Variations in BCO2 Coding Sequence Causing a Difference in Carotenoid Concentration in the Skin of Chinese Indigenous Chicken
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Samples
2.3. Measurement of Carotenoid Concentration in Chicken Skin
2.4. Primers
2.5. SNP Scanning and Genotyping
2.6. Real-Time PCR
3. Results
3.1. Carotenoid Concentration in Chicken Skin and Difference of BCO2 Expression Level in Tissues
3.2. Single Nucleotide Polymorphism Scanning in BCO2 Coding Sequence
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Maoka, T. Carotenoids as natural functional pigments. J. Nat. Med. 2020, 74, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Krinsky, N.I. Carotenoids as antioxidants. Nutrition 2001, 17, 815–817. [Google Scholar] [CrossRef]
- Giudetti, A.M.; Salzet, M.; Cassano, T. Oxidative stress in aging brain: Nutritional and pharmacological interventions for neurodegenerative disorders. Oxid. Med. Cell. Longev. 2018, 2018, 3416028. [Google Scholar] [CrossRef]
- Tan, B.L.; Norhaizan, M.E.; Huynh, K.; Heshu, S.R.; Yeap, S.K.; Hazilawati, H.; Roselina, K. Water extract of brewers’ rice induces apoptosis in human colorectal cancer cells via activation of caspase-3 and caspase-8 and downregulates the Wnt/β-catenin downstream signaling pathway in brewers’ rice-treated rats with azoxymethane-induced colon carcinogenesis. BMC Complement. Altern. Med. 2015, 15, 205. [Google Scholar]
- Liu, Z.; Zhou, T.; Ziegler, A.C.; Dimitrion, P.; Zuo, L. Oxidative stress in neurodegenerative diseases: From molecular mechanisms to clinical applications. Oxid. Med. Cell. Longev. 2017, 2017, 2525967. [Google Scholar] [CrossRef] [PubMed]
- Tuzcu, M.; Orhan, C.; Muz, O.E.; Sahin, N.; Juturu, V.; Sahin, K. Lutein and zeaxanthin isomers modulates lipid metabolism and the inflammatory state of retina in obesity-induced high-fat diet rodent model. BMC Ophthalmol. 2017, 17, 129. [Google Scholar] [CrossRef]
- Chang, J.; Zhang, Y.; Li, Y.; Lu, K.; Shen, Y.; Guo, Y.; Qi, Q.; Wang, M.; Zhang, S. NrF2/ARE and NF-κB pathway regulation may be the mechanism for lutein inhibition of human breast cancer cell. Future Oncol. 2018, 14, 719–726. [Google Scholar] [CrossRef] [PubMed]
- Tan, B.L.; Norhaizan, M.E. Carotenoids: How effective are they to prevent age-related diseases? Molecules 2019, 24, 1801. [Google Scholar] [CrossRef] [PubMed]
- VåGE, D.I.; Boman, I.A. A nonsense mutation in the β-carotene oxygenase 2 (BCO2) gene is tightly associated with accumulation of carotenoids in adipose tissue in sheep (Ovis aries). BMC Genet. 2010, 11, 10. [Google Scholar] [CrossRef] [PubMed]
- Park, R. Absorption, metabolism, and transport of carotenoids. FASEB J. 1996, 10, 542–551. [Google Scholar] [CrossRef]
- Hui, J.; Li, L.; Li, R.; Wu, M.; Yang, Y.; Wang, J.; Fan, Y.; Zheng, X. Effects of supplementation with β-carotene on the growth performance and intestinal mucosal barriers in layer-type cockerels. Anim. Sci. J. 2020, 91, e13344. [Google Scholar] [CrossRef] [PubMed]
- Rajput, N.; Ali, S.; Naeem, M.; Khan, M.A.; Wang, T. The effect of dietary supplementation with the natural carotenoids curcumin and lutein on pigmentation, oxidative stability and quality of meat from broiler chickens affected by a coccidiosis challenge. Br. Poult. Sci. 2014, 55, 501–509. [Google Scholar] [CrossRef] [PubMed]
- Jin, S.; Lee, J.H.; Seo, D.W.; Cahyadi, M.; Choi, N.R.; Heo, K.N.; Jo, C.; Park, H.B. A major locus for quantitatively measured shank skin color traits in korean native chicken. Asian Australas. J. Anim. Sci. 2016, 29, 1555–1561. [Google Scholar] [CrossRef]
- Langi, P.; Kiokias, S.; Varzakas, T.; Proestos, C. Carotenoids: From plants to food and feed industries. Methods Mol. Biol. 2018, 1852, 57–71. [Google Scholar] [PubMed]
- Eriksson, J.; Larson, G.; Gunnarsson, U.; Bed’hom, B.; Tixier-Boichard, M.; Strömstedt, L.; Wright, D.; Jungerius, A.; Vereijken, A.; Randi, E.; et al. Identification of the yellow skin gene reveals a hybrid origin of the domestic chicken. PLoS Genet. 2008, 4, e1000010. [Google Scholar] [CrossRef]
- Borel, P. Genetic variations involved in interindividual variability in carotenoid status. Mol. Nutr. Food Res. 2012, 56, 228–240. [Google Scholar] [CrossRef]
- Berry, S.D.; Davis, S.R.; Beattie, E.M.; Thomas, N.L.; Burrett, A.K.; Wardet, H.E.; Stanfield, A.M.; Biswas, M.; Ankersmit-Udy, A.E.; Oxley, P.E.; et al. Mutation in bovine β-carotene oxygenase 2 affects milk color. Genetics 2009, 182, 923–926. [Google Scholar] [CrossRef] [PubMed]
- Luo, W.; Luo, C.; Wang, M.; Guo, L.; Chen, X.; Li, Z.; Zheng, M.; Folaniyi, B.S.; Luo, W.; Shu, D.; et al. Genome diversity of Chinese indigenous chicken and the selective signatures in Chinese gamecock chicken. Sci. Rep. 2020, 10, 14532. [Google Scholar] [CrossRef]
- Nie, C.; Almeida, P.; Jia, Y.; Bao, H.; Ning, Z.; Qu, L. Genome-wide single-nucleotide polymorphism data unveil admixture of Chinese indigenous chicken breeds with commercial breeds. Genome Biol. Evol. 2019, 11, 1847–1856. [Google Scholar] [CrossRef]
- Chen, L.; Wang, X.; Cheng, D.; Chen, K.; Fan, Y.; Wu, G.; You, J.; Liu, S.; Mao, H.; Ren, J. Population genetic analyses of seven Chinese indigenous chicken breeds in a context of global breeds. Anim. Genet. 2019, 50, 82–86. [Google Scholar] [CrossRef]
- Huang, X.; Otecko, N.O.; Peng, M.; Weng, Z.; Du, B. Genome-wide genetic structure and selection signatures for color in 10 traditional chinese yellow-feathered chicken breeds. BMC Genom. 2020, 21, 316. [Google Scholar] [CrossRef]
- Ribaya-Mercado, J.D.; Holmgren, S.C.; Fox, J.G.; Russell, R.M. Dietary β-carotene absorption and metabolism in ferrets and rats. J. Nutr. 1989, 119, 665–668. [Google Scholar] [CrossRef] [PubMed]
- Ribaya-Mercado, J.D.; Fox, J.G.; Rosenblad, W.D.; Blanco, M.C.; Russell, R.M. β-carotene, retinol and retinyl ester concentrations in serum and selected tissues of ferrets fed β-carotene. J. Nutr. 1992, 122, 1898–1903. [Google Scholar] [CrossRef] [PubMed]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Comparative Study. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
- Moreno, J.A.; Díaz-Gómez, J.; Nogareda, C.; Angulo, E.; Sandmann, G.; Portero-Otin, M.; Serrano, J.C.; Twyman, R.M.; Capell, T.; Zhu, C.; et al. The distribution of carotenoids in hens fed on biofortified maize is influenced by feed composition, absorption, resource allocation and storage. Sci. Rep. 2016, 6, 35346. [Google Scholar] [CrossRef]
- Nogareda, C.; Moreno, J.A.; Angulo, E.; Sandmann, G.; Portero, M.; Capell, T.; Zhu, C.; Christou, P. Carotenoid-enriched transgenic corn delivers bioavailable carotenoids to poultry and protects them against coccidiosis. Plant Biotechnol. J. 2016, 14, 160–168. [Google Scholar] [CrossRef]
- Díaz-Gómez, J.; Moreno, J.A.; Angulo, E.; Sandmann, G.; Zhu, C.; Ramos, A.J.; Capell, T.; Christou, P.; Nogareda, C. High-carotenoid biofortified maize is an alternative to color additives in poultry feed. Anim. Feed Sci. Technol. 2017, 231, 38–46. [Google Scholar] [CrossRef]
- Díaz-Gómez, J.; Moreno, J.A.; Angulo, E.; Sandmann, G.; Zhu, C.; Capell, T.; Nogareda, C. Provitamin A carotenoids from an engineered high-carotenoid maize are bioavailable and zeaxanthin does not compromiseβ-carotene absorption in poultry. Transgenic Res. 2017, 26, 591–601. [Google Scholar] [CrossRef]
- Dorshorst, B.; Molin, A.M.; Rubin, C.J.; Johansson, A.M.; Strömstedt, L.; Pham, M.H.; Chen, C.F.; Hallböök, F.; Ashwell, C.; Andersson, L. A complex genomic rearrangement involving the endothelin 3 locus causes dermal hyperpigmentation in the chicken. PLoS Genet. 2011, 7, e1002412. [Google Scholar] [CrossRef]
- Knox, C.W. The inheritance of shank color in chickens. Genetics 1935, 20, 529–544. [Google Scholar] [CrossRef]
- Li, G.; Li, D.; Yang, N.; Qu, L.; Hou, Z.; Zheng, J.; Xu, G.; Chen, S. A genome-wide association study identifies novel single nucleotide polymorphisms associated with dermal shank pigmentation in chickens. Poult. Sci. 2014, 93, 2983–2987. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Lin, Z.; Chen, G.; Luo, Q.; Nie, Q.; Zhang, X.; Luo, W. Characterization of Chicken Skin Yellowness and Exploration of Genes Involved in Skin Yellowness Deposition in Chicken. Front. Physiol. 2021, 31, 585089. [Google Scholar] [CrossRef]
- Wright, D.; Boije, H.; Meadows, J.; Bed’hom, B.; Gourichon, D.; Vieaud, A.; Tixier-Boichard, M.; Rubin, C.J.; Imsland, F.; Hallböök, F.; et al. Copy number variation in intron 1 of SOX5 causes the Pea-comb phenotype in chickens. PLoS Genet. 2009, 5, e1000512. [Google Scholar] [CrossRef] [PubMed]
- Vijayakumar, S.; Hall, D.C.; Reveles, X.T.; Troyer, D.A.; Thompson, I.M.; Garcia, D.; Xiang, R.; Leach, R.J.; Johnson-Pais, T.L.; Naylor, S.L. Detection of recurrent copy number loss at Yp11.2 involving TSPY gene cluster in prostate cancer using array-based comparative genomic hybridization. Cancer Res. 2006, 66, 4055–4064. [Google Scholar] [CrossRef] [PubMed]
- Seo, B.Y.; Park, E.W.; Ahn, S.J.; Lee, S.H.; Kim, J.H.; Im, H.T.; Lee, J.H.; Cho, I.C.; Kong, I.K.; Jeon, J.T. An accurate method for quantifying and analyzing copy number variation in porcine KIT by an oligonucleotide ligation assay. BMC Genet. 2007, 8, 81. [Google Scholar] [CrossRef]
- Hamilton, C.K.; Favetta, L.A.; Di Meo, G.P.; Floriot, S.; Perucatti, A.; Peippo, J.; Kantanen, J.; Eggen, A.; Iannuzzi, L.; King, W.A. Copy number variation of testis-specific protein, Y-encoded (TSPY) in 14 different breeds of cattle (Bos taurus). Sex. Dev. 2009, 3, 205–213. [Google Scholar] [CrossRef]
- Fontanesi, L.; Beretti, F.; Riggio, V.; Gómez González, E.; Dall’Olio, S.; Davoli, R.; Russo, V.; Portolano, B. Copy number variation and missense mutations of the agouti signaling protein (ASIP) gene in goat breeds with different coat colors. Cytogenet. Genome Res. 2009, 126, 333–347. [Google Scholar] [CrossRef]
- Clifford, R.L.; Fishbane, N.; Patel, J.; MacIsaac, J.L.; McEwen, L.M.; Fisher, A.J.; Brandsma, C.A.; Nair, P.; Kobor, M.S.; Hackett, T.L.; et al. Altered DNA methylation is associated with aberrant gene expression in parenchymal but not airway fibroblasts isolated from individuals with COPD. Clin. Epigenetics 2018, 10, 32. [Google Scholar] [CrossRef]
- Jones, P.A.; Takai, D. The role of DNA methylation in mammalian epigenetics. Science 2001, 293, 1068–1070. [Google Scholar] [CrossRef]
- Rintisch, C.; Heinig, M.; Bauerfeind, A.; Schafer, S.; Mieth, C.; Patone, G.; Hummel, O.; Chen, W.; Cook, S.; Cuppen, E.; et al. Natural variation of histone modification and its impact on gene expression in the rat genome. Genome Res. 2014, 24, 942–953. [Google Scholar] [CrossRef] [PubMed]
- Colicchio, J.M.; Miura, F.; Kelly, J.K.; Ito, T.; Hileman, L.C. DNA methylation and gene expression in Mimulus guttatus. BMC Genom. 2015, 16, 507. [Google Scholar] [CrossRef]
- Sundar, I.K.; Rahman, I. Gene expression profiling of epigenetic chromatin modification enzymes and histone marks by cigarette smoke: Implications for COPD and lung cancer. Am. J. Physiol. Lung Cell. Mol. Physiol. 2016, 311, L1245–L1258. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Zhang, F.; Rode, S.; Chin, K.K.; Ko, E.E.; Kim, J.; Iyer, V.R.; Qiao, H. Ethylene induces combinatorial effects of histone H3 acetylation in gene expression in Arabidopsis. BMC Genom. 2017, 18, 538. [Google Scholar] [CrossRef] [PubMed]
- Wongfieng, W.; Jumnainsong, A.; Chamgramol, Y.; Sripa, B.; Leelayuwat, C. 5′-UTR and 3′-UTR Regulation of MICB Expression in Human Cancer Cells by Novel microRNAs. Genes 2017, 8, 213. [Google Scholar] [CrossRef]
- Larsen, C.A.; Howard, M.T. Conserved regions of the DMD 3′ UTR regulate translation and mRNA abundance in cultured myotubes. Neuromuscul. Disord. 2014, 24, 693–706. [Google Scholar] [CrossRef]




| Name | Sequence (5′-3′) | Annealing Temperature (°C) | Product Length (bp) |
|---|---|---|---|
| YSD-F | TCCTCTGATTGCTTTACTGACTTG | 60 | 444 |
| YSD-R | GGGAAGGAGGTATCATTGGAGA | ||
| BCO2-F | ACTGGACCAAGTTTGTTGCCGT | 58 | 192 |
| BCO2-R | GTTGGAGCAATGGAGCATAGCA | ||
| GAPDH-F | GGTGAAAGTCGGAGTCAACGG | 59 | 108 |
| GAPDH-R | TCGATGAAGGGATCATTGATGGC | ||
| ACTB-F | CCCCAAAGCCAACAGAGAGA | 59 | 158 |
| ACTB-R | GGTGGTGAAGCTGTAGCCTCTC | ||
| BCO2-A-F | CAGGGGAGATCACAACGGAC | 56 | 352 |
| BCO2-A-R | ATGAGCACCGGGAACCATTT | ||
| BCO2-B-F | CACAGCTCCCGTCAAAGCTA | 56 | 403 |
| BCO2-B-R | ATGTTGGCATGAGCTCGTCA | ||
| BCO2-C-F | CCGCATCTAGCAGAGCGATA | 56 | 449 |
| BCO2-C-R | AGTCCCAAAGTTTGTGCAGC |
| Breed | No. of Birds | SNP A 1 | SNP B 1 | SNP C 1 | SNP c.890A>G | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Genotype Distribution | Genotype Distribution | Genotype Distribution | Genotype Distribution | ||||||||||
| AA | AG | GG | AA | AG | GG | AA | AG | GG | AA | AG | GG | ||
| Silkies 2 | 30 | 1 | 9 | 17 | 15 | 9 | 1 | 24 | 0 | 0 | 17 | 0 | 9 |
| Fast-Growing Lingnanhuang Line A | 30 | 25 | 5 | 0 | 0 | 0 | 30 | 23 | 4 | 0 | 0 | 0 | 29 |
| Guangxi Huang | 30 | 28 | 1 | 0 | 0 | 9 | 21 | 30 | 0 | 0 | 0 | 0 | 30 |
| Qingyuan Ma | 30 | 30 | 0 | 0 | 0 | 0 | 30 | 30 | 0 | 0 | 0 | 0 | 30 |
| Huiyang Beard | 30 | 30 | 0 | 0 | 0 | 0 | 30 | 30 | 0 | 0 | 0 | 0 | 30 |
| Breed 1 | No. of Birds | Genotypic Frequency | Allelic Frequency | |||
|---|---|---|---|---|---|---|
| AA | AG | GG | A | G | ||
| Qingjiao Ma | 60 | 60 | 0 | 0 | 1.000 | 0.000 |
| Guangxi Huang | 60 | 0 | 0 | 60 | 0.000 | 1.000 |
| Youxi Ma | 44 | 29 | 15 | 0 | 0.830 | 0.170 |
| Huiyang Beard | 60 | 0 | 0 | 60 | 0.000 | 1.000 |
| Fast-Growing Lingnanhuang Line A | 60 | 0 | 0 | 60 | 0.000 | 1.000 |
| Mahuang with black shank | 78 | 74 | 4 | 0 | 0.974 | 0.026 |
| Mahuang with navy shank | 52 | 0 | 0 | 52 | 0.000 | 1.000 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Y.; Gan, S.; Luo, C.; Liu, S.; Ma, J.; Luo, W.; Lin, C.; Shu, D.; Qu, H. Variations in BCO2 Coding Sequence Causing a Difference in Carotenoid Concentration in the Skin of Chinese Indigenous Chicken. Genes 2023, 14, 671. https://doi.org/10.3390/genes14030671
Wang Y, Gan S, Luo C, Liu S, Ma J, Luo W, Lin C, Shu D, Qu H. Variations in BCO2 Coding Sequence Causing a Difference in Carotenoid Concentration in the Skin of Chinese Indigenous Chicken. Genes. 2023; 14(3):671. https://doi.org/10.3390/genes14030671
Chicago/Turabian StyleWang, Yan, Shiyi Gan, Chenglong Luo, Sijia Liu, Jie Ma, Wei Luo, Chuxiao Lin, Dingming Shu, and Hao Qu. 2023. "Variations in BCO2 Coding Sequence Causing a Difference in Carotenoid Concentration in the Skin of Chinese Indigenous Chicken" Genes 14, no. 3: 671. https://doi.org/10.3390/genes14030671
APA StyleWang, Y., Gan, S., Luo, C., Liu, S., Ma, J., Luo, W., Lin, C., Shu, D., & Qu, H. (2023). Variations in BCO2 Coding Sequence Causing a Difference in Carotenoid Concentration in the Skin of Chinese Indigenous Chicken. Genes, 14(3), 671. https://doi.org/10.3390/genes14030671

