Genetic Diversity in Casein Gene Cluster in a Dromedary Camel (C. dromedarius) Population from the United Arab Emirates
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals and Sample Collection
2.2. DNA Extraction and PCR Amplification
2.3. Next-Generation Sequencing
2.3.1. Library Preparation and Sequence Data Generation
2.3.2. Data Analysis
3. Results and Discussion
3.1. Analysis of CSN1S1 Genetic Variability
3.2. Analysis of CSN1S2 Genetic Variability
3.3. Analysis of CSN2 Genetic Variability
3.4. Analysis of CSN3 Genetic Variability
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Federal Competitiveness and Statistics Authority: UAE. FCSA Livestock Statistics Vol. 1, 2018. Available online: https://fcsa.gov.ae/en-us/Pages/Statistics/Statistics.aspx (accessed on 20 December 2020).
- Ejtahed, H.S.; Niasari Naslaji, A.; Mirmiran, P.; Zraif Yeganeh, M.; Hedayati, M.; Azizi, F.; Moosavi Movahedi, A. Effect of Camel Milk on Blood Sugar and Lipid Profile of Patients with Type 2 Diabetes: A Pilot Clinical Trial. Int. J. Endocrinol. Metab. 2015, 13, e21160. [Google Scholar] [CrossRef] [Green Version]
- Ebaid, H.; Ahmed, O.M.; Mahmoud, A.M.; Ahmed, R.R. Limiting Prolonged Inflammation During Proliferation and Remodeling Phases of Wound Healing in Streptozotocin-Induced Diabetic Rats Supplemented with Camel Undenatured Whey Protein. BMC Immunol. 2013, 14, 31. [Google Scholar] [CrossRef] [Green Version]
- Farah, Z.; Mollet, M.; Younan, M.; Dahir, R. Camel Dairy in Somalia: Limiting Factors and Development Potential. Livestig. Sci. 2007, 110, 187–191. [Google Scholar] [CrossRef]
- Al Haj, O.A.; al Kanhal, H.A. Compositional, Technological and Nutritional Aspects of Dromedary Camel Milk. Int. Dairy J. 2010, 20, 811–821. [Google Scholar] [CrossRef]
- Rijnkels, M. Multispecies Comparison of the Casein Gene Loci and Evolution of Casein Gene Family. J. Mammary Gland Biol. Neoplasia 2002, 7, 327–345. [Google Scholar] [CrossRef]
- Madende, M.; Osthoff, G. Comparative Genomics of Casein Genes. J. Dairy Res. 2019, 86, 323–330. [Google Scholar] [CrossRef]
- Pauciullo, A.; Erhardt, G. Molecular Characterization of the Llamas (Lama glama) Casein Cluster Genes Transcripts (CSN1S1, CSN2, CSN1S2, CSN3) and Regulatory Regions. PLoS ONE 2015, 10, e0124963. [Google Scholar]
- Poth, A.G.; Deeth, H.C.; Alewood, P.F.; Holland, J.W. Analysis of the Human Casein Phosphoproteome by 2-D Electrophoresis and MALDI-TOF/TOF MS Reveals New Phosphoforms. J. Proteome Res. 2008, 7, 5017–5027. [Google Scholar] [CrossRef] [PubMed]
- Madende, M.; Kemp, G.; Stoychev, S.; Osthoff, G. Characterization of African elephant β-casein and its relevance to the chemistry of caseins and casein micelles. Int. Dairy J. 2018, 85, 112–120. [Google Scholar] [CrossRef]
- Caroli, A.; Chiatti, F.; Chessa, S.; Rignanese, D.; Bolla, P.; Pagnacco, G. Focusing on the Goat Casein Complex. J. Dairy Sci. 2006, 89, 3178–3187. [Google Scholar] [CrossRef] [Green Version]
- Caroli, A.M.; Chessa, S.; Erhardt, G.J. Invited Review: Milk Protein Polymorphisms in Cattle: Effect on Animal Breeding and Human Nutrition. J. Dairy Sci. 2009, 92, 5335–5352. [Google Scholar] [CrossRef] [Green Version]
- Ramunno, L.; Cosenza, G.; Rando, A.; Pauciullo, A.; Illario, R.; Gallo, D.; di Berardino, D.; Masina, P. Comparative Analysis of Gene Sequence of Goat CSN1S1 F and N Alleles and Characterization of CSN1S1 Transcript Variants in Mammary Gland. Gene 2005, 345, 289–299. [Google Scholar] [CrossRef] [PubMed]
- Guan, D.; Mármol-Sánchez, E.; Cardoso, T.F.; Such, X.; Landi, V.; Tawari, N.R.; Amills, M. Genomic Analysis of the Origins of Extant Casein Variation in Goats. J. Dairy Sci. 2019, 102, 5230–5241. [Google Scholar] [CrossRef] [PubMed]
- Luigi-Sierra, M.G.; Mármol-Sánchez, E.; Amills, M. Comparing the Diversity of the Casein Genes in the Asian Mouflon and Domestic Sheep. Anim. Genet. 2020, 51, 470–475. [Google Scholar] [CrossRef]
- Inostroza, M.G.P.; González, F.J.N.; Landi, V.; Jurado, J.M.L.; Bermejo, J.V.D.; Álvarez, J.F.; Martínez, M.D.A.M. Bayesian Analysis of the Association Between Casein Complex Haplotype Variants and Milk Yield, Composition, and Curve Shape Parameters in Murciano-Granadina Goats. Animals 2020, 10, 1845. [Google Scholar] [CrossRef] [PubMed]
- Kappeler, S.; Farah, Z.; Puhan, Z. Sequence Analysis of C. dromedarius Milk Caseins. J. Dairy Res. 1998, 65, 209–222. [Google Scholar] [CrossRef] [Green Version]
- Shuiep, E.T.S.; Giambra, I.J.; el Zubeir, I.E.Y.M.; Erhardt, G. Biochemical and Molecular Characterization of Polymorphisms of αs1-Casein in Sudanese Camel (C. dromedarius) Milk. Int. Dairy J. 2013, 28, 88–93. [Google Scholar] [CrossRef]
- Singh, R.K.; Chang, H.W.; Yan, D.; Lee, K.M.; Ucmak, D.; Wong, K.; Abrouk, M.; Farahnik, B.; Nakamura, M.; Zhu, T.H.; et al. Influence of Diet on the Gut Microbiome and Implications for Human Health. J. Transl. Med. 2017, 15, 73. [Google Scholar] [CrossRef] [Green Version]
- Pauciullo, A.; Giambra, I.J.; Iannuzzi, L.; Erhardt, G. The β-Casein in Camels: Molecular Characterization of the CSN2 Gene, Promoter Analysis and Genetic Variability. Gene 2014, 547, 159–168. [Google Scholar] [CrossRef]
- Pauciullo, A.; Shuiep, E.S.; Cosenza, G.; Ramunno, L.; Erhardt, G. Molecular Characterization and Genetic Variability at κ-Casein Gene (CSN3) in Camels. Gene 2013, 513, 22–30. [Google Scholar] [CrossRef]
- Pauciullo, A.; Shuiep, E.T.; Ogah, M.D.; Cosenza, G.; Di Stasio, L.; Erhardt, G. Casein Gene Cluster in Camelids: Comparative Genome Analysis and New Findings on Haplotype Variability and Physical Mapping. Front. Genet. 2019, 10, 748. [Google Scholar] [CrossRef] [Green Version]
- Heng, L.; Bob, H.; Alec, W.; Tim, F.; Jue, R.; Nils, H.; Gabor, M.; Goncalo, A.; Richard, D. 1000 Genome Project Data Processing Subgroup, The Sequence Alignment/Map format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar]
- Cingolani, P.; Platts, A.; Wang, L.L.; Coon, M.; Nguyen, T.; Wang, L.; Land, S.J.; Lu, X.; Ruden, D.M. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3. Fly 2012, 6, 80–92. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ward, T.J.; Honeycutt, R.L.; Derr, J.N. Nucleotide Sequence Evolution at the k-Casein Locus: Evidence for Positive Selection within the Family Bovidae. Genetics 1997, 147, 1863–1872. [Google Scholar] [CrossRef] [PubMed]
- Griffiths, A.J.F.; Gelbart, W.M.; Lewontin, R.C.; Miller, J.H. Modern Genetic Analysis, 1st ed.; W. H. Freeman: New York, NY, USA, 2002; Volume 24. [Google Scholar]
- Erhardt, G.; Shuiep, E.T.S.; Lisson, M.; Weimann, C.; Wang, Z.; El Zubeir, I.E.Y.M.; Pauciullo, A. α S1-Casein Polymorphisms in Camel (C. dromedarius) and Descriptions of Biological Active Peptides and Allergenic Epitopes. Trop. Anim. Health Prod. 2016, 48, 879–887. [Google Scholar] [CrossRef] [PubMed]
- Kozak, M. Structural Features in Eukaryotic mRNAs That Modulate the Initiation of Translation. J. Biol. Chem. 1991, 266, 19867–19870. [Google Scholar] [CrossRef]
- Kozak, M. An Analysis of S’-Noncoding Sequences from 699 Vertebrate Messenger RNAs. Nucleic Acids Res. 1987, 15, 8125–8148. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cieslak, J.; Mankowska, M.; Switonski, M. Between-Breed Variation in Frequency of Five Novel Missense SNPs in Porcine Casein β (CSN2) and Casein Kappa (CSN3) Genes. Anim. Genet. 2012, 43, 363–364. [Google Scholar] [CrossRef]
- Suteu, M.; Vlaic, A.; Bâlteanu, V.A.; Wavreille, J.; Renaville, R. Evidence of Alternative Splicing of Porcine β-Casein (CSN2). Anim. Genet. 2012, 43, 474–475. [Google Scholar] [CrossRef]
- Miclo, L.; Girardet, J.M.; Egito, A.S.; Mollé, D.; Martin, P.; Gaillard, J.L. The Primary Structure of a Low-Mr Multiphosphorylated Variant ofβ-Casein in Equine Milk. Proteomics 2007, 7, 1327–1335. [Google Scholar] [CrossRef]
- Kappeler, S.R.; Farah, Z.; Puhan, Z. 5′-Flanking Regions of Camel Milk Genes Are Highly Similar to Homologue Regions of Other Species and Can Be Divided into Two Distinct Groups. J. Dairy Sci. 2003, 86, 498–508. [Google Scholar] [CrossRef] [Green Version]
- El-Agamy, E.I. Camel Milk. In Hand Book of Milk of Non-Bovine Mammals; Park, Y.W., Haenlein, G.F.W., Eds.; Wiley-Blackwell: Hoboken, NJ, USA, 2006; pp. 297–344. [Google Scholar]
| Gene | Sequence (5′→3′) | Tm (°C) | GC (%) | PCR Product Sizes (bp) |
|---|---|---|---|---|
| CSN2_F1 | ACAGGCAGGGCCAGTACTTT | 61.1 | 55 | 5962 |
| CSN2_R1 | GACTCAGCTGGGTGTTGATTT | 59.2 | 47.6 | |
| CSN2_F2 | CTGTTTGCTGCTGTTCCTCA | 60.2 | 50 | 5031 |
| CSN2_R2 | CTCCCATCTGCACTTCCATT | 60.1 | 50 | |
| CSN3_F1 | CTGGCCAAGGACTTCATAGC | 59.8 | 55 | 6456 |
| CSN3_R1 | GGTTGTTCCTGGTTTTGCAC | 60.4 | 55 | |
| CSN3_F2 | GGTGGCTATAAGTTGGCACA | 58.7 | 50.0 | 5849 |
| CSN3_R2 | TTCTGACCAGGCCTCACTTC | 60.4 | 55 | |
| CSN1S1_F1 | CCACCAAATTTTATAGGACAGC | 57.7 | 40.9 | 7409 |
| CSN1S1_R1 | CCTACGCCACAACACTTTCA | 59.8 | 50 | |
| CSN1S1_F2 | ATGAACTCAAGGCACCAACC | 60 | 50 | 6343 |
| CSN1S1_R2 | CAGATATGGGTGGGAGGACA | 60.7 | 55 | |
| CSN1S1_F3 | GCGAATGCTCCATATGCTTC | 60.7 | 50 | 7265 |
| CSN1S1_R3 | GCAGGAGACCCAATGCTAAA | 60.2 | 50 | |
| CSN1S2_F1 | GCATTCCGGGTCACATAACT | 59.8 | 50 | 6767 |
| CSN1S2_R1 | TGCCTATACTGTGTTCCAAGCA | 60.7 | 45.5 | |
| CSN1S2_F2 | ATTGCCTTCAACGTGGTTTC | 60 | 45 | 6799 |
| CSN1S2_R2 | GTGTCAGAGCACACCTGGAC | 59.3 | 60 | |
| CSN1S2_F3 | GCCAAGTGGGTAAGCACAAT | 60 | 50 | 5716 |
| CSN1S2_R3 | GTGAGGCTAACAGGAAATGGAG | 60.1 | 50 |
| Gene | Position | Size (bp) (A) | Intergenic Distance (bp) (B) | Total Size (bp) (A+B) | Exons |
|---|---|---|---|---|---|
| CSN1S1 | 242,112 to 258,587 | 16,476 | 16,476 | 20 | |
| CSN2 | 265,187 to 273,094 | 7908 | 6600 (CSN1S1→CSN2) | 14,508 | 9 |
| CSN1S2 | 321,355 to 335,898 | 14,544 | 48,261 (CSN2→CSN1S2) | 62,805 | 17 |
| CSN3 | 421,597 to 430,955 | 9359 | 85,699 (CSN1S2→CSN3) | 95,058 | 5 |
| Total | 48,287 | 188,847 | 51 |
| Gene | Variant Type | Impact | Total Variants |
|---|---|---|---|
| CSN1S1 | Intron variant | Modifier | 76 |
| Missense variant | Moderate | 2 | |
| Splice region variant & intron variant | Low | 1 | |
| Synonymous variant | Low | 1 | |
| Upstream gene variant | Modifier | 5 | |
| CSN1S2 | 3 prime UTR variant 1 | Modifier | 1 |
| 5 prime UTR variant 2 | Modifier | 1 | |
| Intron variant | Modifier | 34 | |
| Splice acceptor variant & splice region variant & intron variant | High | 1 | |
| Splice region variant & intron variant | Low | 2 | |
| Upstream gene variant | Modifier | 3 | |
| CSN2 | Downstream gene variant | Modifier | 45 |
| Intron variant | Modifier | 37 | |
| Splice region variant & intron variant | Low | 1 | |
| Synonymous variant | Low | 1 | |
| Upstream gene variant | Modifier | 7 | |
| CSN3 | 5 prime UTR variant 2 | Modifier | 1 |
| Intron variant | Modifier | 66 | |
| Upstream gene variant | Modifier | 9 |
| Gene | Variant | Genomic Impact | Functional Impact | Wild Type Homozygous (%) | Heterozygous (%) | Mutant Homozygous (%) | Minor Allele Frequency (Allele) |
|---|---|---|---|---|---|---|---|
| CSN1S1 | c.135T>G | Missense variant | p.Asp45Glu | 4.3 | 16.1 | 79.6 | 0.102 (T) |
| c.70C>T | Missense variant | p.Pro24Ser | 89.2 | 10.8 | 0 | 0.054 (T) | |
| CSN1S2 | c.-19A>C | 5 prime UTR variant | Modifier | 50.5 | 39.8 | 9.7 | 0.296 (c) |
| c.403-9_403-4delTTTTCT | Splice site variant | Low | 67.7 (del/del) | 0 | 32.3 (ins/Ins) | 0.323 (Ins) | |
| CSN2 | c.51+8T>A | Splice site variant | Low | 49.5 | 37.6 | 12.9 | 0.317 (A) |
| c.21C>A | Synonymous variant | (p.Ala7Ala) | 49.5 | 37.6 | 12.9 | 0.317 (A) | |
| CSN3 | c.-65T>C | 5 prime UTR variant | 14.0 | 31.2 | 54.8 | 0.296 (T) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mutery, A.A.; Rais, N.; Mohamed, W.K.; Abdelaziz, T. Genetic Diversity in Casein Gene Cluster in a Dromedary Camel (C. dromedarius) Population from the United Arab Emirates. Genes 2021, 12, 1417. https://doi.org/10.3390/genes12091417
Mutery AA, Rais N, Mohamed WK, Abdelaziz T. Genetic Diversity in Casein Gene Cluster in a Dromedary Camel (C. dromedarius) Population from the United Arab Emirates. Genes. 2021; 12(9):1417. https://doi.org/10.3390/genes12091417
Chicago/Turabian StyleMutery, Abdullah Al, Naushad Rais, Walaa KE Mohamed, and Tlili Abdelaziz. 2021. "Genetic Diversity in Casein Gene Cluster in a Dromedary Camel (C. dromedarius) Population from the United Arab Emirates" Genes 12, no. 9: 1417. https://doi.org/10.3390/genes12091417
APA StyleMutery, A. A., Rais, N., Mohamed, W. K., & Abdelaziz, T. (2021). Genetic Diversity in Casein Gene Cluster in a Dromedary Camel (C. dromedarius) Population from the United Arab Emirates. Genes, 12(9), 1417. https://doi.org/10.3390/genes12091417

