Next Article in Journal
Genome-Wide Association Study of Exercise-Induced Fat Loss Efficiency
Previous Article in Journal
Reclassification of DMD Duplications as Benign: Recommendations for Cautious Interpretation of Variants Identified in Prenatal Screening
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Regulation of Proliferation and Apoptosis of Hair Follicle Stem Cells by miR-145-5p in Yangtze River Delta White Goats

Key Laboratory for Animal Genetics & Molecular Breeding of Jiangsu Province, College of Animal Science and Technology, Yangzhou University, Yangzhou 225009, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Genes 2022, 13(11), 1973; https://doi.org/10.3390/genes13111973
Submission received: 17 September 2022 / Revised: 19 October 2022 / Accepted: 23 October 2022 / Published: 28 October 2022
(This article belongs to the Section Animal Genetics and Genomics)

Abstract

Yangtze River Delta white goats are the sole goat breed producing brush hair of high quality. The gene DUSP6 has been extensively studied in tumor cells but rarely in hair follicle stem cells (HFSCs). Per the previous sequencing data, it was determined that DUSP6 expression was up-regulated in superior-quality brush hair tissues, confirming it as a candidate gene associated with this trait. The targeting relationship of miR-145-5p with DUSP6 was determined based on online database prediction and was authenticated using a dual-luciferase gene reporter assay and quantitative reverse-transcription PCR (RT-qPCR). The regulatory effect of miR-145-5p on the growth of HFSCs was determined by targeting DUSP6 with RT-qPCR, 5-ethynyl-2′-deoxyuridine assays, Western blotting, and flow cytometry. The proliferation of HFSCs was inhibited and their apoptosis capacity was enhanced due to the presence of miR-145-5p. Therefore, it was proposed that this may have occurred through a repression effect of DUSP6 on the MAPK signaling pathway. The regulatory network of the HFSCs can be further understood using the theoretical basis established by the findings derived from this study.

1. Introduction

1.1. Yangtze River Delta White Goat

The main goat breed belonging to the Yangtze River Delta is the Yangtze River Delta white goat, also known as Haimen goats [1]. This rare breed occurs in China and produces excellent skin, meat, and hair. These goats show early maturity, prolificacy, and roughage resistance. The goats are of medium size, with a triangular head, a small and upturned tail, slender limbs, and a dense coat of hair. The wool is white, only slightly curved, and shiny, and it is frequently used to produce writing brushes, thus termed “brush hair”. At present, brush hairs are divided into three categories, mainly according to the hair body thickness, length, and color, i.e., low-, medium-, and superior-grade hair [2]. The main difference is that the superior-quality brush hair has no medulla, while the others have a few medulla. The superior-quality brush hair, which is an extremely scarce resource, can be used to produce high-quality writing brushes.

1.2. Hair Follices and Hair Follice Stem Cells

In the dermal papillae of mammals, the hair root is surrounded by inner and outer hair sheaths, and the outer hair sheaths are surrounded by connective tissue cells, forming a pocket termed the hair follicle [3]. Hair follicles comprise various parts of the hair, such as the shaft, root, bulb, papilla, and hair matrix. The part of the outer sheath surrounding the root of the hair follicle that bulges out contains hair follicle stem cells (HFSCs), which are influenced by many types of hair follicle cells [4]. The regeneration of hair depends on HFSC activation [5]. HFSCs can develop into hair follicles, the epidermis, and sebaceous glands, and they can move down to the hair matrix area to mature into progenitor cells and produce hair follicles and hair shafts.
Micro-RNAs (miRNA) are small noncoding RNAs of approximately 22 nucleotides that are involved in gene regulation and thereby participate in many mechanisms presenting in the body, which include the proliferation, differentiation, and apoptosis of cells [6]. Many miRNAs have been confirmed to be related to hair follicle development, including miR-218-5p, miR-203a-3p, as well as miR-149-5p [7,8,9]. A member of the miR-145 family, miR-145-5p has been studied extensively in association with tumors, hypertension, myasthenia gravis, and psoriasis [10,11,12]. This micro-RNA can exert inhibitory effects on colorectal cancer by binding to metastasis-associated colon cancer-1 [13] and can stop the progression of breast cancer through the inhibition of SOX2 [14]. However, there is less research on the functions of miR-145-5p in hair follicles [15].
Mitogen-activated protein kinase is an important signaling pathway regarding hair growth, and dual specific phosphatase 6 (DUSP6) is a suppressor of extracellular signal-regulated kinase, a key gene within this pathway. DUSP6 was considered to be a candidate gene associated with hair traits in the aforementioned goat breed that caused the generation of superior-quality brush hair, considering the pronounced differences in its expression among goats with brush hair of superior and inferior quality. The aforementioned gene was screened and identified. miR-145-5p targets the DUSP6 gene, as determined by the bioinformatics tools for analyses and prediction functions [16]. The DUSP6 gene was utilized to examine the potential regulatory functions of miR-145-5p in HFSCs in the specific white goat breed. Specifically, the apoptosis and proliferation status of cells, as well as cell cycle progression, were examined to elucidate the effects of miR-145-5p on these processes. The expression and inhibition of miR-145-5p were examined and its role in HFSCs was investigated for the purpose of determining its effect during the growth and development of HFSCs. The mechanism involved in the generation of brush hair of a superior quality associated with the aforementioned goat breed can be further examined using the results of this study. This research also established a basis for investigating the genetic mechanism of superior-quality brush hair.

2. Materials and Methods

2.1. Experimental Animals and Sample Collection

The Haimen National Goat Farm (Haimen, China) provided the Yangtze River Delta white goats. All experiments on the animals were carried out as per the approval and strict guidelines of the Animal Protection and Use Committee of Yangzhou University (permit number: SYXK [Su] IACUC2012-0029). Skins with brush hair of superior, as well as normal, quality were acquired from the cervical spines of 6 male goats (half-siblings, aged 6–8 months), with three samples of each skin type. The hair was shaved with scalpels, and the cervical spine skin was disinfected with 75% alcohol. The complete cervical spine skin tissues were cut to the size of 1 cm × 1 cm, cleaned with PBS, and immediately placed into liquid nitrogen, utilized for the purpose of preserving the tissue samples until their processing and analysis.

2.2. Total RNA Extraction and Reverse-Transcription Quantitative PCR (RT-qPCR)

The extraction of total RNA and reverse transcription into cDNA were carried out. The former process utilized the RNAiso Plus reagent (Takara, Tokyo, Japan). The TB Green® Premix Ex Taq™ II (Takara) was utilized to conduct the RT-qPCR. The 2−ΔΔCt methodology was employed to determine and measure the relative gene expression, with GAPDH as an internal control. The Primer information are in Table 1.

2.3. Cell Culture and Transfection for Overexpression or Knockdown

As described previously, tissues of the cervical spine of the goats were used for the isolation of HFSCs, which were then cultured. The culture fluid comprised 1 mL penicillin–streptomycin, 5 mL fetal bovine serum (Gibco, Grand Island, NY, USA), and DMEM/F12 (Gibco) to reach a final volume of 50 mL. The cells were cultured at 37 °C and 5% CO2 in an incubator. Afterward, the miR-145-5p mimics and inhibitors (Gene Pharma, Suzhou, China) and the corresponding control group were transfected as per the manufacturer’s instructions for the Lipofectamine 3000 kit (Invitrogen, Carlsbad, CA, USA). The cells, upon reaching 70–80% confluence, were then transfected and the Opti-MEM medium (Gibco) was utilized for the culturing and incubation of the cells for 6 h. Afterward, the culture medium was replaced with a freshly produced complete medium for cultivation for a duration of 96 h. Thereafter, stem cells were harvested at intervals of 24 h. All HFSC cultures were performed using at least three replicates. RNA oligonucleotide sequence information are in Table 2.

2.4. Flow Cytometry Analysis of the Cell Cycle and Apoptosis

Six-well plates (1 × 106 cells/well) were utilized to culture the HFSCs in two mL of culture medium, wherein transfection took place for 48 h. Afterward, trypsin was used to digest the collected culture for 5 min and it was centrifuged at 1000× g for 5 min, with the supernatant being aspirated afterward. The cells were resuspended by adding approximately 1 mL of pre-cooled 1 × PBS (Solarbio, Beijing, China) and centrifuging the mixture again at 1000× g for 5 min. Then, 1 mL of pre-cooled ethanol (70%) was utilized to resuspend the cells and they were incubated overnight at 4 °C. PBS was utilized to wash the obtained cells, and a cell suspension using 500 μL propidium iodide (PI; Beyotime, Shanghai, China) staining buffer was formed, which was then incubated in the dark (37 °C for 30 min). The FACS LSRFortessa device (BD BioSciences, San Jose, CA, USA) was utilized in flow cytometry to probe into cell suspensions. Three independent replicate experiments were used per treatment.
Assays for apoptosis were also carried out for HFSCs by employing Annexin V-FITC/PI staining. The cells were left for 6 h for transfection and incubation and then the culture was continued with a complete medium for 48 h. Afterward, one mL 1 × PBS (pH 7.4) was utilized to wash the cells only once, and they were then digested with trypsin until they could be easily removed, placed in 1.5 mL Eppendorf tubes, and washed again with 1 mL 1 × PBS once, and 1 mL 1 × PBS was utilized to form a cell suspension. The incubation procedures of the isolated cells with Annexin V-FITC and PI, at 5 μL and 10 μL, respectively, were carried out at room temperature in a dark environment for 10 min. A flow cytometer (Beckman Coulter, Brea, CA, USA) was utilized to analyze the cells’ apoptosis.

2.5. 5-Ethynyl-2′-Deoxyuridine (EdU) Assay

After the cells were transfected, 24-well plates (2 × 105 cells/well) were utilized to culture the cells. HFSCs were cultured for 24 h in a culture medium (0.5 mL media) that contained all the essentials and 10 µL EdU reagent. The EdU cell proliferation kit (RiboBio, Guangzhou, China) was utilized per the kit’s directions, and the staining results were obtained with inverted fluorescence microscopy. The cells were analyzed for EdU positivity using ImageJ software. Each treatment was performed using three replicates, and all imaging parameters were consistent.

2.6. Western Blotting (WB)

The protein from HFSCs of the different treatment groups was extracted by utilizing buffers such as 1% phenylmethylsulfonyl fluoride (Solarbio) and radioimmunoprecipitation assay protein lysis buffer to obtain the total protein. The solutions were then centrifuged at a rate of 13,000× g to obtain the protein fractions at 4 °C for 5 min, the protein content was quantified, and, finally, the relevant proteins were detected. The BCA protein analysis kit (Solarbio) and sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) were employed to measure and filter out the different proteins, respectively. In the latter process, 20 μg protein was filtered by 8% or 10% SDS-PAGE and was then shifted to membranes of polyvinylidene fluoride. The membranes were blocked (5% skim milk, room temperature, 1 h) and overnight incubation with primary antibodies at 4 °C was carried out for the purpose of detecting relevant proteins. The primary antibodies utilized were antibodies anti-cyclin-dependent kinase 1 (CDK1) (MW: 34 kDa, Abcam, 1:1000 dilution), anti-proliferating cell nuclear antigen (PCNA) (MW: 29 kDa, Abcam, Cambridge, UK, 1:1000), anti-cyclin D2 (CCND2) (MW: 33 kDa, Abcam, 1:1000), anti-BAX (MW: 21 kDa, Abcam, 1:5000), and anti-BCL2 (BCL2 apoptosis regulator) (MW: 26 kDa, Proteintech, Rosemont, IL, USA), and anti-DUSP6 (MW: 42/44 kDa, Abcam, 1:1000) and anti-β-actin (MW: 42 kDa, 1:500 dilution; Abcam) were used as loading controls. After the incubation, 1 × Tris-buffered saline buffer containing Tween 20 was utilized to wash the membranes. Afterward, incubation with secondary antibodies was conducted for 1 h. These antibodies were labeled with horseradish peroxidase and included a goat-specific anti-rabbit antibody and a rabbit-specific anti-goat antibody (1:5000 dilution; Bioworld, Nanjing, China). The Super-Enhanced ECL reagent (BioSharp, Hefei, China) was employed to visualize the protein bands, whereas the Fluor Chem FC3 system (Protein-Simple, San Jose, CA, USA) was utilized to analyze the protein bands.

2.7. Dual Luciferase Gene Reporter Assay

The coding sequence and 3′-untranscribed region (UTR) of goat DUSP6 downloaded from NCBI were amplified and cloned into the luciferase reporter vector psi-CHECK-2 (Promega, Madison, WI, USA). Then, the site utilized for binding by miR-145-5p was changed from GGACCAAA to GCTGGTAA to obtain the mutant DUSP6 3′-UTR luciferase reporter vector. The transfection of proteins, both mutant and wild-type, into 293T cells with miR-145-5p (synthesized by GenePharma, Suzhou, China) was performed to detect luciferase activity. Table 1 displays the primers utilized in this experiment.

2.8. Statistical Analyses

The SPSS v24 software (IBM, Armonk, NY, USA) was employed to carry out t-tests and one-way ANOVA. Significance is reported at p < 0.05.

3. Results

3.1. miR-145-5p Inhibits Goat HFSC Proliferation

To investigate the regulatory function of miR-145-5p on the proliferation of Yangtze Delta white goat HFSCs, knockdown experiments and overexpression of miR-145-5p were performed. In terms of proliferation, RT-qPCR demonstrated that the overexpression of the concerned miRNA (miR-145-5p) significantly decreased the relative expression of marker genes associated with proliferation, such as PCNA, CDK1, and CCND2 (Figure 1A); however, the expression of the marker genes increased in the knockdown group (Figure 2A). Concerning proteins, the WB results were consistent, and the relative protein expression of PCNA, CDK1, and CCND2 was reduced in the overexpression group (Figure 1B). Similar to the relative mRNA levels, the relative protein levels were significantly increased in the knockdown group (Figure 2B). Flow cytometry showed a reduction in S-phase cells and an increasing trend in G0/G1 phase cells in the overexpression group. In the knockdown group, a decrease in S-phase cells and a decreasing trend in G0/G1-phase cells were observed (Figure 2C–E). The quantity of EdU-positive cells was significantly decreased in the concerned micro-RNA upregulated group (Figure 1F) and increased in the downregulated group (Figure 2F). These results indicated that HFSC proliferation can be inhibited by the overexpression of miR-145-5p and promoted by miR-145-5p downregulation.

3.2. miR-145-5p Induces Goat HFSC Apoptosis

The regulatory function concerning the apoptosis of HFSCs of miR-145-5p in Yangtze Delta white goats was examined by separate knockdown and overexpression experiments. miR-145-5p overexpression considerably enhanced the relative expression of the mRNA of BAX and significantly decreased the expression of BCL2, a marker gene of apoptosis (p < 0.01; Figure 3A). Conversely, a considerable increase in the expression of the marker genes in the knockdown group was detected (Figure 3C). The WB results were consistent, and the relative BCL2 protein level was reduced in the overexpression group (Figure 3B). WB showed the same result (Figure 3D). At the cellular level, the apoptotic cell rate was considerably enhanced in the mimic group and showed a decreasing trend in the inhibitor group (Figure 3E–H), which was consistent with the RT-qPCR and WB results.

3.3. DUSP6 Is a Direct Target Gene of miR-145-5p

The association between DUSP6 and miR-145-5p was investigated utilizing miR-145-5p mimics transfected with DUSP6 wild-type vector and DUSP6 mutant-type vector transferred into 293T cells. A dual luciferase gene reporter assay regarding these miRNA mimics indicated a remarkable attenuation in luciferase activity in the wild-type vector, but no considerable variations in the activity of the mutant vector were observed (Figure 4A), indicating the direct targeting of DUSP6 by the miRNA. At the protein level, the WB results were consistent, and the relative protein expression of DUSP6 was reduced in the overexpression group (Figure 4B) but was increased in the knockdown group (Figure 4C). It also showed that miR-145-5p can directly target DUSP6.

4. Discussion

4.1. DUSP6 Plays a Key Role in MAPK Signal Pathway

The regulation of MAPK pathway activity has been associated with the protein family DUSP through the dephosphorylation of key pathway proteins [17]. The regulation of the expression of DUSP family members and their activity controls the intensity and duration of MAPK and thus defines the physiological response [18]. DUSP6, also known as MKP-3, belongs to the protein family DUSP and performs a key function in tumorigenesis [19]. DUSP6 exerts crucial physiological regulatory functions in the MAPK pathway [20,21,22], and it can regulate MAPK pathway activity by binding to ERK1/2 and inactivating ERK1/2 through negative feedback regulation. DUSP6 can also negatively regulate MAPK signaling by dephosphorylating tyrosine or serine/threonine residues on MAPK [18]. DUSP6 regulates MAPK pathway activity and has shown a considerable influence on the development of hair follicles. Interestingly, the results confirmed DUSP6 as a gene targeted by miR-145-5p through prediction and screening by means of bioinformatics tools, dual luciferase reporter gene analysis, RT-qPCR, and WB. The differentially expressed gene DUSP6 was associated with the MAPK pathway of Yangtze Delta white goats concerning the quality of brush hair, linking this pathway’s role with the generation of superior-grade hair. In our previous study, DUSP6 expression in the skin of goats of the aforementioned breed was higher in the case of brush hair of superior grade, while it was lower in goats with low-quality brush hair [23]. Furthermore, miR-145-5p can be linked to the generation of brush hair of a superior grade, as well as regulation of the development of hair follicles via the mechanism of proliferation inhibition of HFSCs in the aforementioned goat breed, as depicted by the present experimental results. The quality of the brush hair depends on the hair follicle’s development and growth. It is a very complex process involving many factors, such as the underlying biochemical and physiological processes. Therefore, as per these results, it is suggested that miR-145-5p affects the MAPK signaling pathway for hair growth and development by affecting the production of DUSP6 in various ways.

4.2. miR-145-5p Targets DUSP6 to Regulate the Proliferation of HFSCs

miR-145-5p belongs to the miR-145 family, which can affect gastric cancer differentiation by directly targeting Krüppel-like factor 5 [24]. The patterns of miR-31-5p and miR-149-5P expression in HFSCs are contrary to those of miR-145-5p [1,25]; by contrast, miR-1-3p is expressed in HFSCs in a similar pattern as that of miR-145-5p. These studies suggest that different miRNAs have different regulatory effects on the growth and hair follicle development of goat HFSCs [26]. According to the results of this research, overexpression of miR-145-5p in the HFSCs of Yangtze River Delta white goats inhibited the expression of PCNA, CDK1, CCND2, and other proliferation marker genes and promoted the expression of BAX and BCL2. According to EdU assays, cell proliferation is inhibited after miR-145-5p overexpression. According to the cell cycle results, the number of S-phase cells in the miR-145-5p overexpression group was considerably increased over that in the control group, whereas the number of G1- and G2-phase cells showed a decreasing trend, which was, however, not significant. In comparison with the control group, the apoptosis status was increased significantly following the overexpression of miR-145-5p. This was in line with the RT-qPCR and WB results, signifying that miR-145-5p can specifically bind to DUSP6, resulting in reduced DUSP6 expression. It was also consistent with the WB and double fluorescence results of the current study, suggesting a strong link between miR-145-5p and DUSP6. miR-145-5p thus directly targets DUSP6, which, as a crucial link in the MAPK signaling pathway, is important for HFSC growth and development. Furthermore, miR-145-5p overexpression lowers DUSP6 expression levels in HFSCs, and activation of the MAPK signaling pathway is inhibited, thus affecting HFSC and hair follicle growth and development. miR-145-5p exerts a regulatory role in the Wnt/β-catenin signaling pathway, which regulates the growth and development of HFSCs [12,27,28]. It is proposed that miR-145-5p may also inhibit HFSC proliferation through the Wnt/β-catenin signaling pathway.
This study aimed to find miRNAs that regulate the formation of high-quality pencil hair traits targeting key genes (DUSP6) and, through research on the function and expression regulation of miRNAs, to construct the regulation mode of miR-145-5p in the formation of high-quality pencil hair traits, so as to further clarify the molecular mechanism of high-quality pencil hair traits. The results obtained can also provide a reliable basis for the accurate molecular breeding of white goats in the Yangtze River Delta. Furthermore, this study provides a relevant basis for the study of hair loss in medicine.

5. Conclusions

As per the results of this study, miR-145-5p can directly target DUSP6 to further inhibit the growth and proliferation and promote the apoptosis of HFSCs in goats. The findings of this research confirmed that miR-145-5p plays a role in the regulation of HFSCs regarding apoptosis and proliferation in Yangtze River Delta white goats. The molecular processes that regulate the hair traits thus affect the quality of the brush hair and can be examined and elucidated even further utilizing the theoretical basis provided by this study.

Author Contributions

Data curation, Y.K., J.Q. and D.J.; Methodology, X.S.; Software, Q.W.; Writing—original draft, X.W. and J.W.; Writing—review and editing, Y.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by [National Natural Science Foundation of China] grant number [32172690, 31572355]; [the Innovation Project of Graduate Students at Yangzhou University] grant number [XKYCX20_027]. The APC was funded by Yong-jun Li.

Institutional Review Board Statement

The Committee of Animal Protection and Use at Yangzhou University (Permit No.: SYXK [Su] IACUC2012-0029).

Informed Consent Statement

Not applicable.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.

Acknowledgments

The support for this study was provided by the Innovation Project of Graduate Students at Yangzhou University (XKYCX20_027), a Project Fund from the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD, 2014-134), and grants from the National Natural Science Foundation of China (32172690, 31572355).

Conflicts of Interest

No competing interests are declared by the author.

References

  1. Wang, J.; Wu, X.; Sun, X.; Zhang, L.; Wang, Q.; Qu, J.; Wang, Y.; Li, Y. The Circular RNA CircCOL1A1 Functions as a miR-149-5p Sponge to Regulate the Formation of Superior-Quality Brush Hair via the CMTM3/AR Axis. Front. Cell Dev. Biol. 2022, 10, 760466. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Wang, J.; Wu, X.; Kang, Y.; Zhang, L.; Niu, H.; Qu, J.; Wang, Y.; Ji, D.; Li, Y. Integrative analysis of circRNAs from Yangtze River Delta white goat neck skin tissue by high-throughput sequencing (circRNA-seq). Anim. Genet. 2022, 53, 405–415. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Krause, K.; Foitzik, K. Biology of the hair follicle: The basics. Semin. Cutan. Med. Surg. 2006, 25, 2–10. [Google Scholar] [PubMed]
  4. Schneider, M.R.; Schmidt-Ullrich, R.; Paus, R. The hair follicle as a dynamic miniorgan. Curr. Biol. 2009, 19, R132–R142. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Hsu, Y.C.; Pasolli, H.A.; Fuchs, E. Dynamics between stem cells, niche, and progeny in the hair follicle. Cell 2011, 144, 92–105. [Google Scholar] [CrossRef] [Scilit]
  6. Fabian, M.R.; Sonenberg, N.; Filipowicz, W. Regulation of mRNA translation and stability by microRNAs. Annu. Rev. Biochem. 2010, 79, 351–379. [Google Scholar] [CrossRef] [Scilit]
  7. Luo, Z.; Dou, J.; Xie, F.; Lu, J.; Han, Q.; Zhou, X.; Kong, J.; Chen, D.; Liu, A. miR-203a-3p promotes loureirin A-induced hair follicle stem cells differentiation by targeting Smad1. Anat. Rec. (Hoboken) 2021, 304, 531–540. [Google Scholar] [CrossRef] [Scilit]
  8. Wang, J.; Qu, J.; Li, Y.; Feng, Y.; Ma, J.; Zhang, L.; Chu, C.; Hu, H.; Wang, Y.; Ji, D. miR-149-5p Regulates Goat Hair Follicle Stem Cell Proliferation and Apoptosis by Targeting the CMTM3/AR Axis During Superior-Quality Brush Hair Formation. Front. Genet. 2020, 11, 529757. [Google Scholar]
  9. Hu, S.; Li, Z.; Lutz, H.; Huang, K.; Su, T.; Cores, J.; Dinh, P.C.; Cheng, K. Dermal exosomes containing miR-218-5p promote hair regeneration by regulating beta-catenin signaling. Sci. Adv. 2020, 6, eaba1685. [Google Scholar]
  10. Jing, X.; Wu, S.; Liu, Y.; Wang, H.; Huang, Q. Circular RNA Sirtuin1 represses pulmonary artery smooth muscle cell proliferation, migration and autophagy to ameliorate pulmonary hypertension via targeting microRNA-145-5p/protein kinase-B3 axis. Bioengineered 2022, 13, 8759–8771. [Google Scholar]
  11. Li, S.; Wang, X.; Wang, T.; Zhang, H.; Lu, X.; Liu, L.; Li, L.; Bo, C.; Kong, X.; Xu, S.; et al. Identification of the regulatory role of lncRNA HCG18 in myasthenia gravis by integrated bioinformatics and experimental analyses. J. Transl. Med. 2021, 19, 468. [Google Scholar] [CrossRef] [Scilit]
  12. Wang, Y.; Cao, Y. miR-145-5p inhibits psoriasis progression by regulating the Wnt/beta-catenin pathway. Am. J. Transl. Res. 2021, 13, 10439–10448. [Google Scholar]
  13. Zhang, T.; Yu, S.; Zhao, S. Hsa_circ_0005100 regulates tumorigenicity of colorectal carcinoma via miR-145-5p/MACC1 axis. J. Clin. Lab. Anal. 2022, 36, e24533. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Tang, W.; Zhang, X.; Tan, W.; Gao, J.; Pan, L.; Ye, X.; Chen, L.; Zheng, W. miR-145-5p Suppresses Breast Cancer Progression by Inhibiting SOX2. J. Surg. Res. 2019, 236, 278–287. [Google Scholar] [CrossRef] [Scilit]
  15. Shang, F.; Wang, Y.; Ma, R.; Rong, Y.; Wang, M.; Wu, Z.; Hai, E.; Pan, J.; Liang, L.; Wang, Z.; et al. Screening of microRNA and mRNA related to secondary hair follicle morphogenesis and development and functional analysis in cashmere goats. Funct. Integr. Genom. 2022, 22, 835–848. [Google Scholar] [CrossRef] [Scilit]
  16. Ji, D.; Yang, B.; Li, Y.; Cai, M.; Zhang, W.; Cheng, G.; Guo, H. Transcriptomic inspection revealed a possible pathway regulating the formation of the high-quality brush hair in Chinese Haimen goat (Capra hircus). R. Soc. Open Sci. 2018, 5, 170907. [Google Scholar] [CrossRef] [Scilit]
  17. Camps, M.; Nichols, A.; Arkinstall, S. Dual specificity phosphatases: A gene family for control of MAP kinase function. FASEB J. 2000, 14, 6–16. [Google Scholar] [CrossRef] [Scilit]
  18. Wang, H.; Liu, D.; Sun, Y.; Meng, C.; Tan, L.; Song, C.; Qiu, X.; Liu, W.; Ding, C.; Ying, L. Upregulation of DUSP6 impairs infectious bronchitis virus replication by negatively regulating ERK pathway and promoting apoptosis. Vet. Res. 2021, 52, 7. [Google Scholar] [CrossRef] [Scilit]
  19. Ahmad, M.K.; Abdollah, N.A.; Shafie, N.H.; Yusof, N.M.; Razak, S.R.A. Dual-specificity phosphatase 6 (DUSP6): A review of its molecular characteristics and clinical relevance in cancer. Cancer Biol. Med. 2018, 15, 14–28. [Google Scholar]
  20. Denu, J.M.; Dixon, J.E. A catalytic mechanism for the dual-specific phosphatases. Proc. Natl. Acad. Sci. USA 1995, 92, 5910–5914. [Google Scholar] [CrossRef] [Scilit]
  21. Zhan, X.L.; Wishart, M.J.; Guan, K.L. Nonreceptor tyrosine phosphatases in cellular signaling: Regulation of mitogen-activated protein kinases. Chem. Rev. 2001, 101, 2477–2496. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Li, C.; Scott, D.A.; Hatch, E.; Tian, X.; Mansour, S.L. Dusp6 (Mkp3) is a negative feedback regulator of FGF-stimulated ERK signaling during mouse development. Development 2007, 134, 167–176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Guo, H.; Cheng, G.; Li, Y.; Zhang, H.; Qin, K. A Screen for Key Genes and Pathways Involved in High-Quality Brush Hair in the Yangtze River Delta White Goat. PLoS ONE 2017, 12, e0169820. [Google Scholar] [CrossRef] [Scilit]
  24. Zhou, T.; Chen, S.; Mao, X. miR-145-5p affects the differentiation of gastric cancer by targeting KLF5 directly. J. Cell. Physiol. 2019, 234, 7634–7644. [Google Scholar] [CrossRef] [Scilit]
  25. Feng, Y.; Wang, J.; Ma, J.; Zhang, L.; Chu, C.; Hu, H.; Wang, Y.; Li, Y. miR-31-5p promotes proliferation and inhibits apoptosis of goat hair follicle stem cells by targeting RASA1/MAP3K1 pathway. Exp. Cell Res. 2021, 398, 112441. [Google Scholar] [CrossRef] [Scilit]
  26. Zhang, G.; Xu, J.; Zhang, Y.; Yang, S.; Jiang, H. Expression of miRNA-1-3p and its target gene in hair follicle cycle development of Liaoning Cashmere goat. Anim. Biotechnol. 2022, 1–6. [Google Scholar] [CrossRef] [Scilit]
  27. Yang, L.; Peng, R. Unveiling hair follicle stem cells. Stem. Cell Rev. Rep. 2010, 6, 658–664. [Google Scholar] [CrossRef] [Scilit]
  28. Kang, J.I.; Kim, M.K.; Lee, J.H.; Jeon, Y.J.; Hwang, E.K.; Koh, Y.S.; Hyun, J.W.; Kwon, S.Y.; Yoo, E.S.; Kang, H.K. Undariopsis peterseniana Promotes Hair Growth by the Activation of Wnt/beta-Catenin and ERK Pathways. Mar. Drugs 2017, 15, 130. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Inhibition of stem cell proliferation of goat hair follicles by miR-145-5p. (A) RT-qPCR quantified the expression of marker genes (CDK1, PCNA, CCND2) following miR-145-5p overexpression. (B) Western blotting showed the expression of proliferation marker genes (CDK1, PCNA, CCND2) following transfection with miR-145-5p mimics. (C) Cell cycle detection by flow cytometry following miR-145-5p upregulation. (D,E) The distribution of the three phases. (F) Distribution and rate of EdU-positive cells. No asterisk, p > 0.05; *, p < 0.05.
Figure 1. Inhibition of stem cell proliferation of goat hair follicles by miR-145-5p. (A) RT-qPCR quantified the expression of marker genes (CDK1, PCNA, CCND2) following miR-145-5p overexpression. (B) Western blotting showed the expression of proliferation marker genes (CDK1, PCNA, CCND2) following transfection with miR-145-5p mimics. (C) Cell cycle detection by flow cytometry following miR-145-5p upregulation. (D,E) The distribution of the three phases. (F) Distribution and rate of EdU-positive cells. No asterisk, p > 0.05; *, p < 0.05.
Genes 13 01973 g001
Figure 2. miR-145-5p knockdown promotes goat HFSC proliferation. (A) RT-qPCR quantified the expression of marker genes (CDK1, PCNA, CCND2) following miR-145-5p downregulation. (B) Western blotting showed the proliferation-associated marker genes’ expression levels (CDK1, PCNA, CCND2) following transfection with miR-145-5p inhibitors. (C) Cell cycle detection by flow cytometry following miR-145-5p knockdown. (D,E) The distribution of the three phases. (F) Distribution and rate of EdU-positive cells. No asterisk, p > 0.05; *, p < 0.05; **, p < 0.01.
Figure 2. miR-145-5p knockdown promotes goat HFSC proliferation. (A) RT-qPCR quantified the expression of marker genes (CDK1, PCNA, CCND2) following miR-145-5p downregulation. (B) Western blotting showed the proliferation-associated marker genes’ expression levels (CDK1, PCNA, CCND2) following transfection with miR-145-5p inhibitors. (C) Cell cycle detection by flow cytometry following miR-145-5p knockdown. (D,E) The distribution of the three phases. (F) Distribution and rate of EdU-positive cells. No asterisk, p > 0.05; *, p < 0.05; **, p < 0.01.
Genes 13 01973 g002
Figure 3. miR-145-5p regulates goat HFSC apoptosis. (A) RT-qPCR quantified the expression of marker genes (BAX and BCL2) following miR-145-5p upregulation. (B) Western blotting showed the expression of proliferation marker genes following transfection with miR-145-5p mimics. (C) RT-qPCR was utilized to quantify the marker genes’ expression (BAX and BCL2) following miR-145-5p downregulation. (D) Western blot analysis of the expression of proliferation marker genes following transfection with miR-145-5p inhibitors. (EH) Distribution and proportion of apoptotic cells in the upgrade and knockdown groups. No asterisk, p > 0.05; *, p < 0.05; **, p < 0.01.
Figure 3. miR-145-5p regulates goat HFSC apoptosis. (A) RT-qPCR quantified the expression of marker genes (BAX and BCL2) following miR-145-5p upregulation. (B) Western blotting showed the expression of proliferation marker genes following transfection with miR-145-5p mimics. (C) RT-qPCR was utilized to quantify the marker genes’ expression (BAX and BCL2) following miR-145-5p downregulation. (D) Western blot analysis of the expression of proliferation marker genes following transfection with miR-145-5p inhibitors. (EH) Distribution and proportion of apoptotic cells in the upgrade and knockdown groups. No asterisk, p > 0.05; *, p < 0.05; **, p < 0.01.
Genes 13 01973 g003
Figure 4. Relationship between DUSP6 and miR-145-5p. (A) Dual luciferase gene reporter assay of DUSP6 wild-type vector and DUSP6 mutant-type vector transfected with miR-145-5p mimics. (B,C) Protein expression of DUSP6 in the upgrade and knockdown groups. No asterisk, p > 0.05; *, p < 0.05.
Figure 4. Relationship between DUSP6 and miR-145-5p. (A) Dual luciferase gene reporter assay of DUSP6 wild-type vector and DUSP6 mutant-type vector transfected with miR-145-5p mimics. (B,C) Protein expression of DUSP6 in the upgrade and knockdown groups. No asterisk, p > 0.05; *, p < 0.05.
Genes 13 01973 g004
Table 1. Primer information for quantitative reverse transcription.
Table 1. Primer information for quantitative reverse transcription.
GenePrimer NamePrimer Sequence (5′ to 3′)
PCNA ID:102172276PCNA-FATCAGCTCAAGTGGCGTGAA
PCNA-RTGCCAAGGTGTCCGCATTAT
CDK1 ID:10086361CDK1-FAGATTTTGGCCTTGCCAGAG
CDK1-RAGCTGACCCCAGCAATACTT
CCND2 ID:102180657CCND2-FGGGCAAGTTGAAATGGAA
CCND2-RTCATCGACGGCGGGTAC
BCL2 ID:100861254BCL2-FATGTGTGTGGAGAGCGTCAA
BCL2-RCCTTCAGAGACAGCCAGGAG
Bax
ID:100846984
BAX-FTTTCCGACGGCAACTTCAA
BAX-RTGAGCACTCCAGCCACAAA
GAPDH ID:100860872GAPDH-FAGGTCGGAGTGAACGGATTC
GAPDH-RCCAGCATCACCCCACTTGAT
Table 2. RNA oligonucleotide sequence information.
Table 2. RNA oligonucleotide sequence information.
GenesSequence NameSequence (5′-3′)
miR-145Negative controlUUCUCCGAACGUGUCACGUTT (sense)
ACGUGACACGUUCGGAGAATT (antisense)
MimicsGUCCAGUUUUCCCAGGAAUCCCU (sense)
GGAUUCCUGGGAAAACUGGACUU (antisense)
Inhibitor negative controlCAGUACUUUUGUGUAGUACAA
InhibitorsAGGGAUUCCUGGGAAAACUGGAC
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Wu, X.; Wang, J.; Kang, Y.; Wang, Q.; Qu, J.; Sun, X.; Ji, D.; Li, Y. Regulation of Proliferation and Apoptosis of Hair Follicle Stem Cells by miR-145-5p in Yangtze River Delta White Goats. Genes 2022, 13, 1973. https://doi.org/10.3390/genes13111973

AMA Style

Wu X, Wang J, Kang Y, Wang Q, Qu J, Sun X, Ji D, Li Y. Regulation of Proliferation and Apoptosis of Hair Follicle Stem Cells by miR-145-5p in Yangtze River Delta White Goats. Genes. 2022; 13(11):1973. https://doi.org/10.3390/genes13111973

Chicago/Turabian Style

Wu, Xi, Jian Wang, Yan Kang, Qiang Wang, Jingwen Qu, Xiaomei Sun, Dejun Ji, and Yongjun Li. 2022. "Regulation of Proliferation and Apoptosis of Hair Follicle Stem Cells by miR-145-5p in Yangtze River Delta White Goats" Genes 13, no. 11: 1973. https://doi.org/10.3390/genes13111973

APA Style

Wu, X., Wang, J., Kang, Y., Wang, Q., Qu, J., Sun, X., Ji, D., & Li, Y. (2022). Regulation of Proliferation and Apoptosis of Hair Follicle Stem Cells by miR-145-5p in Yangtze River Delta White Goats. Genes, 13(11), 1973. https://doi.org/10.3390/genes13111973

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop