and KAP 1.4 SNP loci in the Tibetan cashmere goat. After amplification and sequence alignment of the genes IGF-1, FGF5, and KAP 1.4 among 206 Tibetan cashmere goats, two new SNP loci were detected in gene KAP 1.4, while no SNP loci were found in amplified fragments of genes IGF-1 and FGF5. The expression levels of gene IGF-1 in Baingoin and Nyima counties were significantly higher than in other counties (p < 0.05). Moreover, the expression level of gene FGF5 in Gêrzê was significantly higher than in Rutog. The expression levels of mRNA in KAP 1.4 showed significant variation among seven counties. There were no significant differences in mRNA expression levels of IGF-1, FGF5, and KAP 1.4 in Tibetan cashmere goats when analysed by sex. The gene IGF-1 was slightly up-regulated in one to five-year-old cashmere goats, except in those that were 4 years old. The mRNA expression levels of FGF5 in one and two-year-old cashmere goats was lower compared with those in three to five-year-old cashmere goats. KAP 1.4 was up-regulated across one to five-year-old cashmere goats. In this study, SNP detection and mRNA expression analysis of IGF-1, FGF5, and KAP 1.4 genes was able to add data to genetic evolutionary analysis. Further studies should be carried out in SNPs to detect other fragments in genes IGF-1 and FGF5, as well as signal pathways and gene functions in protein levels of genes IGF-1, FGF5, and KAP 1.4 in the Tibetan cashmere goat.
1. Introduction
Goats (Capra hircus) have long been raised to meet a variety of essential human needs. The demand for cashmere is growing in accordance with the development of humanity. The Tibetan cashmere goat is a well-known domestic breed in the northwestern region of Tibet, China, and is renowned for its cashmere [1,2]. The Tibetan cashmere goat is well adapted to the temperature and harsh surroundings of the Tibetan Plateau. The wool from this breed has a distinct, soft texture and a high commercial worth [3]. Genetic variation in genes such as KRT and KAP in different breeds of cashmere goats contributes to phenotypic differences. Different hair fiber-associated genes are involved in determining skin architecture and hair development. The diversity in these genes may regulate the structure and traits of wool. The growth of cashmere is also regulated by hair follicles, which include the primary hair follicle and the secondary hair follicle. Wool fiber is derived from primary hair follicles, whereas cashmere is derived from secondary hair follicles [4,5].
Previous studies have found that the genes IGF-1, FGF5, and KAP 1.4 are all linked to cashmere development [6,7,8]. These three genes have been investigated in other Chinese domestic goat breeds, including the Liaoning [9,10] and Inner Mongolian cashmere goats [11,12]. However, we are aware of only a few research studies involving Tibetan cashmere goats. IGF-1 is structurally homologous to proinsulin and acts as a polypeptide hormone. IGF-1 is essential for mammalian growth, development, and homeostasis. It is an essential growth hormone regulator [13]. Previous studies have shown that IGF-1 contains at least six exons in many mammalian species and complicated alternative splicing [10,14,15,16] and multiple nuclear polymorphic sites exist in this gene. Polymorphisms in the IGF-1 gene have been linked to developmental characteristics and yearling hair fiber weight in Iranian domestic cashmere goats [6] and Nanjiang Huang goats [17].
The FGF5 gene, which was initially discovered as an oncogene, has been suggested to be involved in human and mouse hair follicle cycles [18,19]. The FGF5 gene can generate two types of proteins: a full-length protein (FGF5) and a short protein (FGFs) [18]. A previous study found that the human hair development cycle enters the catagen phase prematurely due to an elevated expression level of FGF5 [19]. This indicates that FGF5 may inhibit hair follicle development [20]. Indeed, an autosomal recessive mutation in the FGF5 gene in the Angora mouse resulted in an increase in hair development [21]. Furthermore, a missense mutation in the FGF5 gene in dogs resulted in longer hair [22].
Keratin-associated protein (KAP) 1.4 is a primary component of hair fiber. KAP is a large protein family that is divided into three types based on amino acid content: high glycine–tyrosine KAPs, high-sulfur KAPs, and ultra-high-sulfur KAPs [8,12]. The protein levels of KAP in various species is different. Previous research found that the KAP gene family has many polymorphisms, and there are many SNP sites in goat and sheep breeds [8,12,23,24].
Sheep KAP 1.4 has a 30-nucleotide deletion when compared to Ovis aries and Capra hircus [8]. KAP 1.4 is a high-sulfur KAP, and it has been demonstrated that KAP 1.4 has a relationship with the quantity as well as quality of animal hair fibers. Variations in the KAP family play essential roles in the hair development cycle. The aim of this study was to determine whether IGF-1, FGF5, and KAP 1.4 are related to cashmere development in Tibetan cashmere goats through mRNA expression and polymorphisms.
2. Materials and Methods
2.1. Experimental Animals
A total of 240 cashmere goats of various sexes and ages were chosen at random from seven counties in the Ngari and Nagqu provinces of Tibet. A map showing counties and altitudes is presented in Figure 1. A total of 480 skin tissue samples (1 cm3) were collected from the ears of living goats in October (two ear tissue samples were obtained from each goat) for DNA and RNA extraction. All tissue samples were frozen in liquid nitrogen before being stored at −80 °C until use, and tests were carried out with the permission of the Sichuan Agricultural University Animal Experimental Committee (SAU2015064, 12 December 2015).
2.2. DNA and RNA Extraction and cDNA Synthesis
Genomic DNA was extracted using the TIANamp Genomic DNA kit (TIANGEN, Bio, Co., Ltd. Beijing, China) according to the manufacturer’s instructions. Total RNA was extracted using the phenol chloroform extraction technique using RNAiso Plus (TaKaRa Bio, Co., Ltd., Dalian, China). To analyze the mRNA expression level, cDNA was synthesized using the PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa Bio, Co., Ltd., Dalian, China) according the manufacturer’s instructions. The instructions for cDNA synthesis were as follows: 37 °C for 15 min and 85 °C for 5 s in a volume of 20 μL with a total of 1 μg RNA isolated from ear skin tissue, 5 × gDNA Eraser buffer, gDNA Eraser, PrimeScript RT Enzyme Mix I, RT Primer Mix, 5 × PrimeScript Buffer 2, RNase-free dH2O. The primers used for cDNA synthesis were Oligo dT Primer with Random 6-mers.
2.3. PCR and DNA Sequencing
Three-pair primers were designed and synthesized to amplify the desired fragments of IGF-1, FGF5, and KAP 1.4 (Table 1). The primers were designed using partial exon segments from previously published data [17,18,25]. PCR amplification was performed in a volume of 25 μL in a T100 Thermal Cycler (Bio-Rad Laboratories, Inc., Shanghai, China), using the Premix Taq™ kit and genomic DNA as a template, with the following reaction conditions: 3 min denaturation at 95 °C, followed by 35 cycles (30 s at 94 °C, 40 s at the corresponding annealing temperature, and 24 s at 72 °C for extension), ending with an extension of 5 min at 72 °C. After electrophoresis on 2% agarose gel, PCR products were visualized using the UV trans-illuminator (Bio-Rad Laboratories, Inc.) and were purified for sequencing (Sangon Biotech, Co., Ltd., Shanghai, China).
2.4. Genotyping and Genetic Analysis
SNPs were detected using the sequencing technique, and the sequence patterns of 206 DNA samples were examined (due to long-distance transport or accidents, 34 ear tissue samples were damaged and not able to be used in this experiment). Based on the sequence data, allele frequencies, genotype numbers, heterozygosity, and homozygosity were determined. MEGA 6.06 and DNAMAN8 software (LynnonBiosoft, San Ramon, CA 94583, USA) were used for sequence alignment, similarity analysis, statistical genetics, and phylogenetic tree analysis. A phylogenetic tree was constructed using the sequence of the genes IGF-1, FGF5, and KAP 1.4 in Tibetan cashmere goats and other animals.
2.5. Quantitative PCR for mRNA Expression
The mRNA expression levels of IGF-1, FGF5, and KAP 1.4 in Tibetan cashmere goats were determined using quantitative PCR (qPCR) with cDNA as a template, which was reverse-transcribed from total RNA. The qPCR was carried out in triplicate using the CFX96 Real-Time PCR detection system (Bio Rad, Hercules, CA, USA) with the use of the SYBR®Premix Ex Taq™ II kit (TaKaRa Bio, Co., Ltd., Dalian, China). The qPCR procedure was as follows: denaturation at 95 °C for 30 s, followed by 35 cycles of reaction (95 °C for 5 s, annealing at the corresponding temperature for 30 s). In this study, a fluorescent signal was detected at the annealing temperature, and melting curve analysis was performed at the end of the qPCR reaction to assess the specificity of the PCR product. The relative genes’ expression levels were normalized to β-actin. The detailed information of primers used is shown in Table 1.
2.6. Statistical Analysis
The DNAMAN 8 and MEGA 6.03 statistical systems were used to evaluate target gene sequences and SNP detection. Sequence alignment was calculated using the discovered SNP loci, gene frequencies, allele frequencies, heterozygosis, homozygosis, and phylogenetic tree [9,18,26]. Relative mRNA expression levels of IGF-1, FGF5, and KAP 1.4 were analyzed using the GraphPad prism 5 program (GraphPad prism software, Inc., Boston, MA, USA). Differences in the expression levels of target genes in various groups were analyzed using the one-way ANOVA. Results were expressed as X + SD and triplicate [7,10].
3. Results
3.1. Cloning of the Fragments of Genes IGF-1, FGF5, and KAP 1.4
The target fragments of genes IGF-1, FGF5, and KAP 1.4 were amplified and cloned from Tibetan cashmere goats using gene-specific primers (Figure 2). After sequencing, we discovered that the cloned fragments of IGF-1, FGF5, and KAP 1.4 were 320 bp, 193 bp, and 303 bp in length, respectively.
3.2. Sequence Alignment and the Phylogenetic Tree
The sequence alignments in the Tibetan cashmere goat, as well as other goat and sheep breeds, are shown in (Figure 3). The identicality of sequences in genes FGF5 and KAP 1.4 was 99% and in gene IGF-1 was 98%. There were no significant differences among them. The sequences of genes FGF5 and KAP 1.4 were highly similar among Tibetan cashmere goats, other goat and sheep breeds. The sequences of genes IGF-1, FGF5, and KAP 1.4 from other species were retrieved from GenBank, including Capra hircus, Ovis aries, Bos taurus, Homo sapiens, and Mus musculus.
3.3. Single Nucleotide Polymorphism Analysis
After amplification and sequence alignment of genes IGF-1, FGF5, and KAP 1.4 in 206 Tibetan cashmere goats, two new SNP loci were discovered in gene KAP 1.4, but there were no SNP loci in the amplified fragments of genes IGF-1 and FGF5. Furthermore, the sequence maps revealed that the two newly discovered SNPs were localized at 209 bp and 245 bp in the amplified fragment of KAP 1.4. The sequencing of 209 bp and 245 bp fragments revealed variable overlapping peak patterns (Figure 4). The genotype was split according to the nucleotides at 245 bp and 209 bp loci. There were three alleles at the 245 bp locus: C1C1, C1T1, and C2T2 (Figure 4A). However, only two genotypes were identified at the 209 bp locus: C2C2 and C2T2, because T2T2 was not detected (Figure 4B). When the sequences in each genotype were analyzed, both SNP loci were C–T mutations: CTG–TTG at 209 bp and CCT–CTT at 245 bp (Table 2). Moreover, the nucleotide mutation at 209 bp did not change the amino acid (Leucine–non-change), but the nucleotide mutation at 245 bp resulted in the transformation of the amino acid (Proline–Leucine).
Genotype frequencies and allele frequencies among the six counties are shown in Table 3 and Table 4, respectively. At the 245 bp locus, the average frequencies of genotypes C1C1, C1T1, and T1T1 were 0.76, 0.22, and 0.02, respectively, and the allele frequencies of C1 and T1 were 0.87 and 0.13, respectively. At the 209 bp locus the average frequencies of genotypes C2C2 and C2T2 were 0.94 and 0.06, respectively, and the allele frequencies of C2 and T2 were 0.97 and 0.03, respectively. The allele frequencies of T1 and T2 (C–T mutation) were the highest in Coqen county (0.245 and 0.055). In addition, all of the heterozygosity and homozygosity patterns showed differences in alleles and these alleles were specific to a genetic group.
3.4. Relative mRNA Expression Level of IGF-1, FGF5, and KAP 1.4
The mRNA expression levels of IGF-1, FGF5, and KAP 1.4 were compared in different counties, sexes and ages of goats. As demonstrated in Figure 5A, the expression levels of the gene IGF-1 in Baingoin and Nyima counties were significantly higher than in other counties (p < 0.05). Moreover, the expression level of gene FGF5 in Gêrzê was significantly higher than in Rutog (Figure 5B). Comparison of mRNA expression level in KAP 1.4 showed significant differences among the seven counties (Figure 5). Interestingly, there were no significant differences in mRNA levels between sexes in Tibetan cashmere goat genes IGF-1, FGF5, and KAP 1.4 (Figure 6). Furthermore, mRNA expression differences in Tibetan cashmere goats were analysed by age. As shown in Figure 7, the mRNA expression levels of IGF-1, FGF5, and KAP 1.4 were similar across one to five-year-old cashmere goats (p > 0.05), however the expression level of the gene IGF-1 remained slightly up-regulated across one to five-year-old cashmere goats, except in 4-year-old cashmere goats. FGF5 mRNA expression was lower in one and two-year-old goats compared with three to five-year-old goats. Furthermore, the expression levels of the gene KAP 1.4 were progressively up-regulated from one to five-year-old cashmere goats.
4. Discussion
In China, the Tibetan cashmere goat is a valuable species, and its cashmere is extensively used in clothing and other textiles. IGF-1, FGF5, and KAP 1.4 have been identified as key regulators in cashmere development. In this study, we investigated mRNA expression levels of these three genes in Tibetan cashmere goats and discovered IGF-1, FGF5, and KAP 1.4 SNP loci. IGF-1 has been identified as an essential growth hormone regulator that influences growth characteristics and yearling fleece in some goat breeds [5]. Previous research identified SNP loci of the IGF-1 gene, which may serve as a molecular marker for growth traits in the Nanjiang Huang Goat [17]. Furthermore, it has been suggested that FGF5 may function as a negative regulator in hair development, inhibiting hair growth [18,27]. Previous research on Ovis aries found SNP loci in the FGF5 gene, and the genotype and allele frequencies were significantly different between sheep breeds [11]. Other studies on the relationship between fiber growth and polymorphisms in the KAP family revealed that SNPs in the KAP gene definitely affected fiber quality and quantity [28].
Variation in KRTAP20-1 has been linked to cashmere fiber crimped fiber length and weight [29,30]. A previous study compared size variability in the KAP1.4 gene between Ovis aries and Capra hircus and discovered that the gene KAP1.4 in sheep has a 30-nucleotide deletion. Furthermore, researchers discovered SNP loci in KAP 1.4 fragments in Indian native goat breeds, but the associations of guard and down fiber length and diameter with various SNPs were non-significant (p > 0.05) [8]. Another study discovered that the SNP sites in KAP 9.2 as well as the mRNA expression level of KAP 9.2 were significantly different among genotypes of Shanbei white cashmere goats, Inner Mongolia white cashmere goats, and Guanzhong dairy goats. It also showed that the identified SNP may regulate translation or stability of KAP 9.2 mRNA, which would be beneficial for marker-assisted selection in cashmere goat breeding [12]. A recent study found that SNP loci in genes KAP 6 and KAP 8 were associated with wool fiber diameter in Medium Peppin Merino sheep [24].
In accordance with previous research, particular exonic fragments of the genes IGF-1, FGF5, and KAP 1.4 have been amplified, and SNPs in these genes may be associated with growth traits. As a result, we examined the relationship between mRNA expression levels and polymorphisms in the genes IGF-1, FGF5, and KAP 1.4 and cashmere growth in Tibetan cashmere goats. Average annual cashmere production in different counties and ages of Tibetan cashmere goats is presented in Table 5 and Table 6. These tables show that the average cashmere production in Rutog, Coqen, and Nyima counties (350–380 g/each) is greater than that in the other three counties (300 g/each), and that cashmere production in one-year-old cashmere goats (50 g/each) is lower than that of two to five-year-old (50–200/each) cashmere goats. Two novel SNP loci in the KAP 1.4 gene may affect cashmere production, and the mRNA expression levels of KAP 1.4 and FGF5 are also known to be associated with cashmere production. SNP detection results identified two SNP sites in KAP 1.4, but no SNPs were identified in IGF-1 and FGF5. Among these two newly identified SNPs, only the SNP locus at 245 bp resulted in an amino acid change (Proline–Leucine).
According to Table 3, Table 4 and Table 5, both genotypes in SNP loci 245 bp and 209 bp revealed that Coqen county has the highest mutation rate. The average mutation rate at the SNP locus 245 bp is 24.3%, with the highest rate (42.9%) in Coqen county (350 g/each). As a result, it is hypothesized that this polymorphism in KAP 1.4 is associated with cashmere growth, and that this mutation may contribute to a rise in Tibetan cashmere goat cashmere output. No SNPs were identified in the amplified fragment, implying that exons 1 and 4 of the FGF5 gene did not appear in polymorphisms. Previous research has shown that SNPs in specific fragments of the genes IGF-1 and FGF5 occur [6,12], but in this study they were not detected in Tibetan cashmere goats. The difference between breeds may lead to this situation. The measured distance of various species in the phylogenetic tree indicated that the Tibetan cashmere goat was close to Capra hircus, Bos taurus, and Ovis aries, while Homo sapiens and Mus musculus were distinct species. The mRNA expression levels of genes FGF5 and KAP 1.4 were significantly different among the various counties (p < 0.05). The mRNA expression level of IGF-1 is similar in most counties (p > 0.05) and similar to previous findings in other goat breeds [13]. The reasons for the relatively high expression levels of the gene IGF-1 in Baingoin and Nyima could be due to individual variations in the animals or distinct living conditions. The counties of Baingoin and Nyima are parts of Nagqu Prefecture, while the remaining five counties are part of Ngari Prefecture. The average annual production of cashmere from Northwestern Tibetan cashmere goats in Rutog, Coqen, Nyima, Baingoin, Gê’gya, Gêrzê, and Gareach districts were 380, 350, 350, 300, 300, 300, and 300 g, respectively. The county with the highest cashmere output, Rutog (380 g/each), has the lowest FGF5 mRNA expression level. This could imply that FGF5 is a negative regulator in the hair cycle, inhibiting fiber development [18]. Counties with higher production of cashmere, Coqen and Nyima (350 g/each), had significantly higher mRNA expression levels of the gene KAP than other counties, including Rutog, Baingoin, Gê’gya, Gêrzê, and Gar. However, the expression levels in the top cashmere-producing area Rutog (380 g/each) are similar (p > 0.05). The habitat of the Tibetan cashmere goat, including altitude, climate, rearing conditions, and biological variety, may contribute to the low mRNA expression level of KAP 1.4 in Rutog. The results of the mRNA expression levels of IGF-1, FGF5, and KAP 1.4 by sex and year stages of Tibetan cashmere goats were similar (p > 0.05). However, there was a trend in Tibetan cashmere goat mRNA expression levels of IGF-1 and KAP 1.4; these were up-regulated with age, with the exception of IGF-1 in four-year-old cashmere goats. As shown in Table 6, cashmere production increased with age. KAP 1.4 mRNA expression levels increase with age indicating that these may play a role in regulating cashmere development.
In this study, we analyzed whether the mRNA expression and polymorphisms of genes IGF-1, FGF5, and KAP 1.4 were associated with cashmere production in Tibetan cashmere goats and we explored the possible features of these genes. The study of the relationship between cashmere production and the characteristics of these three genes revealed that FGF5 and KAP 1.4 may regulate cashmere production in Tibetan cashmere goats. Our results demonstrate that candidate genes of cashmere development in Tibetan cashmere goats may be used for analyzing cashmere quantity and quality. The detection of SNPs and the analysis of mRNA expression of genes IGF-1, FGF5, and KAP 1.4 in the current research could provide data for genetic evolutionary analysis. Further research should be conducted into SNP detection of other fragments in genes IGF-1 and FGF5, as well as signal pathways and gene functions in protein levels of genes IGF-1, FGF5, and KAP 1.4 in Tibetan cashmere goats.
Author Contributions
Methodology, L.S.; Validation, Y.L.; Formal analysis, Y.T.; Investigation, R.C.; Resources, G.B.; Writing—original draft, T.S. and Y.T.; Writing—review and editing, X.C.; Project administration, X.Z.; Funding acquisition, Y.W. All authors have read and agreed to the published version of the manuscript.
Funding
This work was supported in part by project of Special fund from promotion and demonstration of Tibet financial agricultural science and technology in 2015, Key projects of the Sichuan Department of Education (15ZA0005), two-side support plan of Sichuan Agricultural University (00770107) and the Innovation Program of Chinese Agricultural Science and Technology (ASTIP-IAS13).
Institutional Review Board Statement
The animal study was reviewed and approved by the Sichuan Agricultural University Animal experimental committee. (SAU2015064, 12 December 2015).
Informed Consent Statement
Not applicable.
Data Availability Statement
Not applicable.
Conflicts of Interest
The authors declare no conflict of interest.
References
- Sun, Z.; Liu, Y.; He, X.; Di, R.; Wang, X.; Ren, C.; Zhang, Z.; Chu, M. Integrative Proteomics and Transcriptomics Profiles of the Oviduct Reveal the Prolificacy-Related Candidate Biomarkers of Goats (Capra hircus) in Estrous Periods. Int. J. Mol. Sci. 2022, 23, 14888. [Google Scholar] [CrossRef] [PubMed]
- Song, S.; Yao, N.; Yang, M.; Liu, X.; Dong, K.; Zhao, Q.; Pu, Y.; He, X.; Guan, W.; Yang, N.; et al. Exome sequencing reveals geneticdifferentiation due to high-altitude adaptation in the Tibetan cashmere goat (Capra hircus). BMC Genom. 2016, 17, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Ma, H.; Zhang, W.; Song, W.; Sun, P.; Jia, Z. Effects of tryptophan supplementation on cashmere fiber characteristics, serum tryptophan, and related hormone concentrations in cashmere goats. Domest. Anim. Endocrinol. 2012, 43, 239–250. [Google Scholar] [CrossRef] [PubMed]
- Bai, W.L.; Dang, Y.L.; Yin, R.H.; Jiang, W.Q.; Wang, Z.Y.; Zhu, Y.B.; Wang, S.Q.; Zhao, Y.Y.; Deng, L.; Luo, G.B.; et al. Differential Expression of microRNAs and their Regulatory Networks in Skin Tissue of Liaoning Cashmere Goat during Hair Follicle Cycles. Anim. Biotechnol. 2016, 27, 104–112. [Google Scholar] [CrossRef] [PubMed]
- Ansari-Renani, H.; Ebadi, Z.; Moradi, S.; Baghershah, H.; Ansari-Renani, M.; Ameli, S. Determination of hair follicle characteristics, density and activity of Iranian cashmere goat breeds. Small Rumin. Res. 2011, 95, 128–132. [Google Scholar] [CrossRef]
- Kurdistani, Z.K.; Rostamzadeh, J.; Rashidi, A.; Davis, M. Evaluation of insulin-like growth factor-I gene polymorphism on growth traits and yearling fleece weight in goats. Small Rumin. Res. 2013, 111, 10–15. [Google Scholar] [CrossRef]
- He, X.; Yuan, C.; Chen, Y. Isolation, characterization, and expression analysis of FGF5 isoforms in cashmere goat. Small Rumin. Res. 2014, 116, 111–117. [Google Scholar] [CrossRef]
- Shah, R.M.; Ganai, T.A.S.; Sheikh, F.D.; Shanaz, S.; Shabir, M.; Khan, H.M. Characterization and polymorphism of Keratin Associated Protein 1.4 gene in goats. Gene 2013, 518, 431–442. [Google Scholar] [CrossRef]
- Jin, M.; Liu, N.; Yuan, S.; Piao, J.; Zhao, F.; Qu, Y.; Zhang, T.; Wang, Y. Construction of a cDNA library and identification of genes from Liaoning cashmere goat. Livest. Sci. 2014, 164, 26–34. [Google Scholar] [CrossRef]
- Bai, W.L.; Yin, R.H.; Yin, R.L.; Wang, J.J.; Jiang, W.Q.; Luo, G.B.; Zhao, Z.H. IGF-1 mRNA splicing variants in Liaoning cashmere goat: Identification, characterization, and transcriptional patterns in skin and visceral organs. Anim. Biotechnol. 2013, 24, 81–93. [Google Scholar] [CrossRef]
- Liu, H.; Yang, G.; Zhang, W.; Zhu, X.; Jia, Z. Effects of FGF5 on fibre traits on Inner Mongolian cashmere goats. Hereditas 2009, 31, 175–179. (In Chinese) [Google Scholar]
- Wang, X.; Zhao, Z.D.; Xu, H.R.; Qu, L.; Zhao, H.B.; Li, T.; Zhang, Z.Y. Variation and expression of KAP 9.2 gene affecting cashmere trait in goats. Mol. Biol. Rep. 2012, 39, 10525–10529. [Google Scholar] [CrossRef]
- Thomas, N.; Venkatachalapathy, T.; Aravindakshan, T.; Raghavan, K.C. Molecular cloning, SNP detection and association analysis of 5′-flanking region of the goat IGF-1 gene with prolificacy. Anim. Reprod. Sci. 2016, 167, 8–15. [Google Scholar] [CrossRef]
- O’Sullivan, D.C.; Szestak, T.A.M.; Pell, J.M. Pell. Regulation of IGF-I mRNA by GH: Putative functions for class 1 and 2 message. Am. J. Physiol. Endocrinol. Metab. 2002, 283, 251–258. [Google Scholar] [CrossRef]
- Jansen, M.; van Schaik, F.M.A.; Ricker, A.T.; Bullock, B.; Woods, D.E.; Gabbay, K.H.; Nussbaum, A.L.; Sussenbach, J.S.; Van den Brande, J.L. Sequence of cDNA encoding human insulin-like growth factor I precursor. Nature 1983, 306, 609–611. [Google Scholar] [CrossRef]
- Ohlsen, S.M.; Dean, D.M.; Wong, E.A. Characterization of Multiple Transcription Initiation Sites of the Ovine Insulin-Like Growth Factor-I Gene and Expression Profiles of Three Alternatively Spliced Transcripts. DNA Cell Biol. 1993, 12, 3. [Google Scholar] [CrossRef]
- Zhang, C.; Zhang, W.; Luo, H.; Yue, W.; Gao, M.; Jia, Z. A New Single Nucleotide Polymorphism in the IGF-I Gene and Its Association with Growth Traits in the Nanjiang Huang Goat. Asian Aust. J. Anim. Sci. 2008, 21, 1073–1079. [Google Scholar] [CrossRef]
- He, X.; Chao, Y.; Zhou, G.; Chen, Y. Fibroblast growth factor 5-short(FGF5s) inhibits the activity of FGF5 in primary and secondary hair follicle dermal papilla cells of cashmere goats. Gene 2016, 575, 393–398. [Google Scholar] [CrossRef]
- Higgins, C.A.; Petukhova, L.; Harel, S.; Ho, Y.Y.; Drill, E.; Shapiro, L.; Wajid, M.; Christiano, A.M. FGF5 is a crucial regulator of hair length in humans. Proc. Natl. Acad. Sci. USA 2014, 111, 10648–10653. [Google Scholar] [CrossRef] [Green Version]
- Hbbert, J.M.; Rosenquist, T.; Götz, J.; Martin, G.R. FGF5 as a regulator of the hair Growth Cycle: Evidence from Targeted adn Spontaneous Mutations. Cell 1994, 78, 1017–1205. [Google Scholar] [CrossRef]
- Sundberg, J.P.; Rourk, M.H.; Boggess, D.; Hogan, M.E.; Sundberg, B.A.; Bertolino, A.P. Angora Mouse Mutations: Altered Hair Cycle, Follicular Dystrophy, Phenotypic, Maintenance of Skin Grafts, and Changes in Keratin Expression. Vet. Pathol. 1997, 34, 171–179. [Google Scholar] [CrossRef] [PubMed]
- Housley, D.J.E.; Venta, P.J. The long and the short of it: Evidence that FGF5 is a major determinant of canine “hair”-itability. Anim. Genet. 2006, 37, 309–315. [Google Scholar] [CrossRef] [PubMed]
- Fang, Y.; Liu, W.J.; Zhang, F.Q.; Shao, Y.G.; Yu, S.G. The polymorphism of a Novel Mutation of KAP 13.1 Gene and its Association with Cashmere Traits on Xinjiang Local Goat Breed in China. Asian J. Anim. Vet. Adv. 2010, 5, 34–42. [Google Scholar] [CrossRef]
- Parsons, Y.M.; Cooper, D.W.; Piper, L.R. Evidence of linkage between high-glycine-tyrosine keratin gene loci and wool fibre diameter in a Merino half-sib family. Anim. Genet. 1994, 25, 105–108. [Google Scholar] [CrossRef]
- Gao, A.I.; Li, N.; Zhao, X. PCR-SSCP Analysis of FGF5 Gene inDifferent Sheep Breeds. Acta Vet. Et Zootech. Sin. 2006, 37, 326. (In Chinese) [Google Scholar]
- Vahidi, S.M.F.; Tarang, A.R.; Naqvi, A.-U.; Anbaran, M.F.; Boettcher, P.; Joost, S.; Colli, L.; Garcia, J.F.; Ajmone-Marsan, P. Investigation of the genetic diversity of domestic Capra hircus breeds reared within an early goat domestication area in Iran. Genet. Sel. Evol. 2014, 46, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Rosenquist, T.A.; Martin, G.R. Fibroblast Growth Factor Signalling in the Hair Growth Cycle: Expression of the Fibroblast Growth Factor Receptor and Ligand Genes in the Murine Hair Follicle. Dev. Dyn. 1996, 205, 379–386. [Google Scholar] [CrossRef]
- Gong, H.; Zhou, H.; Hickford, J.G.H. Polymorphism of the ovine keratin-associated protein 1–4 gene (KRTAP1.4). Mol. Biol. Rep. 2010, 37, 3377–3380. [Google Scholar] [CrossRef]
- Brito, L.F.; Jafarikia, M.; Grossi, D.A.; Kijas, J.W.; Porto-Neto, L.R.; Ventura, R.V.; Salgorzaei, M.; Schenkel, F.S. Characterization of linkage disequilibrium, consistency of gametic phase and admixture in Australian and Canadian goats. BMC Genet. 2015, 16, 1–15. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.; Hao, Z.; Zhou, H.; Luo, Y.; Hu, J.; Liu, X.; Li, S.; Hickford, J.G. A keratin-associated protein (KAP) gene that is associated with variation in cashmere goat fleece weight. Small Rumin. Res. 2018, 167, 104–109. [Google Scholar] [CrossRef]
Figure 1.
Distribution of the Northwestern Tibetan cashmere goat population, showing different counties and their altitudes.
Figure 1.
Distribution of the Northwestern Tibetan cashmere goat population, showing different counties and their altitudes.
Figure 2.
Amplification of genes IGF-1, FGF5, and KAP 1.4 in Northwestern cashmere goats. Lanes 1–8: gene IGF-1; Lanes 9–16: gene FGF5; Lanes 17–23: gene KAP 1.4.
Figure 2.
Amplification of genes IGF-1, FGF5, and KAP 1.4 in Northwestern cashmere goats. Lanes 1–8: gene IGF-1; Lanes 9–16: gene FGF5; Lanes 17–23: gene KAP 1.4.
Figure 3.
Nucleotide sequence alignment of genes IGF-1 (A), FGF5 (B), and KAP 1.4 (C) in Northwestern Tibetan cashmere goats along with that of other goat and sheep breeds. “Cashmere goat” stands for Northwestern Tibetan cashmere goat.
Figure 3.
Nucleotide sequence alignment of genes IGF-1 (A), FGF5 (B), and KAP 1.4 (C) in Northwestern Tibetan cashmere goats along with that of other goat and sheep breeds. “Cashmere goat” stands for Northwestern Tibetan cashmere goat.
Figure 4.
(A) Sequence maps of genotypes C1C1, C1T1, and T1T1 with g.245 C > T of gene KAP1.4. (B) Sequence maps of genotypes C2C2 and C2T2 with g.209 C > T of gene KAP 1.4.
Figure 4.
(A) Sequence maps of genotypes C1C1, C1T1, and T1T1 with g.245 C > T of gene KAP1.4. (B) Sequence maps of genotypes C2C2 and C2T2 with g.209 C > T of gene KAP 1.4.
Figure 5.
Relative mRNA expression of genes IGF-1 (A), FGF5 (B), and KAP 1.4 (C) in ear skin tissue of the Northwestern Tibetan cashmere goat among seven counties. Data are mean ± SD from three independent experiments. Different letters stand for significant difference (p < 0.05).
Figure 5.
Relative mRNA expression of genes IGF-1 (A), FGF5 (B), and KAP 1.4 (C) in ear skin tissue of the Northwestern Tibetan cashmere goat among seven counties. Data are mean ± SD from three independent experiments. Different letters stand for significant difference (p < 0.05).
Figure 6.
Relative mRNA expression of genes IGF-1 (A), FGF5 (B), and KAP 1.4 (C) in ear skin tissue of the Northwestern Tibetan cashmere goat by sex. Data are mean ± SD from three independent experiments (p > 0.05).
Figure 6.
Relative mRNA expression of genes IGF-1 (A), FGF5 (B), and KAP 1.4 (C) in ear skin tissue of the Northwestern Tibetan cashmere goat by sex. Data are mean ± SD from three independent experiments (p > 0.05).
Figure 7.
Relative mRNA expression of gene IGF-1 (A), FGF5 (B), and KAP 1.4 (C) in ear skin tissue of the Northwestern Tibetan cashmere goat by age stages (one to five years old). Data are mean ± SD from three independent experiments (p > 0.05).
Figure 7.
Relative mRNA expression of gene IGF-1 (A), FGF5 (B), and KAP 1.4 (C) in ear skin tissue of the Northwestern Tibetan cashmere goat by age stages (one to five years old). Data are mean ± SD from three independent experiments (p > 0.05).
Table 1.
Primer sequences for PCR and real-time PCR.
| Primer Name | Primer Sequence (5′-3′) | Product Size (bp) | Annealing Temperature (°C) | Accession Number |
|---|---|---|---|---|
| Primers for SNP detection | ||||
| IGF1-F | GCTGGGTGTAGCAGTGAACA | 320 | 55.6 | D26119 |
| IGF1-R | GTTGCTTCAGCCGCATAACT | |||
| FGF5-F | AGCAGTAGCACCGTGTCTTC | 193 | 61.0 | XM_01294679 |
| FGF5-R | AGCCATTGACTTTGCCATCC | |||
| KAP1.4-F | TTGGTGGCAGCATTGGCTATG | 303 | 54.7 | GQ507748 |
| KAP1.4-R | AGAGATACTGTGTCTTGGGCA | |||
| Primers for real time PCR | ||||
| IGF1-F | AATCAGCAGTCTTCCAACCCAA | 114 | 51.8 | NM_001285697 |
| IGF1-R | AGCAAGCACAGGGCCAGAT | |||
| FGF5-F | ACCTCAGCACGTCTCTACCCAC | 123 | 52.4 | KM_596772 |
| FGF5-R | GGAACCTTTGGCTTGACGG | |||
| KAP1.4-F | GCCAGCCAACTTCCATCCA | 110 | 56.7 | JQ627657 |
| KAP1.4-R | AATGCCACAGCCGGTCTCAC | |||
| β-action-F | GGCCGCACCACTGGCATTGTCAT | 104 | 60.0 | DQ845171.1 |
| β-action-R | AGGTCCAGACGCAGGATGGCG | |||
IGF-1, Insulin-like Growth Factor I; FGF5, Fibroblast Growth Factor 5; KAP1.4, Keratin-associated protein 1.4; β-actin, beta actin.
Table 2.
Positions of mutations with changes in bases and their effects on amino acids in gene KAP 1.4 of the Northwestern Tibetan cashmere goat.
Table 2.
Positions of mutations with changes in bases and their effects on amino acids in gene KAP 1.4 of the Northwestern Tibetan cashmere goat.
| Gene | Position of Mutation | Base Change | Codon | Amino Acid |
|---|---|---|---|---|
| KAP1.4 | 209 | C–T | C*TG–TTG | Leucine(L)–non-change |
| 245 | C–T | CC*T–CTT | Proline(P)–Leucine(L) |
Locus of changed nucleotide.
Table 3.
Genotype and allele frequencies of gene KAP 1.4 of the cashmere goat at the 245 bp locus.
| Counties | Genotypes | Frequencies | Alleles | Frequencies | Heterozygosity | Homozygosity |
|---|---|---|---|---|---|---|
| C1C1 | 0.86 | C1 | 0.930 | |||
| Gar (N = 37) | C1T1 | 0.14 | T1 | 0.070 | 0.135 | 0.865 |
| T1T1 | 0 | |||||
| C1C1 | 0.84 | C1 | 0.895 | |||
| Rutog (N = 37) | C1T1 | 0.11 | T1 | 0.105 | 0.108 | 0.892 |
| T1T1 | 0.05 | |||||
| C1C1 | 0.73 | C1 | 0.865 | |||
| Gê’gya (N = 30) | C1T1 | 0.27 | T1 | 0.135 | 0.266 | 0.734 |
| T1T1 | 0 | |||||
| C1C1 | 0.78 | C1 | 0.890 | |||
| Baingoin (N = 37) | C1T1 | 0.22 | T1 | 0.110 | 0.216 | 0.784 |
| T1T1 | 0 | |||||
| C1C1 | 0.73 | C1 | 0.845 | |||
| Gêrzê (N = 30) | C1T1 | 0.23 | T1 | 0.155 | 0.233 | 0.767 |
| T1T1 | 0.04 | |||||
| C1C1 | 0.57 | C1 | 0.755 | |||
| Coqen (N = 35) | C1T1 | 0.37 | T1 | 0.245 | 0.371 | 0.629 |
| T1T1 | 0.06 | |||||
| C1C1 (N = 156) | 0.76 | C1 | 0.870 | |||
| Total (N = 206) Nyima C1T1 (N = 45) | 0.22 | T1 | 0.130 | 0.218 | 0.782 | |
| T1T1 (N = 5) | 0.02 | |||||
Table 4.
Genotype and allele frequencies of gene KAP 1.4 of the cashmere goat at the 209 bp locus. “N” represents the total number of cashmere goats in the counties.
Table 4.
Genotype and allele frequencies of gene KAP 1.4 of the cashmere goat at the 209 bp locus. “N” represents the total number of cashmere goats in the counties.
| Genetic Group | Genotypes | Frequencies | Alleles | Frequencies | Heterozygosity | Homozygosity |
|---|---|---|---|---|---|---|
| C2C2 | 0.97 | C2 | 0.985 | |||
| Gar (N = 37) | C2T2 | 0.03 | T2 | 0.015 | 0.027 | 0.973 |
| T2T2 | 0 | |||||
| C2C2 | 0.92 | C2 | 0.960 | |||
| Rutog (N = 37) | C2T2 | 0.08 | T2 | 0.040 | 0.081 | 0.919 |
| T2T2 | 0 | |||||
| C2C2 | 0.93 | C2 | 0.965 | |||
| Gê’gya (N = 30) | C2T2 | 0.07 | T2 | 0.035 | 0.066 | 0.934 |
| T2T2 | 0 | |||||
| C2C2 | 1 | C2 | 1.000 | |||
| Baingoin (N = 37) | C2T2 | 0 | T2 | 0.000 | 0.000 | 1.000 |
| T2T2 | 0 | |||||
| C2C2 | 0.93 | C2 | 0.965 | |||
| Gêrzê (N = 30) | C2T2 | 0.07 | T2 | 0.035 | 0.066 | 0.934 |
| T2T2 | 0 | |||||
| C2C2 | 0.89 | C2 | 0.945 | |||
| Coqen (N = 35) | C2T2 | 0.11 | T2 | 0.055 | 0.114 | 0.886 |
| T2T2 | 0 | |||||
| C2C2 (N = 194) | 0.94 | C2 | 0.970 | |||
| Total (N = 206) | C2T2 (N = 12) | 0.06 | T2 | 0.030 | 0.058 | 0.942 |
| T2T2 (N = 0) | 0 | |||||
Table 5.
Annual production of cashmere in each of the six districts with Northwestern Tibetan cashmere goats.
Table 5.
Annual production of cashmere in each of the six districts with Northwestern Tibetan cashmere goats.
| Counties | Rutog | Coqen | Nyima | Baingoin | Gê’gya | Gêrzê | Gar |
|---|---|---|---|---|---|---|---|
| Average cashmere production (g/each) | 380 | 350 | 350 | 300 | 300 | 300 | 300 |
Table 6.
Annual production of cashmere in age 1 to 5-year-old Northwestern Tibetan cashmere goats.
| Age | 1-Year-Old | 2-Year-Old | 3-Year-Old | 4-Year-Old | 5-Year-Old |
|---|---|---|---|---|---|
| Average cashmere production (g/each) | <50 | 50–200 | 50–200 | 50–200 | 50–200 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Song, T.; Tan, Y.; Cuomu, R.; Liu, Y.; Ba, G.; Suo, L.; Wu, Y.; Cao, X.; Zeng, X. Polymorphisms and mRNA Expression Levels of IGF-1, FGF5, and KAP 1.4 in Tibetan Cashmere Goats. Genes 2023, 14, 711. https://doi.org/10.3390/genes14030711
AMA Style
Song T, Tan Y, Cuomu R, Liu Y, Ba G, Suo L, Wu Y, Cao X, Zeng X. Polymorphisms and mRNA Expression Levels of IGF-1, FGF5, and KAP 1.4 in Tibetan Cashmere Goats. Genes. 2023; 14(3):711. https://doi.org/10.3390/genes14030711
Chicago/Turabian StyleSong, Tianzeng, Yao Tan, Renqing Cuomu, Yacheng Liu, Gui Ba, Langda Suo, Yujiang Wu, Xiaohan Cao, and Xianyin Zeng. 2023. "Polymorphisms and mRNA Expression Levels of IGF-1, FGF5, and KAP 1.4 in Tibetan Cashmere Goats" Genes 14, no. 3: 711. https://doi.org/10.3390/genes14030711
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
