The Impact of Niclosamide Exposure on the Activity of Antioxidant Enzymes and the Expression of Glucose and Lipid Metabolism Genes in Black Carp (Mylopharyngodon piceus)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Niclosamide Preparation
2.3. Animal Holding and Experimental Design
2.4. Determination of NIC Concentrations in Tissue
2.5. Antioxidant Capacity Assays
2.6. Metabolic Parameter Assays
2.7. Gene Expression Analysis
2.8. Statistical Analysis
3. Results
3.1. NIC Exposure Reduced Fish Weight and Accumulated in Black Carp
3.2. NIC Exposure Caused Damage to the Tight Junction in Black Carp
3.3. NIC Exposure Decreased Antioxidant Ability in Black Carp
3.4. NIC Exposure Decreased the ATP Level and Inhibited ATPase Activity in Black Carp
3.5. NIC Exposure Changed the Modes of Glucose and Lipid Metabolism in Black Carp
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Chen, W.; Mook, J.R.A.; Premont, R.T.; Wang, J. Niclosamide: Beyond an antihelminthic drug. Cell Signal. 2018, 41, 89–96. [Google Scholar] [CrossRef]
- Zhu, B.; He, W.; Yang, F.; Chen, L. High-throughput transcriptome sequencing reveals the developmental toxicity mechanisms of niclosamide in zebrafish embryo. Chemosphere 2020, 244, 125468. [Google Scholar] [CrossRef]
- Takougang, I.; Meli, J.; Pone, J.W.; Angwafo, F. Community acceptability of the use of low-dose niclosamide (Bayluscide), as a molluscicide in the control of human schistosomiasis in Sahelian Cameroon. Ann. Trop. Med. Parasitol. 2007, 101, 479–486. [Google Scholar] [CrossRef]
- Lawrence, M.J.; Mitrovic, D.; Foubister, D.; Bragg, L.M.; Sutherby, J.; Docker, M.F.; Servos, M.R.; Wilkie, M.P.; Jeffries, K.M. Contrasting physiological responses between invasive sea lamprey and non-target bluegill in response to acute lampricide exposure. Aquat. Toxicol. 2021, 237, 105848. [Google Scholar] [CrossRef]
- Cirkovic, M.; Kartalovic, B.; Novakov, N.; Pelic, M.; Djordjevic, V.; Radosavljevic, V.; Aleksic, N. Distribution of niclosamide residues in meat and internal organs of common carp. Procedia Food Sci. 2015, 5, 54–56. [Google Scholar] [CrossRef]
- Xu, J.; Shi, P.; Li, H.; Zhou, J. Broad spectrum antiviral agent niclosamide and its therapeutic potential. ACS Infect. Dis. 2020, 6, 909–915. [Google Scholar] [CrossRef]
- Zhu, B.; Lei, L.; Sun, Y.; Shi, X.; Fu, K.; Hua, J.; Martyniuk, C.J.; Han, J.; Yang, L.; Zhou, B. Niclosamide exposure at environmentally relevant concentrations efficaciously inhibited the growth and disturbed the liver-gut axis of adult male zebrafish. Environ. Sci. Technol. 2022, 56, 11516–11526. [Google Scholar] [CrossRef]
- Ionescu, R.A.; Mitrovic, D.; Wilkie, M.P. Reversible disruptions to energy supply and acid-base balance in larval sea lamprey exposed to the pesticide: Niclosamide (2′,5-dichloro-4′-nitrosalicylanilide). Aquat. Toxicol. 2022, 242, 106006. [Google Scholar] [CrossRef]
- Huang, D.G.; Zhen, J.H.; Quan, S.Q.; Liu, M.; Liu, L. Risk assessment for niclosamide residues in water and sediments from Nan Ji Shan Island within Poyang Lake region, China. Adv. Mater. Res. 2013, 721, 608–612. [Google Scholar] [CrossRef]
- Borowiec, B.G.; Birceanu, O.; Wilson, J.M.; McDonald, A.E.; Wilkie, M.P. Niclosamide is a much more potent toxicant of mitochondrial respiration than TFM in the invasive sea lamprey (Petromyzon marinus). Environ. Sci. Technol. 2022, 56, 4970–4979. [Google Scholar] [CrossRef]
- Yang, C.; Huang, Y.; Lu, Z.; Ma, Y.; Ran, X.; Xiao, Y.; Zhang, M.; Qiu, X.; Luo, L.; Yue, G.; et al. Sublethal effects of niclosamide on the aquatic snail Pomacea canaliculata. Ecotoxicol. Environ. Saf. 2023, 259, 115064. [Google Scholar] [CrossRef]
- Xiang, J.; Wu, H.; Gao, J.; Jiang, W.; Tian, X.; Xie, Z.; Zhang, T.; Feng, J.; Song, R. Niclosamide exposure disrupts antioxidant defense, histology, and the liver and gut transcriptome of Chinese soft-shelled turtle (Pelodiscus sinensis). Ecotoxicol. Environ. Saf. 2023, 260, 115081. [Google Scholar] [CrossRef] [PubMed]
- Park, J.P.; Fioravanti, C.F. Catalysis of NADH→NADP+ transhydrogenation by adult Hymenolepis diminuta mitochondria. Parasitol. Res. 2006, 98, 200–206. [Google Scholar] [CrossRef] [PubMed]
- Ionescu, R.A.; Mitrovic, D.; Wilkie, M.P. Disturbances to energy metabolism in juvenile lake sturgeon (Acipenser fulvescens) following exposure to niclosamide. Ecotoxicol. Environ. Saf. 2022, 229, 112969. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Fu, H.; Wang, L.; Lin, L.; He, G.; Fu, P.; Wang, C.; Zhang, Y.; Kang, B. Fishery status and rebuilding of major economic fishes in the largest freshwater lake in China based on limited data. Fishes 2022, 7, 47. [Google Scholar] [CrossRef]
- Guo, Y.; Huang, D.; Chen, F.; Ma, S.; Zhou, W.; Zhang, W.; Mai, K. Lipid deposition in abalone Haliotis discus hannai affected by dietary lipid levels through AMPKα2/PPARα and JNK/mTOR/SREBP-1c pathway. Aquaculture 2021, 532, 736040. [Google Scholar] [CrossRef]
- Jia, X.; Qian, P.; Wu, C.; Xie, Y.; Yang, W.; Song, R.; Wu, J.; Ye, J. Effects of dietary pantothenic acid on growth, antioxidant ability and innate immune response in juvenile black carp. Aquacult. Rep. 2022, 24, 101131. [Google Scholar] [CrossRef]
- Dia, Y.; Shen, Y.; Guo, J.; Yang, H.; Chen, F.; Zhang, W.; Wu, W.; Xu, X.; Li, J. Glycolysis and gluconeogenesis are involved of glucose metabolism adaptation during fasting and re-feeding in black carp (Mylopharyngodon piceus). Aquac. Fish. 2022, in press. [CrossRef]
- Xia, J.; Jin, C.; Pan, Z.; Sun, L.; Fu, Z.; Jin, Y. Chronic exposure to low concentrations of lead induces metabolic disorder and dysbiosis of the gut microbiota in mice. Sci. Total Environ. 2018, 631–632, 439–448. [Google Scholar] [CrossRef]
- Dai, Y.; Shen, Y.; Wang, S.; Zhang, J.; Su, Y.; Bao, S.; Xu, X.; Li, J. RNA-Seq transcriptome analysis of the liver and brain of the black carp (Mylopharyngodon piceus) during fasting. Mar. Biotechnol. 2021, 23, 389–401. [Google Scholar] [CrossRef]
- Wilkie, M.P.; Hubert, T.D.; Boodaard, M.A.; Birceanu, O. Control of invasive sea lampreys using the piscicides TFM and niclosamide: Toxicology, successes & future prospects. Aquat. Toxicol. 2019, 211, 235–252. [Google Scholar] [PubMed]
- Fuchylo, U.; Alharbi, H.A.; Alcaraz, A.J.; Jones, P.D.; Giesy, J.P.; Hecker, M.; Brinkmann, M. Inflammation of gill epithelia in fish causes increased permeation of petrogenic polar organic chemicals via disruption of tight junctions. Environ. Sci. Technol. 2022, 56, 1820–1829. [Google Scholar] [CrossRef] [PubMed]
- Yu, J.; Wang, Y.; Xiao, Y.; Li, X.; Xu, X.; Zhao, H.; Wu, L.; Li, J. Effects of chronic nitrate exposure on the intestinal morphology, immune status, barrier function, and microbiota of juvenile turbot (Scophthalmus maximus). Ecotoxicol. Environ. Saf. 2021, 207, 111287. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Fu, S.; Zhang, S.; Ding, M.; Wang, A. Lead induces structural damage, microbiota dysbiosis and cell apoptosis in the intestine of juvenile bighead carp (Hypophthalmichthys nobilis). Aquaculture 2020, 528, 735573. [Google Scholar] [CrossRef]
- Zhao, J.; Zhao, Y.; Liu, H.; Cao, Q.; Feng, L.; Zhang, Z.; Jiang, W.; Wu, P.; Liu, Y.; Luo, W.; et al. Dietary leucine improves fish intestinal barrier function by increasing humoral immunity, antioxidant capacity, and tight junction. Int. J. Mol. Sci. 2023, 24, 4716. [Google Scholar] [CrossRef] [PubMed]
- Deng, F.; Wang, D.; Chen, F.; Lu, T.; Li, S. Molecular characterization and expression analysis of claudin-4-like in rainbow trout involved in Flavobacterium psychrophilum infection. Fish Shellfish Immun. 2022, 130, 244–251. [Google Scholar] [CrossRef] [PubMed]
- Han, Z.; Ge, L.; Wen, S.; Sun, J. Dysfunction of the intestinal physical barrier in the intestinal inflammation of tongue sole, Cynoglossus semilaevis, induced by Shewanella algae infection. Fish Shellfish Immun. 2023, 139, 108900. [Google Scholar] [CrossRef]
- Collins, P.; Jones, C.; Choudhury, S.; Damelin, L.; Hodgson, H. Increased expression of uncoupling protein 2 in HepG2 cells attenuates oxidative damage and apoptosis. Liver Int. 2005, 25, 880–887. [Google Scholar] [CrossRef]
- Chen, L.; Wang, L.; Shen, H.; Lin, H.; Li, D. Anthelminthic drug niclosamide sensitizes the responsiveness of cervical cancer cells to paclitaxel via oxidative stress-mediated mTOR inhibition. Biochem. Biophys. Res. Commun. 2017, 484, 416–421. [Google Scholar] [CrossRef]
- Yang, C.; Lim, W.; Song, G. Mediation of oxidative stress toxicity induced by pyrethroid pesticides in fish. Comp. Biochem. Phys. C 2020, 234, 108758. [Google Scholar] [CrossRef]
- Singh, A.; Rajput, V.D.; Sharma, R.; Ghazaryan, K.; Minkina, T. Salinity stress and nanoparticles: Insights into antioxidative enzymatic resistance, signaling, and defense mechanisms. Environ. Res. 2023, 235, 116585. [Google Scholar] [CrossRef] [PubMed]
- Li, R.; Amenyogbe, E.; Lu, Y.; Jin, J.; Xie, R.; Huang, J. Effects of low-temperature stress on intestinal structure, enzyme activities and metabolomic analysis of juvenile golden pompano (Trachinotus ovatus). Front. Mar. Sci. 2023, 10, 1114120. [Google Scholar] [CrossRef]
- Lu, J.; Zhang, M.; Lu, L. Tissue metabolism, hematotoxicity, and hepatotoxicity of trichlorfon in Carassius auratus gibelio after a single oral administration. Front. Physiol. 2018, 9, 551. [Google Scholar] [CrossRef] [PubMed]
- Yuan, X.; Wu, H.; Gao, J.; Gen, X.; Xie, M.; Song, R.; Zheng, J.M.; Wu, Y.; Ou, D. Acute deltamethrin exposure induces oxidative stress, triggers endoplasmic reticulum stress, and impairs hypoxic resistance of crucian carp. Comp. Biochem. Phys. C 2022, 263, 109508. [Google Scholar] [CrossRef]
- Yuan, Y.; Guan, H.; Huang, Y.; Luo, J.; Jian, J.; Cai, S.; Yang, Y. Involvement of Nrf2 in the immune regulation of Litopenaeus vannamei against Vibrio harveyi infection. Fish Shellfish Immun. 2023, 133, 108547. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, V.T.; Bian, L.; Tamaoki, J.; Otsubo, S.; Muratani, M.; Kawahara, A.; Kobayashi, M. Generation and characterization of keap1a- and keap1b-knockout zebrafish. Redox Biol. 2020, 36, 101667. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Xia, S.; Zhu, J.; Miao, L.; Ren, M.; Lin, Y.; Ge, X.; Sun, S. Growth performance, physiological response and histology changes of juvenile blunt snout bream, Megalobrama amblycephala exposed to chronic ammonia. Aquaculture 2019, 506, 424–436. [Google Scholar] [CrossRef]
- Alasadi, A.; Chen, M.; Swapna, G.V.T.; Tao, H.; Guo, J.; Collantes, J.; Fadhil, N.; Montelione, G.; Jin, S. Effect of mitochondrial uncouplers niclosamide ethanolamine (NEN) and oxyclozanide on hepatic metastasis of colon cancer. Cell Death Dis. 2018, 9, 215. [Google Scholar] [CrossRef]
- Sun, J.L.; Zhao, L.; Wu, H.; Liu, Q.; Liao, L.; Luo, J.; Lian, W.; Cui, C.; Jin, L.; Ma, J.; et al. Acute hypoxia changes the mode of glucose and lipid utilization in the liver of the largemouth bass (Micropterus salmoides). Sci. Total Environ. 2020, 713, 135157. [Google Scholar] [CrossRef]
- Yang, S.; Wu, H.; He, K.; Yan, T.; Zhou, J.; Zhao, L.; Sun, J.L.; Lian, W.; Zhang, D.; Du, J.; et al. Response of AMP-activated protein kinase and lactate metabolism of largemouth bass (Micropterus salmoides) under acute hypoxic stress. Sci. Total Environ. 2019, 666, 1071–1079. [Google Scholar] [CrossRef]
- Lazado, C.C.; Strand, D.A.; Breiland, M.W.; Furtado, F.; Timmerhaus, G.; Gjessing, M.C.; Hytterod, S.; Merkin, G.V.; Pedersen, L.F.; Pittman, K.A.; et al. Mucosal immune and stress responses of Neoparamoeba perurans-infected Atlantic salmon (Salmo salar) treated with peracetic acid shed light on the host-parasite-oxidant interactions. Front. Immunol. 2022, 13, 948897. [Google Scholar] [CrossRef] [PubMed]
- Su, J.; Mei, L.; Xi, L.; Gong, Y.; Yang, Y.; Jin, J.; Liu, H.; Zhu, X.; Xie, S.; Han, D. Responses of glycolysis, glycogen accumulation and glucose-induced lipogenesis in grass carp and Chinese longsnout catfish fed high-carbohydrate diet. Aquaculture 2021, 533, 736146. [Google Scholar] [CrossRef]
- Zheng, L.; Wang, Z.; Zhang, B.; Yan, L.; Wang, P.; Zhao, C.; Lin, H.; Qiu, L.; Zhou, C. Effects of high dietary carbohydrate levels on growth performance, enzyme activities, expression of genes related to liver glucose metabolism, and the intestinal microbiota of Lateolabrax maculatus Juveniles. Fishes 2023, 8, 431. [Google Scholar] [CrossRef]
- Pan, H.; Li, L.; Li, J.M.; Wang, W.; Limbu, S.M.; Degrace, P.; Li, D.; Du, Z. Inhibited fatty acid β-oxidation impairs stress resistance ability in Nile tilapia (Oreochromis niloticus). Fish Shellfish Immun. 2017, 68, 500–508. [Google Scholar] [CrossRef] [PubMed]
- Ming, J.; Wang, T.; Wang, T.; Ye, J.; Zhang, Y.; Yang, X.; Shao, X.P.; Ding, Z. Effects of dietary berberine on growth performance, lipid metabolism, antioxidant capacity and lipometabolism-related genes expression of AMPK signaling pathway in juvenile black carp (Mylopharyngodon piceus) fed high-fat diets. Fish Physiol. Biochem. 2022, 49, 769–786. [Google Scholar] [CrossRef] [PubMed]
- Minghetti, M.; Leaver, M.J.; Tocher, D.R. Transcriptional control mechanisms of genes of lipid and fatty acid metabolism in the Atlantic salmon (Salmo salar L.) established cell line, SHK-1. BBA-Mol. Cell Biol. Lipids 2011, 1811, 194–202. [Google Scholar] [CrossRef]
- Nakazawa, M.S.; Keith, B.; Simon, M.C. Oxygen availability and metabolic adaptations. Nat. Rev. Cancer 2016, 16, 663–673. [Google Scholar] [CrossRef]
- Lei, C.; Li, M.; Tian, J.; Wen, J.; Li, Y. Transcriptome analysis of golden pompano (Trachinotus ovatus) liver indicates a potential regulatory target involved in HUFA uptake and deposition. Comp. Biochem. Phys. D 2020, 33, 100633. [Google Scholar] [CrossRef]







| Target Gene | Abbreviation | Primer Sequences (5′-3′) | Accession Number | Annealing Temperature (°C) | 
|---|---|---|---|---|
| Endogenous antioxidant defense | ||||
| NFE2-related nuclear factor 2 | NRF2 | Forward: TGTCCAAACACCAGCTCAA | cited by Ref. [16] | 56 | 
| Reverse: CGTACTCTAGGCCCACGAT | ||||
| Kelch-like-ECH-associated protein 1a | Keap1a | Forward: GGCTGCTCTGTGATCTGGTT | cited by Ref. [16] | 56 | 
| Reverse: TTCCTTGAAGTTGCTGGTGA | ||||
| Kelch-like-ECH-associated protein 1b | Keap1b | Forward: CCATCGGCATCGCCAACTT | cited by Ref. [16] | 60 | 
| Reverse: TGCGTAGCCACCTGACTGAA | ||||
| Physical barrier/Tight junction | ||||
| Zonula occludens-1 | ZO1 | Forward: CTCTTCACCACCACCATCAAC | cited by Ref. [16] | 56 | 
| Reverse: TCCGAGACCCAAACCAACT | ||||
| Zonula occludens-2 | ZO2 | Forward: GCCGTCTGGGTCTGTGAA | cited by Ref. [16] | 58 | 
| Reverse: CCGCCGTATCCTCGTAGTC | ||||
| Zonula occludens-3 | ZO3 | Forward: TGGCTCAGGAGAAGGGTG | cited by Ref. [16] | 58 | 
| Reverse: GCTGCTCGGACTGTTTGG | ||||
| Claudin3 | Claudin3 | Forward: GGAATGTGCGTGACCCTG | cited by Ref. [16] | 56 | 
| Reverse: TCCACAAGCCTTCATAGCG | ||||
| Claudin4 | Claudin4 | Forward: ACTGGGTGTTCTGGGAATCAAA | cited by Ref. [16] | 58 | 
| Reverse: GACGGGTACGAGGATGAGGA | ||||
| Claudin8 | Claudin8 | Forward: AGCGGTGCCCTGGAGATT | cited by Ref. [16] | 60 | 
| Reverse: CCACAAGCCTTCATAGCG | ||||
| Claudin15 | Claudin15 | Forward: GGTGTTCTGGGAATCAAATGC | cited by Ref. [16] | 56 | 
| Reverse: GCAGACGGGTACGAGGATG | ||||
| Occludin | Occludin | Forward: CCCGACGATGAGTTCCAG | cited by Ref. [16] | 56 | 
| Reverse: GAGGCCACGCATACGAAG | ||||
| Glucose metabolism | ||||
| Glucose-6-phosphatase | G6Pase | Forward: ATGCTTTCAGCTCACCGTCA | cited by Ref. [17] | 58 | 
| Reverse: TGTCGATGGGGACAGTTTGG | ||||
| Pyruvate kinase | PK | Forward: GCAGAGACGGAGCGTGATAA | cited by Ref. [18] | 58 | 
| Reverse: TTGCGACTTCCCAGAATCCC | ||||
| Phosphoenolpyruvate carboxykinase | PEPCK | Forward: CTGGCCTTGTAACCCAGAGA | cited by Ref. [17] | 57 | 
| Reverse: CACCATAACCACTGCCGAAG | ||||
| Glucokinase | GK | Forward: TGTGGTTGCCATGGTGAATG | cited by Ref. [17] | 56 | 
| Reverse: CTCTCCTTCAACCAGCTCCA | ||||
| Glucose transporter 2 | GLUT2 | Forward: AGATGGGCACACCTTACCT | cited by Ref. [17] | 56 | 
| Reverse: CAGACCACAGTACAGTCCCA | ||||
| Lipid metabolism | ||||
| Carnitine palmitoyltransferase 1 | CPT1 | Forward: TTTACGACGGACGGTTGC | MW048769 | 57 | 
| Reverse: TGCTTGTTCTTCCCACGAC | ||||
| Acetyl-CoA carboxylase 1 | ACC1 | Forward: AGCCTCGGCACCACATAC | MW053372 | 56 | 
| Reverse: GACCCTGAGAATCCAGAACC | ||||
| Acyl-coenzyme A oxidase | ACOX | Forward: AGGCTGGTCTGCTAAGTGTTC | MW053374 | 56 | 
| Reverse: CATCTCATCGCGGTAGTCAA | ||||
| Sterol-regulatory-element-binding protein 1 | SREBP-1 | Forward: GAGAAACTGCCCATCAATC | MW048767 | 54 | 
| Reverse: CCTCAACACTGCCGACTTA | ||||
| Fatty acid synthetase | FAS | Forward: AGAGCAACTACGGGTTCGC | MK986683 | 58 | 
| Reverse: ACCTATCCAGCACCTCCAAAC | ||||
| Fatty acid transport protein | FATP | Forward: ATTCGGCGTATGTATCAGG | MK986680 | 60 | 
| Reverse: CGAGCGTAAGAGGGAAGA | ||||
| Glycerol-3-phosphate acyltransferase | Gpat | Forward: ATCTGAGTACAACGCTCCC | cited by Ref. [19] | 55 | 
| Reverse: TCATCCAGTTTACGACGAAT | ||||
| Apolipoprotein A-1 | ApoA1 | Forward: TGAGAAGCTGACCAAGGACAT | cited by Ref. [20] | 57 | 
| Reverse: GTTCGGACTTCCTCCATGTG | ||||
| Fatty acid translocase | FAT/CD36 | Forward: GGTCAACCCAGATAACCAGTG | cited by Ref. [19] | 57 | 
| Reverse: CTCATCAAAGTTCGGATTCAGT | ||||
| Housekeeping gene | ||||
| β-actin | β-actin | Forward: CCAGCAGATGTGGATTAGCA | KP185128 | 56 | 
| Reverse: CAGTTTGAGTCGGCGTGA | ||||
| Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. | 
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, H.; Yuan, X.; Xie, M.; Gao, J.; Xiong, Z.; Song, R.; Xie, Z.; Ou, D. The Impact of Niclosamide Exposure on the Activity of Antioxidant Enzymes and the Expression of Glucose and Lipid Metabolism Genes in Black Carp (Mylopharyngodon piceus). Genes 2023, 14, 2196. https://doi.org/10.3390/genes14122196
Wu H, Yuan X, Xie M, Gao J, Xiong Z, Song R, Xie Z, Ou D. The Impact of Niclosamide Exposure on the Activity of Antioxidant Enzymes and the Expression of Glucose and Lipid Metabolism Genes in Black Carp (Mylopharyngodon piceus). Genes. 2023; 14(12):2196. https://doi.org/10.3390/genes14122196
Chicago/Turabian StyleWu, Hao, Xiping Yuan, Min Xie, Jinwei Gao, Zhenzhen Xiong, Rui Song, Zhonggui Xie, and Dongsheng Ou. 2023. "The Impact of Niclosamide Exposure on the Activity of Antioxidant Enzymes and the Expression of Glucose and Lipid Metabolism Genes in Black Carp (Mylopharyngodon piceus)" Genes 14, no. 12: 2196. https://doi.org/10.3390/genes14122196
APA StyleWu, H., Yuan, X., Xie, M., Gao, J., Xiong, Z., Song, R., Xie, Z., & Ou, D. (2023). The Impact of Niclosamide Exposure on the Activity of Antioxidant Enzymes and the Expression of Glucose and Lipid Metabolism Genes in Black Carp (Mylopharyngodon piceus). Genes, 14(12), 2196. https://doi.org/10.3390/genes14122196
 
         
                                                


 
       