Transcriptomics Analysis of Primordium Formation in Pleurotus eryngii
Abstract
:1. Introduction
2. Materials and Methods
2.1. P. eryngii Cultivation and Sample Collection
2.2. RNA Extraction, cDNA Library Construction, and Illumina Sequencing
2.3. Bioinformatics Analysis
2.4. Validation of Transcriptomics Data by RT-qPCR
2.5. Statistical Analysis
3. Results
3.1. Analysis of the Morphological Features of P. eryngii
3.2. RNA Sequencing
3.3. Identification of Differentially Expressed Genes
3.4. Functional Annotation of Differentially Expressed Genes
3.5. Differentially Expressed Genes Related to Primordium Formation in P. eryngii
3.6. Validation of Transcriptomics Data by RT-qPCR
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Mau, J.L.; Lin, Y.; Chen, P.; Wu, Y.; Peng, J. Flavor compounds in king oyster mushrooms Pleurotus eryngii. J. Agric. Food Chem. 1998, 46, 4587–4591. [Google Scholar] [CrossRef]
- Bouzgarrou, C.; Amara, K.; Reis, F.S.; Barreira, J.; Skhiri, F.; Chatti, N.; Martins, A.; Barros, L.; Ferreira, I. Incorporation of tocopherol-rich extracts from mushroom mycelia into yogurt. Food Funct. 2018, 9, 3166–3172. [Google Scholar] [CrossRef] [Green Version]
- Wang, F.F. Assay study on nutritive components of Pleurotus eryngii. Food Sci. 2002, 23, 132–135. [Google Scholar] [CrossRef]
- Zhang, B.; Li, Y.; Zhang, F.; Linhardt, R.J.; Zeng, G.; Zhang, A. Extraction, structure and bioactivities of the polysaccharides from Pleurotus eryngii: A review. Int. J. Biol. Macromol. 2020, 150, 1342–1347. [Google Scholar] [CrossRef]
- Zheng, H.; Chen, J.; Weng, M.; Ahmad, I.; Zhou, C. Structural characterization and bioactivities of a polysaccharide from the stalk residue of Pleurotus eryngii. Food Sci. Technol. 2020, 40, 235–241. [Google Scholar] [CrossRef]
- Xu, N.; Ren, Z.; Zhang, J.; Song, X.; Gao, Z.; Jing, H.; Li, S.; Wang, S.; Jia, L. Antioxidant and anti-hyperlipidemic effects of mycelia zinc polysaccharides by Pleurotus eryngii var. tuoliensis. Int. J. Biol. Macromol. 2017, 95, 204–214. [Google Scholar] [CrossRef] [PubMed]
- Chang, S.; Buswell, J.A.; Chiu, S. Mushroom Biology and Mushroom Products; The Chinese University of Hong Kong Press: Hong Kong, China, 1993; pp. 33–39. [Google Scholar]
- Zhao, Y.; Wang, L.; Zhang, D.; Li, R.; Cheng, T.; Zhang, Y.; Liu, X.; Wong, G.; Tang, Y.; Wang, H.; et al. Comparative transcriptome analysis reveals relationship of three major domesticated varieties of Auricularia auricula-judae. Sci. Rep. 2019, 9, 78. [Google Scholar] [CrossRef] [Green Version]
- Ramírez, L.; Oguiza, J.A.; Pérez, G.; Lavín, J.L.; Omarini, A.; Santoyo, F.; Alfaro, M.; Castanera, R.; Parenti, A.; Muguerza, E.; et al. Genomics and transcriptomics characterization of genes expressed during postharvest at 4 °C by the edible basidiomycete Pleurotus ostreatus. Int. Microbiol. 2011, 14, 111–120. [Google Scholar] [CrossRef]
- Wu, Y.; Zhu, W.; Wei, W.; Zhao, X.; Wang, Q.; Zeng, W.; Zheng, Y.; Chen, P.; Zhang, S. De novo assembly and transcriptome analysis of sclerotial development in Wolfiporia Cocos. Gene 2016, 588, 149–155. [Google Scholar] [CrossRef]
- Liu, M.; Yu, T.; Singh, P.K.; Liu, Q.; Liu, H.; Zhu, Q.; Xiao, Z.; Xu, J.; Peng, Y.; Fu, S.; et al. A comparative transcriptome analysis of Volvariella volvacea identified the candidate genes Involved in fast growth at the mycelial growth stage. Genes 2020, 11, 161. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, X.; Yan, L.; Li, Q.; Tan, H.; Zhou, J.; Miao, R.; Ye, L.; Peng, W.; Zhang, X.; Tan, W.; et al. Transcriptional profiling of Auricularia cornea in selenium accumulation. Sci. Rep. 2019, 9, 5641. [Google Scholar] [CrossRef] [Green Version]
- Song, H.; Kim, D.; Kim, J. Comparative transcriptome analysis of dikaryotic mycelia and mature fruiting bodies in the edible mushroom Lentinula edodes. Sci. Rep. 2018, 8, 8983. [Google Scholar] [CrossRef] [PubMed]
- Wang, F.; Liu, Q.; Zhang, J.; Liu, K.; Li, K.; Liu, G.; Dong, C. Comparative transcriptome analysis between a spontaneous blbino mutant and its sibling strain of Cordyceps militaris in response to light stress. Front. Microbiol. 2018, 9, 1237. [Google Scholar] [CrossRef] [PubMed]
- Du, F.; Ti, N.; Hu, Q.; Zou, Y.; Ye, D.; Zhang, A.H. A Comparative Transcriptome Analysis Reveals Physiological Maturation Properties of Mycelia in Pleurotus tuoliensis. Genes 2019, 10, 703. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Du, F.; Zou, Y.J.; Hu, Q.X.; Zhang, H.J.; Ye, D. Comparative transcriptomic analysis reveals molecular processes involved in pileus morphogenesis in Pleurotus eryngii under different light conditions. Genomics 2020, 112, 1707–1715. [Google Scholar] [CrossRef]
- Patel, R.K.; Jain, M. NGS QC Toolkit: A toolkit for quality control of next generation sequencing data. PLoS ONE 2012, 7, e30619. [Google Scholar] [CrossRef]
- Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef] [Green Version]
- Ruiz-Duenas, F.J.; Barrasa, J.M.; Sanchez-Garcia, M.; Camarero, S.; Miyauchi, S.; Serrano, A.; Linde, D.; Babiker, R.; Drula, E.; Ayuso-Fernandez, I.; et al. Genomic analysis enlightens agaricales lifestyle evolution and increasing peroxidase diversity. Mol. Biol. Evol. 2021, 38, 1428–1446. [Google Scholar] [CrossRef]
- Langmead, B.; Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 2012, 9, 357–359. [Google Scholar] [CrossRef] [Green Version]
- Roberts, A.; Pachter, L. Streaming fragment assignment for real-time analysis of sequencing experiments. Nat. Methods 2013, 10, 71–73. [Google Scholar] [CrossRef] [Green Version]
- Zheng, X.; Moriyama, E.N. Comparative studies of differential gene calling using RNA-Seq data. BMC Bioinform. 2013, 14 (Suppl. 13), S7. [Google Scholar] [CrossRef] [Green Version]
- Young, M.D.; Wakefield, M.J.; Smyth, G.K.; Oshlack, A. Gene ontology analysis for RNA-seq: Accounting for selection bias. Genome Biol. 2010, 11, R14. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kanehisa, M.; Araki, M.; Goto, S.; Hattori, M.; Hirakawa, M.; Itoh, M.; Katayama, T.; Kawashima, S.; Okuda, S.; Tokimatsu, T.; et al. KEGG for linking genomes to life and the environment. Nucleic Acids Res. 2007, 36, D480–D484. [Google Scholar] [CrossRef] [PubMed]
- Lyu, X.; Shen, C.; Fu, Y.; Xie, J.; Jiang, D.; Li, G.; Cheng, J. Comparative genomic and transcriptional analyses of the carbohydrate-active enzymes and secretomes of phytopathogenic fungi reveal their significant roles during infection and development. Sci. Rep. 2015, 5, 15565. [Google Scholar] [CrossRef] [PubMed]
- Martínez-Soto, D.; Ruiz-Herrera, J. Functional analysis of the MAPK pathways in fungi. Rev. Iberoam. Micol. 2017, 34, 192–202. [Google Scholar] [CrossRef]
- Liu, J.; Chang, M.; Meng, J.; Feng, C.; Zhao, H.; Zhang, M. Comparative proteome reveals metabolic changes during the fruiting process in Flammulina velutipes. J. Agric. Food Chem. 2017, 65, 5091–5100. [Google Scholar] [CrossRef]
- Cheng, C.K.; Au, C.H.; Wilke, S.K.; Stajich, J.E.; Zolan, M.E.; Pukkila, P.J.; Kwan, H.S. 5′-Serial analysis of gene expression studies reveal a transcriptomic switch during fruiting body development in Coprinopsis cinerea. BMC Genom. 2013, 14, 195. [Google Scholar] [CrossRef] [Green Version]
- Lu, Y.; Lian, L.; Guo, L.; Xie, B.; Wang, W.; Chen, B.; van Peer, A.F.; Li, S.; Wu, T.; Xie, B. The accordant trend of both parameters (rgs expression and cAMP content) follows the pattern of development of fruiting body in Volvariella volvacea. Curr. Microbiol. 2015, 71, 579–584. [Google Scholar] [CrossRef]
- Virdy, K.J.; Sands, T.W.; Kopko, S.H.; van Es, S.; Meima, M.; Schaap, P.; Cotter, D.A. High cAMP in spores of dictyostelium discoideurn: Association with spore dormancy. Microbiology 1999, 145, 1883–1890. [Google Scholar] [CrossRef] [Green Version]
- Fillinger, S.; Chaveroche, M.K.; Shimizu, K.; Keller, N.; D’Enfert, C. cAMP and ras signalling independently control spore germination in the filamentous fungus Aspergillus nidulans. Mol. Microbiol. 2002, 44, 1001–1016. [Google Scholar] [CrossRef] [PubMed]
- Hirata, K.; Amagai, A.; Chae, S.; Hirose, S.; Maeda, Y. Involvements of a novel protein, DIA2, in cAMP signaling and spore differentiation during Dictyostelium development. Differentiation 2008, 76, 310–322. [Google Scholar] [CrossRef] [PubMed]
- Lopez, D.; Ribeiro, S.; Label, P.; Fumanal, B.; Venisse, J.; Kohler, A.; de Oliveira, R.R.; Labutti, K.; Lipzen, A.; Lail, K.; et al. Genome-Wide Analysis of Corynespora cassiicola Leaf Fall Disease Putative Effectors. Front. Microbiol. 2018, 9, 276. [Google Scholar] [CrossRef] [Green Version]
- Dou, Y.; Du, F.; Yajie, Z.; Haijun, Z.; Zhanshan, H.; Qingxiu, H. Effects of light conditions on the differentiation and physiological effects of Pleurotus eryngii. Chin. J. Appl. Environ. Biol. 2019, 05, 1107–1112. [Google Scholar] [CrossRef]
- Hanbing, S.; Yong, L.; Jiahua, H.; Jingyi, D.; Qisi, Z.; Baogui, X.; Yongxin, T. Growth and development of Hypsizygus marmoreus and response expression of light receptor white collar genes under different light quality irradiation. Acta Hortic. Sin. 2020, 3, 467–476. [Google Scholar] [CrossRef]
- Yaoling, Z. Study on photo effect of growth and development in Pleurotus nebrodensis. Shanxi J. Agric. Sci. 2019, 5, 32–34. [Google Scholar] [CrossRef]
- Olmedo, M.; Ruger-Herreros, C.; Luque, E.M.; Corrochano, L.M. Regulation of transcription by light in Neurospora crassa: A model for fungal photobiology? Fungal. Biol. Rev. 2013, 27, 10–18. [Google Scholar] [CrossRef]
- Olmedo, M.; Ruger-Herreros, C.; Luque, E.M.; Corrochano, L.M. A complex photoreceptor system mediates the regulation by light of the conidiation genes con-10 and con-6 in Neurospora crassa. Fungal. Genet. Biol. 2010, 47, 352–363. [Google Scholar] [CrossRef]
- Thompson, C.L.; Sancar, A. Photolyase/cryptochrome blue-light photoreceptors use photon energy to repair DNA and reset the circadian clock. Oncogene 2002, 21, 9043–9056. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, S.T.; Sancar, A. Photochemistry, photophysics, and mechanism of pyrimidine dimer repair by DNA photolyase. Photochem. Photobiol. 1993, 57, 895–904. [Google Scholar] [CrossRef]
- Phan, T.L.C.H.; Delorge, I.; Avonce, N.; Van Dijck, P. Functional characterization of class I trehalose biosynthesis genes in Physcomitrella patens. Front. Plant Sci. 2020, 10, 1694. [Google Scholar] [CrossRef]
- Zhang, X.; Zhang, Y.; Li, H. Regulation of trehalose, a typical stress protectant, on central metabolisms, cell growth and division of Saccharomyces cerevisiae CEN.PK113-7D. Food Microbiol. 2020, 89, 103459. [Google Scholar] [CrossRef] [PubMed]
- Terashita, T.; Yoshida, K.; Sakai, T.; Yoshikawa, K.; Nagai, M.; Suzuki, A. Effect of trehalose on the spawn storage in some edible mushroom fungi (2): Effect on preservation in the freezer. Mycoscience 2003, 44, 71–74. [Google Scholar] [CrossRef]
Software | Version | Parameters |
---|---|---|
NGS QC Toolkit | 2.3.3 | IlluQC_PRLL.pl N 5-l 70-s 20; TrimmingReads.pl-q 20; AmbiguityFiltering.pl-t5-n 35 |
hisat2 | 2.0.5 | --RNA-strandness RF--fr |
bowtie2 | 2.2.9 | -k30-t |
eXpress | 1.5.1 | --rf-stranded |
DESeq | 1.18.0 | p-value < 0.05, |log2FoldChange| > 1 |
Primer | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
---|---|---|
GAPDH | GCCAACAACTACAACGCAGA | CGCCTGGTACGATAACGAAT |
INO1 | TCCGAAGGACAGATCCTCGT | CGTTGTTACCACCCATCCCA |
WC-1 | CGAATATCGTCCAAGGCGGA | CCCCAAAACTCTCGCTCAGT |
PAL1 | CAACCTAACGCAACAGCAGA | GCCTGCAGACATGGGACTAT |
CAT-1 | CGTGAACACGTACACGCTCT | TCGTCCTTTTCAGGGATGAC |
AGN1 | CCGTTGGGAACAGCTTATGT | GGGTATGAGCCAGTCTGGAA |
PHR | TAAACCCTTTGGCTCCCGAC | CAGGCGGCTCGATGTATCTT |
AES1 | GATACTGGCCGGGATACAGC | CGGTGATGAGATGCCCTACC |
NIK1 | ATACCGTCAGCCCAGTCTCT | CCGTTCTCCGCTATCTCCAC |
XYL1 | ACGAACGTAAGAGGGCTTGG | AGGACGTTGTACCTTCGCTG |
LAC12 | TGGAACCAACGTGATGCGTA | CGGCAATAAACCTCGAAGCG |
FC-SDR | AATTTGCAACGGCATCTACC | AATTTGCAACGGCATCTACC |
ENGASE1 | AGGGTGGCTACACAGAAACG | AGGGTGGCTACACAGAAACG |
Sample | Raw Reads | Clean Reads | Valid Bases | Q30 | GC | Total Mapped | Uniquely Mapped |
---|---|---|---|---|---|---|---|
A1 | 54,094,426 | 52,290,698 | 92.33% | 93.88% | 53.43% | 47,971,181 (91.74%) | 47,239,190 (90.34%) |
A2 | 52,370,316 | 50,312,152 | 92.34% | 93.34% | 53.21% | 45,726,888 (90.89%) | 44,959,009 (89.36%) |
A3 | 53,137,348 | 51,129,606 | 92.40% | 93.70% | 53.29% | 46,529,731 (91.00%) | 45,731,339 (89.44%) |
B1 | 53,280,494 | 51,362,248 | 93.15% | 93.67% | 53.18% | 46,933,670 (91.38%) | 46,423,930 (90.39%) |
B2 | 51,919,842 | 49,990,770 | 92.77% | 93.70% | 53.30% | 45,633,067 (91.28%) | 45,171,712 (90.36%) |
B3 | 52,589,620 | 50,422,530 | 92.67% | 93.48% | 53.35% | 46,323,569 (91.87%) | 45,859,357 (90.95%) |
ID | Term | Category | Samples |
---|---|---|---|
GO:2000028 | Regulation of photoperiodism | BP | MC |
GO:0007602 | Phototransduction | BP | MC |
GO:0048571 | Long-day photoperiodism | BP | PD and MC |
GO:0009853 | Photorespiration | BP | MC |
GO:0042462 | Eye photoreceptor cell development | BP | PD |
GO:0045494 | Photoreceptor cell maintenance | BP | MC |
GO:0009585 | Red, far-red light phototransduction | BP | PD and MC |
GO:0009644 | Response to high light intensity | BP | PD and MC |
GO:0009416 | Response to light stimulus | BP | PD and MC |
GO:0009639 | Response to red or far-red light | BP | PD and MC |
GO:0010114 | Response to red light | BP | PD and MC |
GO:0001917 | Photoreceptor inner segment | CC | PD |
GO:0032391 | Photoreceptor connecting cilium | CC | MC |
GO:0001750 | Photoreceptor outer segment | CC | MC |
GO:0009881 | Photoreceptor activity | MF | PD |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ye, D.; Du, F.; Zou, Y.; Hu, Q. Transcriptomics Analysis of Primordium Formation in Pleurotus eryngii. Genes 2021, 12, 1863. https://doi.org/10.3390/genes12121863
Ye D, Du F, Zou Y, Hu Q. Transcriptomics Analysis of Primordium Formation in Pleurotus eryngii. Genes. 2021; 12(12):1863. https://doi.org/10.3390/genes12121863
Chicago/Turabian StyleYe, Dou, Fang Du, Yajie Zou, and Qingxiu Hu. 2021. "Transcriptomics Analysis of Primordium Formation in Pleurotus eryngii" Genes 12, no. 12: 1863. https://doi.org/10.3390/genes12121863
APA StyleYe, D., Du, F., Zou, Y., & Hu, Q. (2021). Transcriptomics Analysis of Primordium Formation in Pleurotus eryngii. Genes, 12(12), 1863. https://doi.org/10.3390/genes12121863