Investigation of Dombrock Blood Group Alleles and Genotypes among Saudi Blood Donors in Southwestern Saudi Arabia
Abstract
:1. Introduction
2. Materials and Methods
2.1. Blood Samples
2.2. PCR and Sequencing
2.3. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- International Society of Blood Transfusion. Red Cell Immunogenetics and Blood Group Terminology. 2015. Available online: http://www.isbtweb.org (accessed on 26 March 2022).
- Swanson, J.; Polesky, H.F.; Tippett, P.; Sanger, R.A. “New” blood group antigen, Doa. Nature 1965, 206, 313. [Google Scholar] [CrossRef]
- Molthan, L.; Crawford, M.N.; Tippett, P. Enlargement of the Dombrock blood group system: The finding of anti-Dob. Vox Sang. 1973, 24, 382–384. [Google Scholar] [CrossRef] [PubMed]
- Lomas-Francis, C.; Reid, M.E. The Dombrock blood group system: A review. Immunohematology 2010, 26, 71–78. [Google Scholar] [CrossRef]
- Swanson, J.; Zweber, M.; Polesky, H.F. A new public antigenic determinant Gya (Gregory). Transfusion 1967, 7, 304–306. [Google Scholar] [CrossRef]
- Schmidt, R.P.; Frank, S.; Baugh, M. New antibodies to high incidence antigenic determinants (anti-so anti-el anti-HY and anti-DP). Transfusion 1967, 7, 386. [Google Scholar]
- Jensen, L.; Scott, E.P.; Marsh, W.L.; MacIlroy, M.; Rosenfield, R.E.; Brancato, P.; Fay, A.F. Anti-Joa: An antibody defining a high-frequency erythrocyte antigen. Transfusion 1972, 12, 322–324. [Google Scholar] [CrossRef]
- Banks, J.A.; Hemming, N.; Poole, J. Evidence that the Gya, Hy and Joa antigens belong to the Dombrock blood group system. Vox Sang. 1995, 68, 177–182. [Google Scholar] [CrossRef]
- Spring, F.A.; Reid, M.E. Evidence that the human blood group antigens Gya and Hy are carried on a novel glycosylphosphatidylinositol-linked erythrocyte membrane glycoprotein. Vox Sang. 1991, 60, 53–59. [Google Scholar] [CrossRef]
- Telen, M.J.; Rosse, W.F.; Parker, C.J.; Moulds, M.K.; Moulds, J.J. Evidence that several high-frequency human blood group antigens reside on phosphatidylinositol-linked erythrocyte membrane proteins. Blood 1990, 75, 1404–1407. [Google Scholar] [CrossRef]
- Westhoff, C.M. Blood group genotyping. Blood 2019, 133, 1814–1820. [Google Scholar] [CrossRef] [Green Version]
- Kruskall, M.S.; Greene, M.J.; Strycharz, D.M.; Getman, E.M.; Cawley, A. Acute hemolytic transfusion reaction due to anti-Dombrocka (Doa). Transfusion 1986, 26, 545. [Google Scholar]
- Judd, W.J.; Steiner, E.A. Multiple hemolytic transfusion reactions caused by anti-Doa. Transfusion 1991, 31, 477–478. [Google Scholar] [CrossRef]
- Moheng, M.C.; McCarthy, P.; Pierce, S.R. Anti-Dob implicated as the cause of a delayed hemolytic transfusion reaction. Transfusion 1985, 25, 44–46. [Google Scholar] [CrossRef]
- Halverson, G.; Shanahan, E.; Santiago, I.; Mabile, R.; Thurrell, T.; Strupp, A.M.; Wolf, C.F.; Spruell, P.; Moulds, M.K. The first reported case of anti-Dob causing an acute hemolytic transfusion reaction. Vox Sang. 1994, 66, 206–209. [Google Scholar]
- Crottet, S.L. Clinical significance of antibodies to antigens in the Scianna, Dombrock, Colton, Landsteiner-Weiner, Chido/Rodgers, H, Kx, Cromer, Gerbich, knops, Indian, and ok blood group systems. Immunohematology 2018, 34, 103–108. [Google Scholar] [CrossRef]
- Gubin, A.N.; Njoroge, J.M.; Wojda, U.; Pack, S.D.; Rios, M.; Reid, M.E.; Miller, J.L. Identification of the Dombrock blood group glycoprotein as a polymorphic member of the ADP-ribosyltransferase gene family. Blood 2000, 96, 2621–2627. [Google Scholar] [CrossRef]
- The 1000 Genomes Project Consortium. A global reference for human genetic variation. Nature 2015, 526, 68–74. [Google Scholar] [CrossRef] [Green Version]
- Nakajima, H.; Moulds, J.J. Doa (Dombrock) blood group antigen in the Japanese. Vox Sang. 1980, 38, 294–296. [Google Scholar] [CrossRef]
- Chandanayingyong, D.; Sasaki, T.T.; Greenwalt, T.J. Blood groups of the Thais. Transfusion 1967, 7, 269–276. [Google Scholar] [CrossRef]
- Chapel-Fernandes, S.; Movia, C.; Jordier, F.; Durousseau de Coulgeans, C.; Chiaroni, J.; Bailly, P. DO/ART4 gene sequencing in sub-Saharan cohorts and African migrants: Useful data describing the diversity and spreading of rare variants. Transfusion 2019, 59, 3755–3766. [Google Scholar] [CrossRef]
- Alsaeed, E.S.; Farhat, G.N.; Assiri, A.M.; Memish, Z.; Ahmed, E.M.; Saeedi, M.Y.; Al-Dossary, M.F.; Bashawri, H. Distribution of hemoglobinopathy disorders in Saudi Arabia based on data from the premarital screening and genetic counseling program, 2011–2015. J. Epidemiol. Glob. Health 2018, 7 (Suppl. 1), S41–S47. [Google Scholar] [CrossRef] [PubMed]
- Halawani, A.J.; Mobarki, A.A.; Arjan, A.H.; Saboor, M.; Hamali, H.A.; Dobie, G.; Alsharif, K.F. Red Cell Alloimmunization and Autoimmunization Among Sickle Cell Disease and Thalassemia Patients in Jazan Province, Saudi Arabia. Int. J. Gen. Med. 2022, 15, 4093–4100. [Google Scholar] [CrossRef] [PubMed]
- Halawani, A.J.; Arjan, A.H. ABO, RH, and KEL1 antigens, phenotypes and haplotypes in Southwestern Saudi Arabia. Clin. Lab. 2021, 67, 344–348. [Google Scholar] [CrossRef] [PubMed]
- Halawani, A.J.; Saboor, M.; Abu-Tawil, H.I.; Mahzari, A.A.; Mansor, A.S.; Bantun, F. Prevalence of Duffy blood group antigens and phenotypes among Saudi blood donors in Southwestern Saudi Arabia. Clin. Lab. 2021, 67, 173–177. [Google Scholar] [CrossRef] [PubMed]
- Halawani, A.J.; Habibullah, M.M.; Dobie, G.; Alhazmi, A.; Bantun, F.; Nahari, M.H.; Dawmary, I.; Abu-Tawil, H.I. Frequencies of MNS blood group antigens and phenotypes in Southwestern Saudi Arabia. Int. J. Gen. Med. 2021, 14, 9315–9319. [Google Scholar] [CrossRef]
- Halawani, A.J.; Saboor, M.; Abu-Tawil, H.I.; Alhazmy, A.Y.; Mashlawi, W.Q.; Bantun, F.; Mansor, A.S. The frequencies of Kidd blood group antigens and phenotypes among Saudi blood donors in Southwestern Saudi Arabia. Saudi J. Biol. Sci. 2022, 29, 251–254. [Google Scholar] [CrossRef]
- Reid, M.E. Complexities of the Dombrock blood group system revealed. Transfusion 2005, 45, 92S–99S. [Google Scholar] [CrossRef]
- Yazdanbakhsh, K.; Ware, R.E.; Noizat-Pirenne, F. Red blood cell alloimmunization in sickle cell disease: Pathophysiology, risk factors, and transfusion management. Blood 2012, 120, 528–537. [Google Scholar] [CrossRef] [Green Version]
- Reid, M.E. DNA analysis to find rare blood donors when antisera is not available. Vox Sang. 2002, 83 (Suppl. 1), 91–93. [Google Scholar] [CrossRef]
- Denomme, G.A.; Johnson, S.T.; Pietz, B.C. Mass-scale red cell genotyping of blood donors. Transfus. Apher. Sci. 2011, 44, 93–99. [Google Scholar] [CrossRef]
- Veldhuisen, B.; van der Schoot, C.E.; de Haas, M. Blood group genotyping: From patient to high-throughput donor screening. Vox Sang. 2009, 97, 198–206. [Google Scholar] [CrossRef] [PubMed]
- Reid, M.E.; Lomas-Francis, C.; Olsson, M.L. DO—Dombrock blood group system. In The Blood Group Antigen FactsBook, 3rd ed.; Academic Press: Oxford, UK, 2012; pp. 439–455. [Google Scholar]
Primer | 5′ to 3′ Sequence | Product Size (bp) | Chromosomal Location |
---|---|---|---|
Do-rs11276-F | ACACACGCTGTGGCTATTTTG | 538 | chr12:14840409-14840946 |
Do-rs11276-R | GTGATCCTGAGTGGCCTCAAT |
Allele | Observation (n) | Frequency (%) |
---|---|---|
DO*A | 122 | 40.67 |
DO*B | 178 | 59.33 |
DO Allele | Genotype | Predicted Phenotype | Observation (n) | Frequency (%) n = 150 |
---|---|---|---|---|
DO*A | DO*A/DO*A | Do(a+b−) | 20 | 13.33 |
DO*A and DO*B | DO*A/DO*B | Do(a+b+) | 82 | 54.67 |
DO*B | DO*B/DO*B | Do(a−b+) | 48 | 32 |
Population | DO*A/DO*A | DO*A/DO*B | DO*B/DO*B | p-Values |
---|---|---|---|---|
Southwestern Saudis (Current study) | 13.33 | 54.67 | 32 | - |
African [4] | 11 | 44 | 45 | 0.17 (>0.05) |
Japanese [19] | 1.50 | 22 | 76.50 | 0.00 (<0.01) ** |
Thai [20] | 0.50 | 13 | 86.50 | 0.00 (<0.01) ** |
Caucasian [3] | 16 | 46 | 31 | 0.65 (>0.05) |
ASW | 9.80 | 42.60 | 47.50 | 0.08 (>0.05) |
PUR | 18.30 | 50 | 31.70 | 0.51 (>0.05) |
CHS | 0.00 | 18.10 | 81.90 | 0.00 (<0.01) ** |
FIN | 8.10 | 38.40 | 53.50 | 0.01 (<0.05) * |
BEB | 11.60 | 52.30 | 36 | 0.84 (>0.05) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Halawani, A.J.; Mansor, A.S.; Assaggaf, H.M.; Almasmoum, H.A.; Abu-Tawil, H.I.; Alsharif, K.F.; Dobie, G.; Habibullah, M.M. Investigation of Dombrock Blood Group Alleles and Genotypes among Saudi Blood Donors in Southwestern Saudi Arabia. Genes 2022, 13, 1079. https://doi.org/10.3390/genes13061079
Halawani AJ, Mansor AS, Assaggaf HM, Almasmoum HA, Abu-Tawil HI, Alsharif KF, Dobie G, Habibullah MM. Investigation of Dombrock Blood Group Alleles and Genotypes among Saudi Blood Donors in Southwestern Saudi Arabia. Genes. 2022; 13(6):1079. https://doi.org/10.3390/genes13061079
Chicago/Turabian StyleHalawani, Amr J., Abdullah S. Mansor, Hamza M. Assaggaf, Hibah A. Almasmoum, Hisham I. Abu-Tawil, Khalaf F. Alsharif, Gasim Dobie, and Mahmoud M. Habibullah. 2022. "Investigation of Dombrock Blood Group Alleles and Genotypes among Saudi Blood Donors in Southwestern Saudi Arabia" Genes 13, no. 6: 1079. https://doi.org/10.3390/genes13061079
APA StyleHalawani, A. J., Mansor, A. S., Assaggaf, H. M., Almasmoum, H. A., Abu-Tawil, H. I., Alsharif, K. F., Dobie, G., & Habibullah, M. M. (2022). Investigation of Dombrock Blood Group Alleles and Genotypes among Saudi Blood Donors in Southwestern Saudi Arabia. Genes, 13(6), 1079. https://doi.org/10.3390/genes13061079