MicroRNA-132-3p, Downregulated in Myeloid Angiogenic Cells from Hereditary Hemorrhagic Telangiectasia Patients, Is Enriched in the TGFβ and PI3K/AKT Signalling Pathways
Abstract
:1. Introduction
2. Methodology
2.1. Patient Recruitment and Ethics Statement
2.2. MAC Cell Culture
2.3. Total RNA Isolation from MACs
2.4. MiRNA Microarray
2.5. Enrichment Analysis of Dysregulated MiRNAs
2.6. RT-qPCR for MiRNA Validation
2.7. Enrichment Analysis of MiR-132-3p
2.8. Statistical Analyses
3. Results
3.1. Study Participants
3.2. HHT MACs Have a Dysregulated MiRNA Profile Enriched in Pathways Involved in HHT Pathogenesis
3.3. MiR-132-3p Is Significantly Decreased in HHT MACs
3.4. MiR-132-3p Is Significantly Enriched in the TFGβ and PI3K/AKT Signalling Pathways
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Govani, F.S.; Shovlin, C.L. Hereditary Haemorrhagic Telangiectasia: A Clinical and Scientific Review. Eur. J. Hum. Genet. 2009, 17, 860–871. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guttmacher, A.E.; Marchuk, D.A.; White, R.I. Hereditary Hemorrhagic Telangiectasia. N. Engl. J. Med. 1995, 333, 918–924. [Google Scholar] [CrossRef] [PubMed]
- Shovlin, C.L. Hereditary Haemorrhagic Telangiectasia: Pathophysiology, Diagnosis and Treatment. Blood Rev. 2010, 24, 203–219. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zarrabeitia, R.; Albiñana, V.; Salcedo, M.; Señaris-Gonzalez, B.; Fernandez-Forcelledo, J.L.; Botella, L.M. A Review on Clinical Management and Pharmacological Therapy on Hereditary Haemorrhagic Telangiectasia (HHT). Curr. Vasc. Pharmacol. 2010, 8, 473–481. [Google Scholar] [CrossRef] [Green Version]
- Dupuis-Girod, S.; Bailly, S.; Plauchu, H. Hereditary Hemorrhagic Telangiectasia: From Molecular Biology to Patient Care. J. Thromb. Haemost. 2010, 8, 1447–1456. [Google Scholar] [CrossRef]
- McAllister, K.A.; Grogg, K.M.; Johnson, D.W.; Gallione, C.J.; Baldwin, M.A.; Jackson, C.E.; Helmbold, E.A.; Markel, D.S.; McKinnon, W.C.; Murrell, J. Endoglin, a TGF-beta Binding Protein of Endothelial Cells, Is the Gene for Hereditary Haemorrhagic Telangiectasia Type 1. Nat. Genet. 1994, 8, 345–351. [Google Scholar] [CrossRef] [Green Version]
- Johnson, D.W.; Berg, J.N.; Baldwin, M.A.; Gallione, C.J.; Marondel, I.; Yoon, S.J.; Stenzel, T.T.; Speer, M.; Pericak-Vance, M.A.; Diamond, A.; et al. Mutations in the Activin Receptor-Like Kinase 1 Gene in Hereditary Haemorrhagic Telangiectasia Type 2. Nat. Genet. 1996, 13, 189–195. [Google Scholar] [CrossRef]
- Gallione, C.J.; Repetto, G.M.; Legius, E.; Rustgi, A.K.; Schelley, S.L.; Tejpar, S.; Mitchell, G.; Drouin, É.; Westermann, C.J.J.; Marchuk, D.A. A Combined Syndrome of Juvenile Polyposis and Hereditary Haemorrhagic Telangiectasia Associated with Mutations in MADH4 (SMAD4). Lancet 2004, 363, 852–859. [Google Scholar] [CrossRef]
- Schulte, C.; Geisthoff, U.; Lux, A.; Kupka, S.; Zenner, H.P.; Blin, N.; Pfister, M. High Frequency of ENG and ALK1/ACVRL1 Mutations in German HHT Patients. Hum. Mutat. 2005, 25, 595. [Google Scholar] [CrossRef]
- Lesca, G.; Burnichon, N.; Raux, G.; Tosi, M.; Pinson, S.; Marion, M.J.; Babin, E.; Gilbert-Dussardier, B.; Rivière, S.; Goizet, C.; et al. Distribution of ENG and ACVRL1 (ALK1) Mutations in French HHT Patients. Hum. Mutat. 2006, 27, 598. [Google Scholar] [CrossRef]
- Sánchez-Martínez, R.; Iriarte, A.; Mora-Luján, J.M.; Patier, J.L.; López-Wolf, D.; Ojeda, A.; Torralba, M.A.; Juyol, M.C.; Gil, R.; Anõn, S.; et al. Current HHT Genetic Overview in Spain and Its Phenotypic Correlation: Data from RiHHTa Registry. Orphanet J. Rare Dis. 2020, 15, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Cunha, S.I.; Magnusson, P.U.; Dejana, E.; Lampugnani, M.G. Deregulated TGF-β/BMP Signaling in Vascular Malformations. Circ. Res. 2017, 121, 981–999. [Google Scholar] [CrossRef] [PubMed]
- Tual-Chalot, S.; Oh, S.P.; Arthur, H.M. Mouse Models of Hereditary Hemorrhagic Telangiectasia: Recent Advances and Future Challenges. Front. Genet. 2015, 6, 25. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Snellings, D.A.; Gallione, C.J.; Clark, D.S.; Vozoris, N.T.; Faughnan, M.E.; Marchuk, D.A. Somatic Mutations in Vascular Malformations of Hereditary Hemorrhagic Telangiectasia Result in Bi-Allelic Loss of ENG or ACVRL1. Am. J. Hum. Genet. 2019, 105, 894–906. [Google Scholar] [CrossRef]
- Çakmak, H.A.; Demir, M. MicroRNA and Cardiovascular Diseases. Balk. Med. J. 2020, 37, 60–71. [Google Scholar] [CrossRef]
- Saliminejad, K.; Khorram Khorshid, H.R.; Soleymani Fard, S.; Ghaffari, S.H. An Overview of MicroRNAs: Biology, Functions, Therapeutics, and Analysis Methods. J. Cell. Physiol. 2019, 234, 5451–5465. [Google Scholar] [CrossRef]
- Lee, R.C.; Feinbaum, R.L.; Ambros, V. The C. Elegans Heterochronic Gene Lin-4 Encodes Small RNAs with Antisense Complementarity to Lin-14. Cell 1993, 75, 843–854. [Google Scholar] [CrossRef]
- Wightman, B.; Ha, I.; Ruvkun, G. Posttranscriptional Regulation of the Heterochronic Gene Lin-14 by Lin-4 Mediates Temporal Pattern Formation in C. Elegans. Cell 1993, 75, 855–862. [Google Scholar] [CrossRef]
- Hammond, S.M. An Overview of MicroRNAs. Adv. Drug Deliv. Rev. 2015, 87, 3–14. [Google Scholar] [CrossRef] [Green Version]
- Rajewsky, N.; Socci, N.D. Computational Identification of MicroRNA Targets. Dev. Biol. 2004, 267, 529–535. [Google Scholar] [CrossRef]
- Garzon, R.; Fabbri, M.; Cimmino, A.; Calin, G.A.; Croce, C.M. MicroRNA Expression and Function in Cancer. Trends Mol. Med. 2006, 12, 580–587. [Google Scholar] [CrossRef] [PubMed]
- Ha, T.Y. MicroRNAs in Human Diseases: From Cancer to Cardiovascular Disease. Immune Netw. 2011, 11, 135–154. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sohel, M.M.H. Circulating MicroRNAs as Biomarkers in Cancer Diagnosis. Life Sci. 2020, 248, 117473. [Google Scholar] [CrossRef] [PubMed]
- Cannavicci, A.; Zhang, Q.; Dai, S.; Faughnan, M.E.; Kutryk, M.J.B. Decreased Levels of MiR-28-5p and MiR-361-3p and Increased Levels of Insulin-like Growth Factor 1 MRNA in Mononuclear Cells from Patients with Hereditary Hemorrhagic Telangiectasia. Can. J. Physiol. Pharmacol. 2019, 97, 562–569. [Google Scholar] [CrossRef]
- Zhang, Q.; Kandic, I.; Faughnan, M.E.; Kutryk, M.J. Elevated Circulating MicroRNA-210 Levels in Patients with Hereditary Hemorrhagic Telangiectasia and Pulmonary Arteriovenous Malformations: A Potential New Biomarker. Biomarkers 2013, 18, 23–29. [Google Scholar] [CrossRef]
- Cannavicci, A.; Zhang, Q.; Kutryk, M.J.B. Non-Coding RNAs and Hereditary Hemorrhagic Telangiectasia. J. Clin. Med. 2020, 9, 3333. [Google Scholar] [CrossRef]
- Tabruyn, S.P.; Hansen, S.; Ojeda-Fernández, M.L.; Bovy, N.; Zarrabeitia, R.; Recio-Poveda, L.; Bernabéu, C.; Martial, J.A.; Botella, L.M.; Struman, I. MiR-205 Is Downregulated in Hereditary Hemorrhagic Telangiectasia and Impairs TGF-beta Signaling Pathways in Endothelial Cells. Angiogenesis 2013, 16, 877–887. [Google Scholar] [CrossRef] [Green Version]
- Ruiz-Llorente, L.; Albiñana, V.; Botella, L.M.; Bernabeu, C. Differential Expression of Circulating Plasma MiRNA-370 and MiRNA-10a from Patients with Hereditary Hemorrhagic Telangiectasia. J. Clin. Med. 2020, 9, 2855. [Google Scholar] [CrossRef]
- Medina, R.J.; Barber, C.L.; Sabatier, F.; Dignat-George, F.; Melero-Martin, J.M.; Khosrotehrani, K.; Ohneda, O.; Randi, A.M.; Chan, J.K.Y.; Yamaguchi, T.; et al. Endothelial Progenitors: A Consensus Statement on Nomenclature. Stem Cells Transl. Med. 2017, 6, 1316–1320. [Google Scholar] [CrossRef]
- Asahara, T.; Murohara, T.; Sullivan, A.; Silver, M.; van Der Zee, R.; Li, T.; Witzenbichler, B.; Schatteman, G.; Isner, J. Isolation of Putative Progenitor Endothelial Cells for Angiogenesis. Science 1997, 275, 964–967. [Google Scholar] [CrossRef]
- Asahara, T.; Masuda, H.; Takahashi, T.; Kalka, C.; Pastore, C.; Silver, M.; Kearne, M.; Magner, M.; Isner, J.M. Bone Marrow Origin of Endothelial Progenitor Cells Responsible for Postnatal Vasculogenesis in Physiological and Pathological Neovascularization. Circ. Res. 1999, 85, 221–228. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Takahashi, T.; Kalka, C.; Masuda, H.; Chen, D.; Silver, M.; Kearney, M.; Magner, M.; Isner, J.M.; Asahara, T. Ischemia-and Cytokine-Induced Mobilization of Bone Marrow-Derived Endothelial Progenitor Cells for Neovascularization. Nat. Med. 1999, 5, 434–438. [Google Scholar] [CrossRef] [PubMed]
- Fadini, G.P.; Losordo, D.; Dimmeler, S. Critical Reevaluation of Endothelial Progenitor Cell Phenotypes for Therapeutic and Diagnostic Use. Circ. Res. 2012, 110, 624–637. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kalka, C.; Masuda, H.; Takahashi, T.; Kalka-Moll, W.M.; Silver, M.; Kearney, M.; Li, T.; Isner, J.M.; Asahara, T. Transplantation of Ex Vivo Expanded Endothelial Progenitor Cells for Therapeutic Neovascularization. Proc. Natl. Acad. Sci. USA 2000, 97, 3422–3427. [Google Scholar] [CrossRef]
- Urbich, C.; Heeschen, C.; Aicher, A.; Dernbach, E.; Zeiher, A.M.; Dimmeler, S. Relevance of Monocytic Features for Neovascularization Capacity of Circulating Endothelial Progenitor Cells. Circulation 2003, 108, 2511–2516. [Google Scholar] [CrossRef] [Green Version]
- Tepper, O.M.; Galiano, R.D.; Capla, J.M.; Kalka, C.; Gagne, P.J.; Jacobowitz, G.R.; Levine, J.P.; Gurtner, G.C. Human Endothelial Progenitor Cells from Type II Diabetics Exhibit Impaired Proliferation, Adhesion, and Incorporation into Vascular Structures. Circulation 2002, 106, 2781–2786. [Google Scholar] [CrossRef] [Green Version]
- Vasa, M.; Fichtlscherer, S.; Aicher, A.; Adler, K.; Urbich, C.; Martin, H.; Zeiher, A.M.; Dimmeler, S. Number and Migratory Activity of Circulating Endothelial Progenitor Cells Inversely Correlate with Risk Factors for Coronary Artery Disease. Circ. Res. 2001, 89, e1–e7. [Google Scholar] [CrossRef] [Green Version]
- Ward, M.R.; Thompson, K.A.; Isaac, K.; Vecchiarelli, J.; Zhang, Q.; Stewart, D.J.; Kutryk, M.J. Nitric Oxide Synthase Gene Transfer Restores Activity of Circulating Angiogenic Cells from Patients with Coronary Artery Disease. Mol. Ther. 2011, 19, 1323–1330. [Google Scholar] [CrossRef]
- Urbich, C.; Aicher, A.; Heeschen, C.; Dernbach, E.; Hofmann, W.K.; Zeiher, A.M.; Dimmeler, S. Soluble Factors Released by Endothelial Progenitor Cells Promote Migration of Endothelial Cells and Cardiac Resident Progenitor Cells. J. Mol. Cell. Cardiol. 2005, 39, 733–742. [Google Scholar] [CrossRef]
- Medina, R.J.; O’Neill, C.L.; O’Doherty, T.M.; Knott, H.; Guduric-Fuchs, J.; Gardiner, T.A.; Stitt, A.W. Myeloid Angiogenic Cells Act as Alternative M2 Macrophages and Modulate Angiogenesis through Interleukin-8. Curr. Mol. Med. 2011, 17, 1045–1055. [Google Scholar] [CrossRef] [Green Version]
- van Laake, L.W.; van den Driesche, S.; Post, S.; Feijen, A.; Jansen, M.A.; Driessens, M.H.; Mager, J.J.; Snijder, R.J.; Westermann, C.J.J.; Doevendans, P.A.; et al. Endoglin Has a Crucial Role in Blood Cell-Mediated Vascular Repair. Circulation 2006, 114, 2288–2297. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rodríguez-Carrio, J.; López, P.; Suárez, A. EPC Dysfunction and Immune Networks: Translating Opportunities for Clinical Setting in Personalized Medicine. Curr. Med. Chem. 2017, 25, 4497–4506. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Zucco, L.; Toshner, M.; Morrell, N.W.; Granton, J.; Stewart, D.J.; Kutryk, M.J.B. Myeloid Angiogenic Cells Exhibit Impaired Migration, Reduced Expression of Endothelial Markers, and Increased Apoptosis in Idiopathic Pulmonary Arterial Hypertension. Can. J. Physiol. Pharmacol. 2019, 97, 306–312. [Google Scholar] [CrossRef] [PubMed]
- Zucco, L.; Zhang, Q.; Kuliszewski, M.A.; Kandic, I.; Faughnan, M.E.; Stewart, D.J.; Kutryk, M.J. Circulating Angiogenic Cell Dysfunction in Patients with Hereditary Hemorrhagic Telangiectasia. PLoS ONE 2014, 9, e89927. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shovlin, C.L.; Guttmacher, A.E.; Buscarini, E.; Faughnan, M.E.; Hyland, R.H.; Westermann, C.J.J.; Kjeldsen, A.D.; Plauchu, H. Diagnostic Criteria for Hereditary Hemorrhagic Telangiectasia (Rendu-Osler-Weber Syndrome). Am. J. Med. Genet. 2000, 91, 66–67. [Google Scholar] [CrossRef]
- Verma, S.; Kuliszewski, M.A.; Li, S.H.; Szmitko, P.E.; Zucco, L.; Wang, C.H.; Badiwala, M.V.; Mickle, D.A.G.; Weisel, R.D.; Fedak, P.W.M.; et al. C-Reactive Protein Attenuates Endothelial Progenitor Cell Survival, Differentiation, and Function: Further Evidence of a Mechanistic Link between C-Reactive Protein and Cardiovascular Disease. Circulation 2004, 109, 2058–2067. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Q.; Kandic, I.; Barfield, J.T.; Kutryk, M.J. Coculture with Late, but Not Early, Human Endothelial Progenitor Cells up Regulates IL-1β Expression in THP-1 Monocytic Cells in a Paracrine Manner. Stem Cells Int. 2013, 2013, 859643. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Q.; Cannavicci, A.; Dai, S.C.; Wang, C.; Kutryk, M.J.B. MicroRNA Profiling of Human Myeloid Angiogenic Cells Derived from Peripheral Blood Mononuclear Cells. Biochem. Cell Biol. 2020, 98, 203–207. [Google Scholar] [CrossRef]
- Andersen, C.L.; Jensen, J.L.; Ørntoft, T.F. Normalization of Real-Time Quantitative Reverse Transcription-PCR Data: A Model-Based Variance Estimation Approach to Identify Genes Suited for Normalization, Applied to Bladder and Colon Cancer Data Sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef] [Green Version]
- Liu, T.; Cheng, W.; Gao, Y.; Wang, H.; Liu, Z. Microarray Analysis of MicroRNA Expression Patterns in the Semen of Infertile Men with Semen Abnormalities. Mol. Med. Rep. 2012, 6, 535–542. [Google Scholar] [CrossRef] [Green Version]
- Sokolov, M.V.; Panyutin, I.V.; Neumann, R.D. Unraveling the Global MicroRNAome Responses to Ionizing Radiation in Human Embryonic Stem Cells. PLoS ONE 2012, 7, e31028. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vlachos, I.S.; Zagganas, K.; Paraskevopoulou, M.D.; Georgakilas, G.; Karagkouni, D.; Vergoulis, T.; Dalamagas, T.; Hatzigeorgiou, A.G. DIANA-MiRPath v3.0: Deciphering MicroRNA Function with Experimental Support. Nucleic Acids Res. 2015, 43, W460–W466. [Google Scholar] [CrossRef] [PubMed]
- Licursi, V.; Conte, F.; Fiscon, G.; Paci, P. MIENTURNET: An Interactive Web Tool for MicroRNA-Target Enrichment and Network-Based Analysis. BMC Bioinform. 2019, 20, 1–10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, H.Y.; Lin, Y.C.D.; Li, J.; Huang, K.Y.; Shrestha, S.; Hong, H.C.; Tang, Y.; Chen, Y.G.; Jin, C.N.; Yu, Y.; et al. MiRTarBase 2020: Updates to the Experimentally Validated MicroRNA–Target Interaction Database. Nucleic Acids Res. 2020, 48, D148–D154. [Google Scholar] [CrossRef] [Green Version]
- Snodgrass, R.O.; Chico, T.J.A.; Arthur, H.M. Hereditary Haemorrhagic Telangiectasia, an Inherited Vascular Disorder in Need of Improved Evidence-Based Pharmaceutical Interventions. Genes 2021, 12, 174. [Google Scholar] [CrossRef]
- Alsina-Sanchis, E.; Garcia-Ibanez, Y.; Figueiredo, A.M.; Riera-Domingo, C.; Figueras, A.; Matias-Guiu, X.; Casanovas, O.; Botella, L.M.; Pujana, M.A.; Riera-Mestre, A.; et al. ALK1 Loss Results in Vascular Hyperplasia in Mice and Humans through PI3K Activation. Arterioscler. Thromb. Vasc. Biol. 2018, 38, 1216–1229. [Google Scholar] [CrossRef] [Green Version]
- Iriarte, A.; Figueras, A.; Cerdà, P.; Mora, J.M.; Jucglà, A.; Penín, R.; Viñals, F.; Riera-Mestre, A. PI3K (Phosphatidylinositol 3-Kinase) Activation and Endothelial Cell Proliferation in Patients with Hemorrhagic Hereditary Telangiectasia Type 1. Cells 2019, 8, 971. [Google Scholar] [CrossRef] [Green Version]
- Ola, R.; Dubrac, A.; Han, J.; Zhang, F.; Fang, J.S.; Larrivée, B.; Lee, M.; Urarte, A.A.; Kraehling, J.R.; Genet, G.; et al. PI3 Kinase Inhibition Improves Vascular Malformations in Mouse Models of Hereditary Haemorrhagic Telangiectasia. Nat. Commun. 2016, 7, 13650. [Google Scholar] [CrossRef]
- Kim, Y.H.; Vu, P.N.; Choe, S.W.; Jeon, C.J.; Arthur, H.M.; Vary, C.P.H.; Lee, Y.J.; Paul Oh, S. Overexpression of Activin Receptor-like Kinase 1 in Endothelial Cells Suppresses Development of Arteriovenous Malformations in Mouse Models of Hereditary Hemorrhagic Telangiectasia. Circ. Res. 2020, 127, 1122–1137. [Google Scholar] [CrossRef]
- Hernandez, F.; Huether, R.; Carter, L.; Johnston, T.; Thompson, J.; Gossage, J.R.; Chao, E.; Elliott, A.M. Mutations in RASA1 and GDF2 Identified in Patients with Clinical Features of Hereditary Hemorrhagic Telangiectasia. Hum. Genome Var. 2015, 2, 15040. [Google Scholar] [CrossRef]
- Ruiz, S.; Zhao, H.; Chandakkar, P.; Papoin, J.; Choi, H.; Nomura-Kitabayashi, A.; Patel, R.; Gillen, M.; Diao, L.; Chatterjee, P.K.; et al. Correcting Smad1/5/8, MTOR, and VEGFR2 Treats Pathology in Hereditary Hemorrhagic Telangiectasia Models. J. Clin. Investig. 2020, 130, 942–957. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Park, H.; Furtado, J.; Poulet, M.; Chung, M.; Yun, S.; Lee, S.; Sessa, W.C.; Franco, C.A.; Schwartz, M.A.; Eichmann, A. Defective Flow-Migration Coupling Causes Arteriovenous Malformations in Hereditary Hemorrhagic Telangiectasia. Circulation 2021, 144, 805–822. [Google Scholar] [CrossRef] [PubMed]
- Ruiz, S.; Zhao, H.; Chandakkar, P.; Chatterjee, P.K.; Papoin, J.; Blanc, L.; Metz, C.N.; Campagne, F.; Marambaud, P. A Mouse Model of Hereditary Hemorrhagic Telangiectasia Generated by Transmammary-Delivered Immunoblocking of BMP9 and BMP10. Sci. Rep. 2016, 6, 37366. [Google Scholar] [CrossRef] [PubMed]
- Tørring, P.M.; Larsen, M.J.; Kjeldsen, A.D.; Ousager, L.B.; Tan, Q.; Brusgaard, K. Global Gene Expression Profiling of Telangiectasial Tissue from Patients with Hereditary Hemorrhagic Telangiectasia. Microvasc. Res. 2015, 99, 118–126. [Google Scholar] [CrossRef]
- Panico, A.; Tumolo, M.R.; Leo, C.G.; de Donno, A.; Grassi, T.; Bagordo, F.; Serio, F.; Idolo, A.; de Masi, R.; Mincarone, P.; et al. The Influence of Lifestyle Factors on MiRNA Expression and Signal Pathways: A Review. Epigenomics 2021, 13, 145–164. [Google Scholar] [CrossRef]
- Qian, Y.; Song, J.; Ouyang, Y.; Han, Q.; Chen, W.; Zhao, X.; Xie, Y.; Chen, Y.; Yuan, W.; Fan, C. Advances in Roles of MiR-132 in the Nervous System. Front. Pharmacol. 2017, 8, 770. [Google Scholar] [CrossRef]
- Rafat, M.; Moraghebi, M.; Afsa, M.; Malekzadeh, K. The Outstanding Role of MiR-132-3p in Carcinogenesis of Solid Tumors. Hum. Cell 2021, 34, 1051–1065. [Google Scholar] [CrossRef]
- Li, X.; Li, D.; Wikstrom, J.D.; Pivarcsi, A.; Sonkoly, E.; Ståhle, M.; Landén, N.X. MicroRNA-132 Promotes Fibroblast Migration via Regulating RAS P21 Protein Activator 1 in Skin Wound Healing. Sci. Rep. 2017, 7, 7797. [Google Scholar] [CrossRef] [Green Version]
- Wang, Z.H.; Zhang, Q.S.; Duan, Y.L.; Zhang, J.L.; Li, G.F.; Zheng, D.L. TGF-β Induced MiR-132 Enhances the Activation of TGF-β Signaling through Inhibiting SMAD7 Expression in Glioma Cells. Biochem. Biophys. Res. Commun. 2015, 463, 187–192. [Google Scholar] [CrossRef]
- Li, D.; Wang, A.; Liu, X.; Meisgen, F.; Grünler, J.; Botusan, I.R.; Narayanan, S.; Erikci, E.; Li, X.; Blomqvist, L.; et al. MicroRNA-132 Enhances Transition from Inflammation to Proliferation during Wound Healing. J. Clin. Investig. 2015, 125, 3008–3026. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.; Li, Y.; Wang, Q.; Su, B.; Xu, H.; Sun, Y.; Sun, P.; Li, R.; Peng, X.; Cai, J. Role of RASA1 in Cancer: A Review and Update (Review). Oncol. Rep. 2020, 44, 2386–2396. [Google Scholar] [CrossRef] [PubMed]
- Anand, S.; Majeti, B.K.; Acevedo, L.M.; Murphy, E.A.; Mukthavaram, R.; Scheppke, L.; Huang, M.; Shields, D.J.; Lindquist, J.N.; Lapinski, P.E.; et al. MicroRNA-132-Mediated Loss of P120RasGAP Activates the Endothelium to Facilitate Pathological Angiogenesis. Nat. Med. 2010, 16, 909–914. [Google Scholar] [CrossRef] [PubMed]
- Devalliere, J.; Chang, W.G.; Andrejecsk, J.W.; Abrahimi, P.; Cheng, C.J.; Jane-wit, D.; Saltzman, W.M.; Pober, J.S. Sustained Delivery of Proangiogenic MicroRNA-132 by Nanoparticle Transfection Improves Endothelial Cell Transplantation. FASEB J. 2014, 28, 908–922. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lei, Z.; van Mil, A.; Brandt, M.M.; Grundmann, S.; Hoefer, I.; Smits, M.; el Azzouzi, H.; Fukao, T.; Cheng, C.; Doevendans, P.A.; et al. MicroRNA-132/212 Family Enhances Arteriogenesis after Hindlimb Ischaemia through Modulation of the Ras-MAPK Pathway. J. Cell. Mol. Med. 2015, 19, 1994–2005. [Google Scholar] [CrossRef] [Green Version]
- Ma, T.; Chen, Y.; Chen, Y.; Meng, Q.; Sun, J.; Shao, L.; Yu, Y.; Huang, H.; Hu, Y.; Yang, Z.; et al. MicroRNA-132, Delivered by Mesenchymal Stem Cell-Derived Exosomes, Promote Angiogenesis in Myocardial Infarction. Stem Cells Int. 2018, 2018, 3290372. [Google Scholar] [CrossRef] [Green Version]
- Pan, Q.; Kuang, X.; Cai, S.; Wang, X.; Du, D.; Wang, J.; Wang, Y.; Chen, Y.; Bihl, J.; Chen, Y.; et al. MiR-132-3p Priming Enhances the Effects of Mesenchymal Stromal Cell-Derived Exosomes on Ameliorating Brain Ischemic Injury. Stem Cell Res. Ther. 2020, 11, 260. [Google Scholar] [CrossRef]
HHT Patients (n = 40) | Controls (n = 22) | |
---|---|---|
Age (years) | 49.4 ± 10.6 | 46.2 ± 12.6 |
Number (%) of Females | 21 (52.5) | 12 (54.5) |
Average Female Age (years) (SD) | 50.0 ± 9.8 | 48 ± 11.2 |
Number (%) of Males | 19 (47.5) | 10 (45.5) |
Average Male Age (years) (SD) | 48.8 ± 11.7 | 44 ± 14.5 |
Mutated Genes (Number of HHT Patients): | ||
ENG | 19 (47.5) | |
ACVRL1 | 15 (37.5) | |
SMAD4 | 1 (2.5) | |
Unknown * | 5 (12.5) | |
AVMs (Number of HHT Patients): | ||
PAVM | 17 (42.5) | |
PAVM and CAVM | 3 (7.5) | |
PAVM and LVM | 2 (5) | |
CAVM LVM | 1 (2.5) 3 (7.5) | |
No AVM Unknown † | 13 (32.5) 1 (2.5) |
MicroRNAs | Accession | Assay Target Sequence | Fold Increase |
---|---|---|---|
hsa-miR-16-5p | MIMAT0000069 | UAGCAGCACGUAAAUAUUGGCG | 2.06 |
hsa-miR-19a-3p | MIMAT0000073 | UGUGCAAAUCUAUGCAAAACUGA | 1.50 |
hsa-miR-29a-3p | MIMAT0000086 | UAGCACCAUCUGAAAUCGGUUA | 1.63 |
hsa-miR-29b-3p | MIMAT0000100 | UAGCACCAUUUGAAAUCAGUGUU | 1.89 |
hsa-miR-106b-5p | MIMAT0000680 | UAAAGUGCUGACAGUGCAGAU | 1.52 |
hsa-miR-126-3p | MIMAT0000445 | UCGUACCGUGAGUAAUAAUGCG | 1.69 |
hsa-miR-132-3p | MIMAT0000426 | UAACAGUCUACAGCCAUGGUCG | 1.54 |
hsa-miR-133a-3p | MIMAT0000427 | UUUGGUCCCCUUCAACCAGCUG | 16.51 |
hsa-miR-139-5p | MIMAT0000250 | UCUACAGUGCACGUGUCUCCAG | 2.56 |
hsa-miR-145-5p | MIMAT0000437 | GUCCAGUUUUCCCAGGAAUCCCU | 1.91 |
hsa-miR-210-3p | MIMAT0000267 | CUGUGCGUGUGACAGCGGCUGA | 4.16 |
hsa-miR-218-5p | MIMAT0000275 | UUGUGCUUGAUCUAACCAUGU | 3.46 |
hsa-miR-221-3p | MIMAT0000278 | AGCUACAUUGUCUGCUGGGUUUC | 1.70 |
hsa-miR-301a-3p | MIMAT0000688 | CAGUGCAAUAGUAUUGUCAAAGC | 2.13 |
hsa-miR-155-5p | MIMAT0000646 | UUAAUGCUAAUCGUGAUAGGGGU | 1.68 |
hsa-miR-342-3p | MIMAT0000753 | UCUCACACAGAAAUCGCACCCGU | 6.92 |
hsa-miR-362-3p | MIMAT0004683 | AACACACCUAUUCAAGGAUUCA | 1.64 |
hsa-miR-424-5p | MIMAT0001341 | CAGCAGCAAUUCAUGUUUUGAA | 1.82 |
hsa-miR-454-3p | MIMAT0003885 | UAGUGCAAUAUUGCUUAUAGGGU | 1.68 |
hsa-miR-532-3p | MIMAT0004780 | CCUCCCACACCCAAGGCUUGCA | 2.00 |
hsa-miR-886-5p | MI0005527 | CGGGUCGGAGUUAGCUCAAGCGG | 2.61 |
Fold Decrease | |||
hsa-let-7f-5p | MIMAT0000067 | UGAGGUAGUAGAUUGUAUAGUU | 2.07 |
hsa-miR-17-5p | MIMAT0000070 | CAAAGUGCUUACAGUGCAGGUAG | 1.59 |
Gene Name | Gene Ensembl ID | Microt-CDS Score | Experimentally Supported |
---|---|---|---|
ROCK1 | ENSG00000067900 | 0.921 | No |
SMAD2 | ENSG00000175387 | 0.937 | Yes |
INHBB | ENSG00000163083 | 0.564 | No |
SMAD9 | ENSG00000120693 | 0.871 | No |
THBS1 | ENSG00000137801 | 0.606 | Yes |
BMP5 | ENSG00000112175 | 0.737 | No |
CDKN2B | ENSG00000147883 | 0.684 | No |
ACVR1 | ENSG00000115170 | 0.914 | No |
SKP1 | ENSG00000113558 | 0.669 | No |
ACVR2B | ENSG00000114739 | 0.999 | Yes |
ZFYVE16 | ENSG00000039319 | 0.531 | No |
DCN | ENSG00000011465 | 0.517 | No |
SMAD4 | ENSG00000141646 | 0.711 | No |
E2F5 | ENSG00000133740 | 0.503 | Yes |
SMURF1 | ENSG00000198742 | 0.691 | Yes |
ZFYVE9 | ENSG00000157077 | 0.716 | No |
SMAD5 | ENSG00000113658 | 0.943 | Yes |
GDF6 | ENSG00000156466 | 0.527 | No |
MAPK3 | ENSG00000102882 | 0.608 | No |
TFDP1 | ENSG00000198176 | 0.854 | No |
SP1 | ENSG00000185591 | 0.538 | Yes |
GDF5 | ENSG00000125965 | 0.998 | No |
TGFB2 | ENSG00000092969 | 0.855 | No |
EP300 | ENSG00000100393 | 1.000 | No |
PPP2CB | ENSG00000104695 | 0.800 | Yes |
BMPR1A | ENSG00000107779 | 0.605 | No |
LTBP1 | ENSG00000049323 | 0.611 | No |
MAPK1 | ENSG00000100030 | 0.992 | Yes |
PPP2R1B | ENSG00000137713 | 0.587 | Yes |
BMPR2 | ENSG00000204217 | 0.717 | No |
RPS6KB1 | ENSG00000108443 | 0.515 | No |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cannavicci, A.; Zhang, Q.; Faughnan, M.E.; Kutryk, M.J.B. MicroRNA-132-3p, Downregulated in Myeloid Angiogenic Cells from Hereditary Hemorrhagic Telangiectasia Patients, Is Enriched in the TGFβ and PI3K/AKT Signalling Pathways. Genes 2022, 13, 665. https://doi.org/10.3390/genes13040665
Cannavicci A, Zhang Q, Faughnan ME, Kutryk MJB. MicroRNA-132-3p, Downregulated in Myeloid Angiogenic Cells from Hereditary Hemorrhagic Telangiectasia Patients, Is Enriched in the TGFβ and PI3K/AKT Signalling Pathways. Genes. 2022; 13(4):665. https://doi.org/10.3390/genes13040665
Chicago/Turabian StyleCannavicci, Anthony, Qiuwang Zhang, Marie E. Faughnan, and Michael J. B. Kutryk. 2022. "MicroRNA-132-3p, Downregulated in Myeloid Angiogenic Cells from Hereditary Hemorrhagic Telangiectasia Patients, Is Enriched in the TGFβ and PI3K/AKT Signalling Pathways" Genes 13, no. 4: 665. https://doi.org/10.3390/genes13040665
APA StyleCannavicci, A., Zhang, Q., Faughnan, M. E., & Kutryk, M. J. B. (2022). MicroRNA-132-3p, Downregulated in Myeloid Angiogenic Cells from Hereditary Hemorrhagic Telangiectasia Patients, Is Enriched in the TGFβ and PI3K/AKT Signalling Pathways. Genes, 13(4), 665. https://doi.org/10.3390/genes13040665