Stalling of Eukaryotic Translesion DNA Polymerases at DNA-Protein Cross-Links
Abstract
:1. Introduction
2. Materials and Methods
2.1. Oligonucleotides and Enzymes
2.2. Preparation of DNA-Protein Cross-Links
2.3. Primer Extension Reactions
3. Results
3.1. Substrate Design
3.2. Inefficient Synthesis by POLι on DPC-Containing Substrates
3.3. POLζ Is Able to Reach the Cross-Link Site
3.4. POLη Able to Reach the Cross-Link Site and Beyond
4. Discussion
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Barker, S.; Weinfeld, M.; Zheng, J.; Li, L.; Murray, D. Identification of mammalian proteins cross-linked to DNA by ionizing radiation. J. Biol. Chem. 2005, 280, 33826–33838. [Google Scholar] [CrossRef] [Green Version]
- Xu, X.; Muller, J.G.; Ye, Y.; Burrows, C.J. DNA−protein cross-links between guanine and lysine depend on the mechanism of oxidation for formation of C5 vs C8 guanosine adducts. J. Am. Chem. Soc. 2008, 130, 703–709. [Google Scholar] [CrossRef] [PubMed]
- Olinski, R.; Nackerdien, Z.; Dizdaroglu, M. DNA-protein cross-linking between thymine and tyrosine in chromatin of Y-irradiated or H2O2-treated cultured human cells. Arch. Biochem. Biophys. 1992, 297, 139–143. [Google Scholar] [CrossRef]
- Kuo, H.K.; Griffith, J.D.; Kreuzer, K.N. 5-Azacytidine–induced methyltransferase-DNA adducts block DNA replication in vivo. Cancer Res. 2007, 67, 8248–8254. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ji, S.; Thomforde, J.; Rogers, C.; Fu, I.; Broyde, S.; Tretyakova, N.Y. Transcriptional bypass of DNA–protein and DNA–peptide conjugates by T7 RNA polymerase. ACS Chem. Biol. 2019, 14, 2564–2575. [Google Scholar] [CrossRef]
- Nakano, T.; Ouchi, R.; Kawazoe, J.; Pack, S.P.; Makino, K.; Ide, H. T7 RNA polymerases backed up by covalently trapped proteins catalyze highly error prone transcription. J. Biol. Chem. 2012, 287, 6562–6572. [Google Scholar] [CrossRef] [Green Version]
- Ji, S.; Shao, H.; Han, Q.; Seiler, C.L.; Tretyakova, N.Y. Reversible DNA–protein cross-linking at epigenetic DNA marks. Angew. Chem. Int. Ed. 2017, 56, 14130–14134. [Google Scholar] [CrossRef]
- Pachva, M.C.; Kisselev, A.F.; Matkarimov, B.T.; Saparbaev, M.; Groisman, R. DNA-histone cross-links: Formation and repair. Front. Cell Dev. Biol. 2020, 8, 607045. [Google Scholar] [CrossRef]
- Pommier, Y.; Leo, E.; Zhang, H.; Marchand, C. DNA topoisomerases and their poisoning by anticancer and antibacterial drugs. Chem. Biol. 2010, 17, 421–433. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bax, B.D.; Murshudov, G.; Maxwell, A.; Germe, T. DNA topoisomerase inhibitors: Trapping a DNA-cleaving machine in motion. J. Mol. Biol. 2019, 431, 3427–3449. [Google Scholar] [CrossRef]
- Thompson, P.S.; Amidon, K.M.; Mohni, K.N.; Cortez, D.; Eichman, B.F. Protection of abasic sites during DNA replication by a stable thiazolidine protein-DNA cross-link. Nat. Struct. Mol. Biol. 2019, 26, 613–618. [Google Scholar] [CrossRef]
- Mohni, K.N.; Wessel, S.R.; Zhao, R.; Wojciechowski, A.C.; Luzwick, J.W.; Layden, H.; Eichman, B.F.; Thompson, P.S.; Mehta, K.P.M.; Cortez, D. HMCES maintains genome integrity by shielding abasic sites in single-strand DNA. Cell 2019, 176, 144–153. [Google Scholar] [CrossRef] [Green Version]
- Srivastava, M.; Su, D.; Zhang, H.; Chen, Z.; Tang, M.; Nie, L.; Chen, J. HMCES safeguards replication from oxidative stress and ensures error-free repair. EMBO Rep. 2020, 21, e49123. [Google Scholar] [CrossRef] [PubMed]
- Xie, M.-Z.; Shoulkamy, M.I.; Salem, A.M.H.; Oba, S.; Goda, M.; Nakano, T.; Ide, H. Aldehydes with high and low toxicities inactivate cells by damaging distinct cellular targets. Mutat. Res. 2016, 786, 41–51. [Google Scholar] [CrossRef]
- Barker, S.; Weinfeld, M.; Murray, D. DNA-protein crosslinks: Their induction, repair, and biological consequences. Mutat. Res. 2005, 589, 111–135. [Google Scholar] [CrossRef] [PubMed]
- Lu, K.; Ye, W.; Zhou, L.; Collins, L.B.; Chen, X.; Gold, A.; Ball, L.M.; Swenberg, J.A. Structural characterization of formaldehyde-induced cross-links between amino acids and deoxynucleosides and their oligomers. J. Am. Chem. Soc. 2010, 132, 3388–3399. [Google Scholar] [CrossRef] [Green Version]
- Chválová, K.; Brabec, V.; Kašpárková, J. Mechanism of the formation of DNA–protein cross-links by antitumor cisplatin. Nucleic Acids Res. 2007, 35, 1812–1821. [Google Scholar] [CrossRef] [Green Version]
- Nakano, T.; Xu, X.; Salem, A.M.H.; Shoulkamy, M.I.; Ide, H. Radiation-induced DNA–protein cross-links: Mechanisms and biological significance. Free Radic. Biol. Med. 2017, 107, 136–145. [Google Scholar] [CrossRef]
- Zhang, H.; Xiong, Y.; Chen, J. DNA-protein cross-link repair: What do we know now? Cell Biosci. 2020, 10, 3. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, S.W.; Burgin, A.B.; Huizenga, B.N.; Robertson, C.A.; Yao, K.C.; Nash, H.A. A eukaryotic enzyme that can disjoin dead-end covalent complexes between DNA and type I topoisomerases. Proc. Natl. Acad. Sci. USA 1996, 93, 11534–11539. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pommier, Y.; Huang, S.N.; Gao, R.; Das, B.B.; Murai, J.; Marchand, C. Tyrosyl-DNA-phosphodiesterases (TDP1 and TDP2). DNA Repair (Amst) 2014, 19, 114–129. [Google Scholar] [CrossRef] [Green Version]
- DeMott, M.S.; Beyret, E.; Wong, D.; Bales, B.C.; Hwang, J.-T.; Greenberg, M.M.; Demple, B. Covalent trapping of human DNA polymerase β by the oxidative DNA lesion 2-deoxyribonolactone. J. Biol. Chem. 2002, 277, 7637–7640. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kroeger, K.M.; Hashimoto, M.; Kow, Y.W.; Greenberg, M.M. Cross-linking of 2-deoxyribonolactone and its β-elimination product by base excision repair enzymes. Biochemistry 2003, 42, 2449–2455. [Google Scholar] [CrossRef]
- Arian, D.; Hedayati, M.; Zhou, H.; Bilis, Z.; Chen, K.; DeWeese, T.L.; Greenberg, M.M. Irreversible inhibition of DNA polymerase β by small-molecule mimics of a DNA lesion. J. Am. Chem. Soc. 2014, 136, 3176–3183. [Google Scholar] [CrossRef] [PubMed]
- Nakano, T.; Terato, H.; Asagoshi, K.; Masaoka, A.; Mukuta, M.; Ohyama, Y.; Suzuki, T.; Makino, K.; Ide, H. DNA-protein cross-link formation mediated by oxanine. J. Biol. Chem. 2003, 278, 25264–25272. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hashimoto, M.; Greenberg, M.M.; Kow, Y.W.; Hwang, J.-T.; Cunningham, R.P. The 2-deoxyribonolactone lesion produced in DNA by neocarzinostatin and other damaging agents forms cross-links with the base-excision repair enzyme endonuclease III. J. Am. Chem. Soc. 2001, 123, 3161–3162. [Google Scholar] [CrossRef]
- Prasad, R.; Horton, J.K.; Chastain, P.D.; Gassman, N.R.; Freudenthal, B.D.; Hou, E.W.; Wilson, S.H. Suicidal cross-linking of PARP-1 to AP site intermediates in cells undergoing base excision repair. Nucleic Acids Res. 2014, 42, 6337–6351. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ide, H.; Shoulkamy, M.I.; Nakano, T.; Miyamoto-Matsubara, M.; Salem, A.M.H. Repair and biochemical effects of DNA–protein crosslinks. Mutat. Res. 2011, 711, 113–122. [Google Scholar] [CrossRef] [PubMed]
- Ide, H.; Nakano, T.; Salem, A.M.H.; Shoulkamy, M.I. DNA–protein cross-links: Formidable challenges to maintaining genome integrity. DNA Repair (Amst) 2018, 71, 190–197. [Google Scholar] [CrossRef]
- Kühbacher, U.; Duxin, J.P. How to fix DNA-protein crosslinks. DNA Repair (Amst) 2020, 94, 102924. [Google Scholar] [CrossRef] [PubMed]
- Stingele, J.; Schwarz, M.S.; Bloemeke, N.; Wolf, P.G.; Jentsch, S. A DNA-dependent protease involved in DNA-protein crosslink repair. Cell 2014, 158, 327–338. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stingele, J.; Bellelli, R.; Alte, F.; Hewitt, G.; Sarek, G.; Maslen, S.L.; Tsutakawa, S.E.; Borg, A.; Kjær, S.; Tainer, J.A.; et al. Mechanism and regulation of DNA-protein crosslink repair by the DNA-dependent metalloprotease SPRTN. Mol. Cell 2016, 64, 688–703. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, F.; Raczynska, J.E.; Chen, Z.; Yu, H. Structural insight into DNA-dependent activation of human metalloprotease Spartan. Cell Rep. 2019, 26, 3336–3346.e4. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kose, H.B.; Larsen, N.B.; Duxin, J.P.; Yardimci, H. Dynamics of the eukaryotic replicative helicase at lagging-strand protein barriers support the steric exclusion model. Cell Rep. 2019, 26, 2113–2125.e6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Larsen, N.B.; Gao, A.O.; Sparks, J.L.; Gallina, I.; Wu, R.A.; Mann, M.; Räschle, M.; Walter, J.C.; Duxin, J.P. Replication-coupled DNA-protein crosslink repair by SPRTN and the proteasome in Xenopus Egg Extracts. Mol. Cell 2019, 73, 574–588.e7. [Google Scholar] [CrossRef] [Green Version]
- Yeo, J.E.; Wickramaratne, S.; Khatwani, S.; Wang, Y.C.; Vervacke, J.; Distefano, M.D.; Tretyakova, N.Y. Synthesis of site-specific DNA-protein conjugates and their effects on DNA replication. ACS Chem. Biol. 2014, 9, 1860–1868. [Google Scholar] [CrossRef]
- Wickramaratne, S.; Ji, S.; Mukherjee, S.; Su, Y.; Pence, M.G.; Lior-Hoffmann, L.; Fu, I.; Broyde, S.; Guengerich, F.P.; Distefano, M.; et al. Bypass of DNA-protein cross-links conjugated to the 7-deazaguanine position of DNA by translesion synthesis polymerases. J. Biol. Chem. 2016, 291, 23589–23603. [Google Scholar] [CrossRef] [Green Version]
- Yudkina, A.V.; Dvornikova, A.P.; Zharkov, D.O. Variable termination sites of DNA polymerases encountering a DNA–protein cross-link. PLoS ONE 2018, 13, e0198480. [Google Scholar] [CrossRef]
- Ji, S.; Fu, I.; Naldiga, S.; Shao, H.; Basu, A.K.; Broyde, S.; Tretyakova, N.Y. 5-Formylcytosine mediated DNA–protein cross-links block DNA replication and induce mutations in human cells. Nucleic Acids Res. 2018, 46, 6455–6469. [Google Scholar] [CrossRef]
- Yang, W.; Gao, Y. Translesion and repair DNA polymerases: Diverse structure and mechanism. Annu. Rev. Biochem. 2018, 87, 239–261. [Google Scholar] [CrossRef]
- Goodman, M.F. Error-prone repair DNA polymerases in prokaryotes and eukaryotes. Annu. Rev. Biochem. 2002, 71, 17–50. [Google Scholar] [CrossRef] [Green Version]
- Gilboa, R.; Zharkov, D.O.; Golan, G.; Fernandes, A.S.; Gerchman, S.E.; Matz, E.; Kycia, J.H.; Grollman, A.P.; Shoham, G. Structure of formamidopyrimidine-DNA glycosylase covalently complexed to DNA. J. Biol. Chem. 2002, 277, 19811–19816. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kazachenko, K.Y.; Miropolskaya, N.A.; Gening, L.V.; Tarantul, V.Z.; Makarova, A.V. Alternative splicing at exon 2 results in the loss of the catalytic activity of mouse DNA polymerase iota in vitro. DNA Repair (Amst) 2017, 50, 77–82. [Google Scholar] [CrossRef] [PubMed]
- Makarova, A.V.; Stodola, J.L.; Burgers, P.M. A four-subunit DNA polymerase ζ complex containing Pol δ accessory subunits is essential for PCNA-mediated mutagenesis. Nucleic Acids Res. 2012, 40, 11618–11626. [Google Scholar] [CrossRef] [Green Version]
- Boldinova, E.O.; Yudkina, A.V.; Shilkin, E.S.; Gagarinskaya, D.I.; Baranovskiy, A.G.; Tahirov, T.H.; Zharkov, D.O.; Makarova, A.V. Translesion activity of PrimPol on DNA with cisplatin and DNA–protein cross-links. Sci. Rep. 2021, 11, 17588. [Google Scholar] [CrossRef] [PubMed]
- Tissier, A.; McDonald, J.P.; Frank, E.G.; Woodgate, R. polι, a remarkably error-prone human DNA polymerase. Genes Dev. 2000, 14, 1642–1650. [Google Scholar] [CrossRef]
- Frank, E.G.; Tissier, A.; McDonald, J.P.; Rapić-Otrin, V.; Zeng, X.; Gearhart, P.J.; Woodgate, R. Altered nucleotide misinsertion fidelity associated with polι-dependent replication at the end of a DNA template. EMBO J. 2001, 20, 2914–2922. [Google Scholar] [CrossRef] [Green Version]
- Poltoratsky, V.; Woo, C.J.; Tippin, B.; Martin, A.; Goodman, M.F.; Scharff, M.D. Expression of error-prone polymerases in BL2 cells activated for Ig somatic hypermutation. Proc. Natl. Acad. Sci. USA 2001, 98, 7976–7981. [Google Scholar] [CrossRef] [Green Version]
- Kirouac, K.N.; Ling, H. Structural basis of error-prone replication and stalling at a thymine base by human DNA polymerase. EMBO J. 2009, 28, 1644–1654. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.; Yuan, F.; Wu, X.; Wang, Z. Preferential incorporation of G opposite template T by the low-fidelity human DNA polymerase iota. Mol. Cell. Biol. 2000, 20, 7099–7108. [Google Scholar] [CrossRef] [Green Version]
- Makarova, A.V.; Burgers, P.M. Eukaryotic DNA polymerase ζ. DNA Repair (Amst) 2015, 29, 47–55. [Google Scholar] [CrossRef] [Green Version]
- Nelson, J.R.; Lawrence, C.W.; Hinkle, D.C. Thymine-thymine dimer bypass by yeast DNA polymerase ζ. Science 1996, 272, 1646–1649. [Google Scholar] [CrossRef] [PubMed]
- Stone, J.E.; Kumar, D.; Binz, S.K.; Inase, A.; Iwai, S.; Chabes, A.; Burgers, P.M.; Kunkel, T.A. Lesion bypass by S. cerevisiae Pol ζ alone. DNA Repair (Amst) 2011, 10, 826–834. [Google Scholar] [CrossRef] [Green Version]
- Duxin, J.P.; Dewar, J.M.; Yardimci, H.; Walter, J.C. Repair of a DNA-protein crosslink by replication-coupled proteolysis. Cell 2014, 159, 346–357. [Google Scholar] [CrossRef] [Green Version]
- Ho, T.V.; Guainazzi, A.; Derkunt, S.B.; Enoiu, M.; Schärer, O.D. Structure-dependent bypass of DNA interstrand crosslinks by translesion synthesis polymerases. Nucleic Acids Res. 2011, 39, 7455–7464. [Google Scholar] [CrossRef] [Green Version]
- Li, J.; Holzschu, D.L.; Sugiyama, T. PCNA is efficiently loaded on the DNA recombination intermediate to modulate polymerase δ, η, and ζ activities. Proc. Natl. Acad. Sci. USA 2013, 110, 7672–7677. [Google Scholar] [CrossRef] [Green Version]
- Masutani, C.; Kusumoto, R.; Yamada, A.; Dohmae, N.; Yokol, M.; Yuasa, M.; Araki, M.; Iwai, S.; Takio, K.; Hanaoka, F. The XPV (xeroderma pigmentosum variant) gene encodes human DNA polymerase η. Nature 1999, 399, 700–704. [Google Scholar] [CrossRef]
- Johnson, R.E.; Kondratick, C.M.; Prakash, S.; Prakash, L. hRAD30 mutations in the variant form of xeroderma pigmentosum. Science 1999, 285, 263–265. [Google Scholar] [CrossRef] [PubMed]
- Masutani, C.; Kusumoto, R.; Iwai, S.; Hanaoka, F. Mechanisms of accurate translesion synthesis by human DNA polymerase eta. EMBO J. 2000, 19, 3100–3109. [Google Scholar] [CrossRef] [PubMed]
- Johnson, R.E.; Prakash, S.; Prakash, L. Efficient bypass of a thymine-thymine dimer by yeast DNA polymerase, Polη. Science 1999, 283, 1001–1004. [Google Scholar] [CrossRef] [PubMed]
- Hang, B.; Singer, B. Protein-protein interactions involving DNA glycosylases. Chem. Res. Toxicol. 2003, 16, 1181–1195. [Google Scholar] [CrossRef]
- Hawkins, M.; Dimude, J.U.; Howard, J.A.L.; Smith, A.J.; Dillingham, M.S.; Savery, N.J.; Rudolph, C.J.; McGlynn, P. Direct removal of RNA polymerase barriers to replication by accessory replicative helicases. Nucleic Acids Res. 2019, 47, 5100–5113. [Google Scholar] [CrossRef] [Green Version]
- Endutkin, A.V.; Yudkina, A.V.; Sidorenko, V.S.; Zharkov, D.O. Transient protein–protein complexes in base excision repair. J. Biomol. Struct. Dyn. 2019, 37, 4407–4418. [Google Scholar] [CrossRef]
- Biertümpfel, C.; Zhao, Y.; Kondo, Y.; Ramón-Maiques, S.; Gregory, M.; Lee, J.Y.; Masutani, C.; Lehmann, A.R.; Hanaoka, F.; Yang, W. Structure and mechanism of human DNA polymerase η. Nature 2010, 465, 1044–1048. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhao, Y.; Biertümpfel, C.; Gregory, M.T.; Hua, Y.J.; Hanaoka, F.; Yang, W. Structural basis of human DNA polymerase η-mediated chemoresistance to cisplatin. Proc. Natl. Acad. Sci. USA 2012, 109, 7269–7274. [Google Scholar] [CrossRef] [Green Version]
- Ouzon-Shubeita, H.; Baker, M.; Koag, M.C.; Lee, S. Structural basis for the bypass of the major oxaliplatin–DNA adducts by human DNA polymerase η. Biochem. J. 2019, 476, 747–758. [Google Scholar] [CrossRef]
- Gregory, M.T.; Park, G.Y.; Johnstone, T.C.; Lee, Y.S.; Yang, W.; Lippard, S.J. Structural and mechanistic studies of polymerase η bypass of phenanthriplatin DNA damage. Proc. Natl. Acad. Sci. USA 2014, 111, 9133–9138. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yudkina, A.V.; Endutkin, A.V.; Diatlova, E.A.; Moor, N.A.; Vokhtantsev, I.P.; Grin, I.R.; Zharkov, D.O. Displacement of slow-turnover DNA glycosylases by molecular traffic on DNA. Genes 2020, 11, 866. [Google Scholar] [CrossRef]
- Sun, B.; Latham, K.A.; Dodson, M.L.; Lloyd, R.S. Studies on the catalytic mechanism of five DNA glycosylases: Probing for enzyme-DNA imino intermediates. J. Biol. Chem. 1995, 270, 19501–19508. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zharkov, D.O.; Rieger, R.A.; Iden, C.R.; Grollman, A.P. NH2-terminal proline acts as a nucleophile in the glycosylase/AP-Lyase reaction catalyzed by Escherichia coli formamidopyrimidine-DNA glycosylase (Fpg) protein. J. Biol. Chem. 1997, 272, 5335–5341. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cuniasse, P.; Fazakerley, G.V.; Guschlbauer, W.; Kaplan, B.E.; Sowers, L.C. The abasic site as a challenge to DNA polymerase. A nuclear magnetic resonance study of G, C and T opposite a model abasic site. J. Mol. Biol. 1990, 213, 303–314. [Google Scholar] [CrossRef]
- Blanca, G.; Villani, G.; Shevelev, I.; Ramadan, K.; Spadari, S.; Hübscher, U.; Maga, G. Human DNA polymerases λ and β show different efficiencies of translesion DNA synthesis past abasic sites and alternative mechanisms for frameshift generation. Biochemistry 2004, 43, 11605–11615. [Google Scholar] [CrossRef]
- Sagher, D.; Strauss, B. Insertion of nucleotides opposite apurinic apyrimidinic sites in deoxyribonucleic acid during in vitro synthesis: Uniqueness of adenine nucleotides. Biochemistry 1983, 22, 4518–4526. [Google Scholar] [CrossRef]
- Miller, H.; Grollman, A.P. Kinetics of DNA polymerase I (Klenow fragment exo-) activity on damaged DNA templates: Effect of proximal and distal template damage on DNA synthesis. Biochemistry 1997, 36, 15336–15342. [Google Scholar] [CrossRef]
- Choi, J.-Y.; Lim, S.; Kim, E.-J.; Jo, A.; Guengerich, F.P. Translesion synthesis across abasic lesions by human B-family and Y-family DNA polymerases α, δ, η, ι, κ, and REV1. J. Mol. Biol. 2010, 404, 34–44. [Google Scholar] [CrossRef] [Green Version]
- Efrati, E.; Tocco, G.; Eritja, R.; Wilson, S.H.; Goodman, M.F. Abasic translesion synthesis by DNA polymerase β violates the “A-rule”. J. Biol. Chem. 1997, 272, 2559–2569. [Google Scholar] [CrossRef] [Green Version]
- Sherrer, S.M.; Fiala, K.A.; Fowler, J.D.; Newmister, S.A.; Pryor, J.M.; Suo, Z. Quantitative analysis of the efficiency and mutagenic spectra of abasic lesion bypass catalyzed by human Y-family DNA polymerases. Nucleic Acids Res. 2011, 39, 609–622. [Google Scholar] [CrossRef] [Green Version]
- Su, Y.; Patra, A.; Harp, J.M.; Egli, M.; Guengerich, F.P. Roles of residues Arg-61 and Gln-38 of human DNA polymerase η in bypass of deoxyguanosine and 7,8-dihydro-8-oxo-2’-deoxyguanosine. J. Biol. Chem. 2015, 290, 15921–15933. [Google Scholar] [CrossRef] [Green Version]
- Wu, Y.; Wilson, R.C.; Pata, J.D. The Y-Family DNA polymerase Dpo4 uses a template slippage mechanism to create single-base deletions. J. Bacteriol. 2011, 193, 2630–2636. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tippin, B.; Kobayashi, S.; Bertram, J.G.; Goodman, M.F. To slip or skip, visualizing frameshift mutation dynamics for error-prone DNA polymerases. J. Biol. Chem. 2004, 279, 45360–45368. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ling, H.; Boudsocq, F.; Woodgate, R.; Yang, W. Crystal structure of a Y-family DNA polymerase in action: A mechanism for error-prone and lesion-bypass replication. Cell 2001, 107, 91–102. [Google Scholar] [CrossRef] [Green Version]
- Ruiz, J.F.; Lucas, D.; García-Palomero, E.; Saez, A.I.; González, M.A.; Piris, M.A.; Bernad, A.; Blaco, L. Overexpression of human DNA polymerase μ (Pol μ) in a Burkitt’s lymphoma cell line affects the somatic hypermutation rate. Nucleic Acids Res. 2004, 32, 5861–5873. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mukherjee, P.; Lahiri, I.; Pata, J.D. Human polymerase kappa uses a template-slippage deletion mechanism, but can realign the slipped strands to favour base substitution mutations over deletions. Nucleic Acids Res. 2013, 41, 5024–5035. [Google Scholar] [CrossRef] [PubMed]
- Martínez-Jiménez, M.I.; García-Gómez, S.; Bebenek, K.; Sastre-Moreno, G.; Calvo, P.A.; Díaz-Talavera, A.; Kunkel, T.A.; Blanco, L. Alternative solutions and new scenarios for translesion DNA synthesis by human PrimPol. DNA Repair (Amst) 2015, 29, 127–138. [Google Scholar] [CrossRef]
- Makarova, A.V.; Boldinova, E.O.; Belousova, E.A.; Lavrik, O.I. In vitro lesion bypass by human PrimPol. DNA Repair (Amst) 2018, 70, 18–24. [Google Scholar] [CrossRef] [PubMed]
Sequence, 5′→3′ | Length | Function |
---|---|---|
GCTCTGGAATTCCTTCXCTTCTTTCCTCTCGACGGTCTCG X = 8-oxoguanine | 40 | Template for ss-DPC or temp-DPC, cross-link at X |
GCTCTGGAATTCCTTCGCTTCTTTCCTCTCGACGGTCTCG | 40 | Template for undamaged substrates |
GCTCTGGAATTCCTTCCCTTCTTTCCTCTCGACGGTCTCG | 40 | Template for down-DPC |
GAGGAAAGAAGXGAAGGAATTCCAGAGC X = 8-oxoguanine | 28 | Displaced strand for down-DPC, cross-link at X |
GAGGAAAGAAGCGAAGGAATTCCAGAGC | 28 | Displaced strand for undamaged substrates |
CGAGACCGTCG | 11 | Primer and size marker M1 |
CGAGACCGTCGCGAGGAAAGAAG | 23 | Size marker M2, corresponding to primer elongation to the cross-link site |
CGAGACCGTCGCGAGGAAAGAAGCGAAGGAATTCCAGAGC | 40 | Size marker M3, corresponding to the full-size product |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yudkina, A.V.; Shilkin, E.S.; Makarova, A.V.; Zharkov, D.O. Stalling of Eukaryotic Translesion DNA Polymerases at DNA-Protein Cross-Links. Genes 2022, 13, 166. https://doi.org/10.3390/genes13020166
Yudkina AV, Shilkin ES, Makarova AV, Zharkov DO. Stalling of Eukaryotic Translesion DNA Polymerases at DNA-Protein Cross-Links. Genes. 2022; 13(2):166. https://doi.org/10.3390/genes13020166
Chicago/Turabian StyleYudkina, Anna V., Evgeniy S. Shilkin, Alena V. Makarova, and Dmitry O. Zharkov. 2022. "Stalling of Eukaryotic Translesion DNA Polymerases at DNA-Protein Cross-Links" Genes 13, no. 2: 166. https://doi.org/10.3390/genes13020166
APA StyleYudkina, A. V., Shilkin, E. S., Makarova, A. V., & Zharkov, D. O. (2022). Stalling of Eukaryotic Translesion DNA Polymerases at DNA-Protein Cross-Links. Genes, 13(2), 166. https://doi.org/10.3390/genes13020166