The Sex-Specific Splicing of Doublesex in Brine Shrimp Artemia franciscana
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal Culture
2.2. Total RNA Extraction and cDNA Synthesis
2.3. Identification of Putative of Dsx/Dmrt Transcripts
2.4. Isolation Full-Length of Dsx/Dmrt Transcript
2.5. Phylogenetic Analysis
2.6. Transcription Proof of Dsx/Dmrt Transcript
3. Results
3.1. Identification of Dsx/Dmrt Transcripts
3.2. Genome Mapping and Putative Protein Translation
3.3. Phylogenetic Tree
3.4. Sex-Specific Splicing of Doublesex Gene
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- De Vos, S.; Bossier, P.; Van Stappen, G.; Vercauteren, I.; Sorgeloos, P.; Vuylsteke, M. A First AFLP-Based Genetic Linkage Map for Brine Shrimp Artemia franciscana and Its Application in Mapping the Sex Locus. PLoS ONE 2013, 8, e57585. [Google Scholar] [CrossRef] [Green Version]
- Bowen, S.T. The Genetics of Artemia salina. V. Crossing over between the X and Y Chromosomes. Genetics 1965, 52, 695–710. [Google Scholar] [CrossRef] [PubMed]
- Parnes, S.; Khalaila, I.; Hulata, G.; Sagi, A. Sex Determination in Crayfish: Are Intersex Cherax quadricarinatus (Decapoda, Parastacidae) Genetically Females? Genet. Res. 2003, 82, 107–116. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Staelens, J.; Rombaut, D.; Vercauteren, I.; Argue, B.; Benzie, J.; Vuylsteke, M. High-Density Linkage Maps and Sex-Linked Markers for the Black Tiger Shrimp (Penaeus monodon). Genetics 2008, 179, 917–925. [Google Scholar] [CrossRef] [Green Version]
- Ventura, T.; Sagi, A. The Insulin-like Androgenic Gland Hormone in Crustaceans: From a Single Gene Silencing to a Wide Array of Sexual Manipulation-Based Biotechnologies. Biotechnol. Adv. 2012, 30, 1543–1550. [Google Scholar] [CrossRef]
- Cui, Z.; Hui, M.; Liu, Y.; Song, C.; Li, X.; Li, Y.; Liu, L.; Shi, G.; Wang, S.; Li, F.; et al. High-Density Linkage Mapping Aided by Transcriptomics Documents ZW Sex Determination System in the Chinese Mitten Crab Eriocheir sinensis. Heredity 2015, 115, 206–215. [Google Scholar] [CrossRef] [Green Version]
- Huylmans, A.K.; Toups, M.A.; MacOn, A.; Gammerdinger, W.J.; Vicoso, B. Sex-Biased Gene Expression and Dosage Compensation on the Artemia Franciscana Z-Chromosome. Genome Biol Evol 2019, 11, 1033–1044. [Google Scholar] [CrossRef] [Green Version]
- Jo, E.; Lee, S.J.; Choi, E.; Kim, J.; Lee, J.H.; Park, H. Sex-Biased Gene Expression and Isoform Profile of Brine Shrimp Artemia Franciscana by Transcriptome Analysis. Animals 2021, 11, 2630. [Google Scholar] [CrossRef]
- Li, D.-R.; Ye, H.-L.; Yang, J.-S.; Yang, F.; Wang, M.-R.; de Vos, S.; Vuylsteke, M.; Sorgeloos, P.; van Stappen, G.; Bossier, P.; et al. Identification and Characterization of a Masculinizer (Masc) Gene Involved in Sex Differentiation in Artemia. Gene 2017, 614, 56–64. [Google Scholar] [CrossRef]
- Xu, J.; Zhan, S.; Chen, S.; Zeng, B.; Li, Z.; James, A.A.; Tan, A.; Huang, Y. Sexually Dimorphic Traits in the Silkworm, Bombyx Mori, Are Regulated by Doublesex. Insect Biochem Mol. Biol 2017, 80, 42–51. [Google Scholar] [CrossRef]
- Mawaribuchi, S.; Ito, Y.; Ito, M. Independent Evolution for Sex Determination and Differentiation in the DMRT Family in Animals. Biol. Open 2019, 8, bio041962. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Burtis, K.C.; Baker, B.S. Drosophila Doublesex Gene Controls Somatic Sexual Differentiation by Producing Alterna-tively Spliced MRNAs Encoding Related Sex-Specific Polypeptides. Cell 1989, 56, 997–1010. [Google Scholar] [CrossRef]
- Verhulst, E.C.; van de Zande, L. Double Nexus—Doublesex Is the Connecting Element in Sex Determination. Brief. Funct. Genom. 2015, 14, 396–406. [Google Scholar] [CrossRef] [Green Version]
- Jung, H.; Yoon, B.-H.; Kim, W.-J.; Kim, D.-W.; Hurwood, D.A.; Lyons, R.E.; Salin, K.R.; Kim, H.-S.; Baek, I.; Chand, V.; et al. Optimizing Hybrid de Novo Transcriptome Assembly and Extending Genomic Resources for Giant Freshwater Prawns (Macrobrachium Rosenbergii): The Identification of Genes and Markers Associated with Re-production. Int. J. Mol. Sci. 2016, 17, 690. [Google Scholar] [CrossRef]
- Yu, Y.-Q.; Ma, W.-M.; Zeng, Q.-G.; Qian, Y.-Q.; Yang, J.-S.; Yang, W.-J. Molecular Cloning and Sexually Di-morphic Expression of Two Dmrt Genes in the Giant Freshwater Prawn, Macrobrachium Rosenbergii. Agric. Res. 2014, 3, 181–191. [Google Scholar] [CrossRef]
- Amterat Abu Abayed, F.; Manor, R.; Aflalo, E.D.; Sagi, A. Screening for Dmrt Genes from Embryo to Mature Macro-brachium Rosenbergii Prawns. Gen. Comp. Endocrinol. 2019, 282, 113205. [Google Scholar] [CrossRef]
- Zhong, P.; Zhou, T.; Zhang, Y.; Chen, Y.; Yi, J.; Lin, W.; Guo, Z.; Xu, A.; Yang, S.; Chan, S.; et al. Potential Involvement of a DMRT Family Member (Mr-Dsx) in the Regulation of Sexual Differentiation and Moulting in the Giant River Prawn Macrobrachium Rosenbergii. Aquac. Res. 2019, 50, 3037–3049. [Google Scholar] [CrossRef]
- Ma, K.; Qiu, G.; Feng, J.; Li, J. Transcriptome Analysis of the Oriental River Prawn, Macrobrachium Nipponense Using 454 Pyrosequencing for Discovery of Genes and Markers. PLoS ONE 2012, 7, e39727. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, E.F.; Qiu, G.F. A Novel Dmrt Gene Is Specifically Expressed in the Testis of Chinese Mitten Crab, Eriocheir Sinensis. Dev. Genes. Evol. 2010, 220, 151–159. [Google Scholar] [CrossRef]
- Li, S.; Li, F.; Yu, K.; Xiang, J. Identification and Characterization of a Doublesex Gene Which Regulates the Expression of Insulin-like Androgenic Gland Hormone in Fenneropenaeus Chinensis. Gene 2018, 649, 1–7. [Google Scholar] [CrossRef]
- Peng, J.; Wei, P.; Zhang, B.; Zhao, Y.; Zeng, D.; Chen, X.; Li, M.; Chen, X. Gonadal Transcriptomic Analysis and Dif-ferentially Expressed Genes in the Testis and Ovary of the Pacific White Shrimp (Litopenaeus Vannamei). BMC Genom. 2015, 16, 1006. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kato, Y.; Kobayashi, K.; Watanabe, H.; Iguchi, T. Environmental Sex Determination in the Branchiopod Crustacean Daphnia Magna: Deep Consevation of a Doublesex Gene in the Sex-Determining Pathway. PLoS Genet. 2011, 7, e1001345. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chandler, J.C.; Fitzgibbon, Q.P.; Smith, G.; Elizur, A.; Ventura, T. Y-Linked IDmrt1 Paralogue (IDMY) in the Eastern Spiny Lobster, Sagmariasus Verreauxi: The First Invertebrate Sex-Linked Dmrt. Dev. Biol. 2017, 430, 337–345. [Google Scholar] [CrossRef]
- De Vos, S.; van Stappen, G.; Sorgeloos, P.; Vuylsteke, M.; Rombauts, S.; Bossier, P. Identification of Salt Stress Response Genes Using the Artemia Transcriptome. Aquaculture 2019, 500, 305–314. [Google Scholar] [CrossRef]
- Altschul, S.F.; Madden, T.L.; Schäffer, A.A.; Zhang, J.; Zhang, Z. Gapped BLAST and PSI-BLAST: A New Generation of Protein Database Search Programs. Nucleic Acids Res. 1997, 25, 3389–3402. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lemoine, F.; Correia, D.; Lefort, V.; Doppelt-Azeroual, O.; Mareuil, F.; Cohen-Boulakia, S.; Gascuel, O. NGPhyloge-ny.Fr: New Generation Phylogenetic Services for Non-Specialists. Nucleic Acids Res. 2019, 47, W260–W265. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yi, W.; Zarkower, D. Similarity of DNA Binding and Transcriptional Regulation by Caenorhabditis Elegans MAB-3 and Drosophila Melanogaster DSX Suggests Conservation of Sex Determining Mechanisms. Development 1999, 126, 873–881. [Google Scholar] [CrossRef]
- Bayrer, J.R.; Zhang, W.; Weiss, M.A. Dimerization of Doublesex Is Mediated by a Cryptic Ubiquitin-Associated Domain Fold: Implications for Sex-Specific Gene Regulation. J. Biol. Chem. 2005, 280, 32989–32996. [Google Scholar] [CrossRef] [Green Version]
- An, W.; Cho, S.; Ishii, H.; Wensink, P.C. Sex-Specific and Non-Sex-Specific Oligomerization Domains in Both of the Doublesex Transcription Factors from Drosophila Melanogaster. Mol. Cell. Biol. 1996, 16, 3106–3111. [Google Scholar] [CrossRef] [Green Version]
- De Vos, S. Genomic Tools and Sex Determination in the Extremophile Brine Shrimp Artemia franciscana. Ph.D. Thesis, Faculty of Bioscience Engineering, Ghent University, Ghent, Belgium, 2014. [Google Scholar]
- Kato, Y.; Kobayashi, K.; Oda, S.; Colbourn, J.K.; Tatarazako, N.; Watanabe, H.; Iguchi, T. Molecular Cloning and Sexually Dimorphic Expression of DM-Domain Genes in Daphnia Magna. Genomics 2008, 91, 94–101. [Google Scholar] [CrossRef]
- Kiuchi, T.; Koga, H.; Kawamoto, M.; Shoji, K.; Sakai, H.; Arai, Y. A Single Female-Specific PiRNA Is the Primary Determiner of Sex in the Silkworm. Nature 2014, 509, 633–636. [Google Scholar] [CrossRef] [PubMed]
- Nong, Q.D.; Matsuura, T.; Kato, Y.; Watanabe, H. Two Doublesex1 Mutants Revealed a Tunable Gene Network Underlying Intersexuality in Daphnia magna. PLoS ONE 2020, 15, e0238256. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Li, B.; Singh, R.; Narendra, U.; Zhu, L.; Weiss, M.A. Regulation of Sexual Dimorphism: Mutational and Chemogenetic Analysis of the Doublesex DM Domain. Mol. Cell. Biol. 2006, 26, 535–547. [Google Scholar] [CrossRef] [Green Version]
- Duan, J.; Xu, H.; Guo, H.; O’Brochta, D.A.; Wang, F.; Ma, S.; Zhang, L.; Zha, X.; Zhao, P.; Xia, Q. New Insights into the Genomic Organization and Splicing of the Doublesex Gene, a Terminal Regulator of Sexual Differ-entiation in the Silkworm Bombyx Mori. PLoS ONE 2013, 8, e79703. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Duan, J.; Xu, H.; Wang, F.; Ma, S.; Zha, X.; Guo, H.; Zhao, P.; Xia, Q. Novel Female-Specific Trans-Spliced and Al-ternative Splice Forms of Dsx in the Silkworm Bombyx Mori. Biochem. Biophys. Res. Commun. 2013, 431, 630–635. [Google Scholar] [CrossRef] [PubMed]
Genes | Gene-Specific Primers (5′-3′) | Size in bp |
---|---|---|
Doublesex-1 (Dmrt93B) | For: ATCCTTTGGGACAATGGATGTTACACTC Rev: CTTTCATAGTGTTGTCAAAACGCGC | 903 |
Doublesex-2 (Dmrt99B) | For: TGGGAGAGAGACAGGAATGTAAATACATAC Rev: GCAGCTCTGAGTGATACCAAAAAATTAAG | 1459 |
Doublesex-3 | For: ATATGAAGTGAGCAATGGTGATACGC Rev CGAATTCGTTTAATCACACATTTAAGGCCAC | 1169 |
Af.dsx-4 | Af.dsxF-For: TCTTCAACCATGAAAACAAACAGGCATCTACC Af.dsxF-Rev-A: ATGTTTTCTGGTGTCTTCTCTGTCACAAC | 920 |
Af.dsx4-For: TCTTCAACCATGAAAACAAACAGGCATCTACC Af.dsx4-Rev-B: AGAAAGAGATGGTGGAAATTGC | 1010 | |
Af.dsxM-For: AGTTCGGTTTGTGGTTCCTCACGG Af.dsxM-Rev-C: CAGGCCAATTTTTTGAATATTATCTAGAAGC | 1124 | |
Doublesex-5 | For: CTACTATCTTACACCTAAGTGCGCCTGAG Rev: GCAACGATTGAAGAGAAATGGGAAAGGATC | 918 |
Doublesex-6 (Dmrt11E) | For: GATTAAACGAACTAAGGCCAGAGAGA Rev: CACAAAGAACGAAAATAAGAAACTAACACAC | 966 |
Tubulin | For: GCAGTGGTCTACAAGGTTTC | 605 |
Rev: TGCATTGACGTCTTTTGGTACGACATCTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Viet, D.N.; Christiaens, O.; De Vos, S.; Smagghe, G.; Bossier, P. The Sex-Specific Splicing of Doublesex in Brine Shrimp Artemia franciscana. Genes 2022, 13, 1997. https://doi.org/10.3390/genes13111997
Viet DN, Christiaens O, De Vos S, Smagghe G, Bossier P. The Sex-Specific Splicing of Doublesex in Brine Shrimp Artemia franciscana. Genes. 2022; 13(11):1997. https://doi.org/10.3390/genes13111997
Chicago/Turabian StyleViet, Dung Nguyen, Olivier Christiaens, Stephanie De Vos, Guy Smagghe, and Peter Bossier. 2022. "The Sex-Specific Splicing of Doublesex in Brine Shrimp Artemia franciscana" Genes 13, no. 11: 1997. https://doi.org/10.3390/genes13111997
APA StyleViet, D. N., Christiaens, O., De Vos, S., Smagghe, G., & Bossier, P. (2022). The Sex-Specific Splicing of Doublesex in Brine Shrimp Artemia franciscana. Genes, 13(11), 1997. https://doi.org/10.3390/genes13111997