Novel Polymorphisms and Genetic Features of the Prion Protein Gene (PRNP) in Cats, Hosts of Feline Spongiform Encephalopathy
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethical Statement
2.2. Samples
2.3. Genetic Analysis
2.4. Statistical Analyses
2.5. Sequence Alignment
2.6. In Silico Analysis
2.7. 3D Structure Analysis in the Cat and Canine PrPs
3. Results
3.1. Investigation of Polymorphisms of the PRNP Gene in 208 Cats
3.2. Investigation of the Influence on Nonsynonymous Polymorphisms of Cat PrP
3.3. Evaluation of Amyloid Propensity of Cat PrP according to of Polymorphism Alleles
3.4. Impact of Nonsynonymous SNPs on the 3D Structure of Cat PrP
3.5. Comparison of Tandem Repeat Regions of PrP in Several Mammals
3.6. A Structural Comparison of PrP between Asp163 in Dogs and Asn166 in Cats
3.7. Investigation of the Influence according to Substitution of Cat PrP
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
TSE | Transmissible spongiform encephalopathy |
CJD | Creutzfeldt-Jakob disease |
BSE | Bovine spongiform encephalopathy |
CWD | Chronic wasting disease |
TME | Transmissible mink encephalopathy |
FSE | Feline spongiform encephalopathy |
MDCK | Madin-Darby canine kidney |
RML | Rocky Mountain Laboratory |
PMCA | Protein misfolding cyclic amplification |
PRNP | Prion protein gene |
PrP | Prion protein |
SNPs | Single nucleotide polymorphisms |
LD | Linkage disequilibrium |
EDTA | Ethylenediaminetetraacetic acid |
HWE | Hardy-Weinberg equilibrium |
ORF | Open reading frame |
References
- Chesebro, B. Introduction to the transmissible spongiform encephalopathies or prion diseases. Br. Med. Bull. 2003, 66, 1–20. [Google Scholar] [CrossRef] [Green Version]
- Soto, C. Prion hypothesis: The end of the controversy? Trends. Biochem. Sci. 2011, 36, 151–158. [Google Scholar] [CrossRef] [Green Version]
- Williams, E.; Young, S. Chronic wasting disease of captive mule deer: A spongiform encephalopathy. J. Wildl. Dis. 1980, 16, 89–98. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- James, H. Bovine spongiform encephalopathy: A tipping point in One Health and Food Safety. Curr. Top. Microbiol. Immunol. 2013, 366, 37–47. [Google Scholar] [CrossRef]
- Sigurdson, C.J.; Miller, M.W. Other animal prion diseases. Br. Med. Bull. 2003, 66, 199–212. [Google Scholar] [CrossRef] [PubMed]
- Imran, M.; Mahmood, S. An overview of animal prion diseases. Virol. J. 2011, 8, 493. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jeong, B.H.; Kim, Y.S. Genetic studies in human prion diseases. J. Korean. Med. Sci. 2014, 29, 623–632. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Aguilar, C.P.; García, C.; Espinosa, J.C.; Andreoletti, O.; Torres, J.M. Prion and prion-like diseases in animals. Virus. Res. 2015, 207, 82–93. [Google Scholar] [CrossRef]
- Jeong, M.J.; Kim, Y.C.; Jeong, B.H. Prion-like protein gene (PRND) polymorphisms associated with scrapie susceptibility in Korean native black goats. PLoS ONE 2018, 13, e0206209. [Google Scholar] [CrossRef]
- Won, S.Y.; Kim, Y.C.; Kim, S.K.; Jeong, B.H. The First Report of Genetic and Structural Diversities in the SPRN Gene in the Horse, an Animal Resistant to Prion Disease. Genes (Basel) 2019, 11, 39. [Google Scholar] [CrossRef] [Green Version]
- Jeong, M.J.; Jeong, B.H. No polymorphisms in the coding region of the prion-like protein gene in Thoroughbred racehorses. Acta. Vet. Hung. 2019, 67, 174–182. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.C.; Kim, S.K.; Jeong, B.H. Scrapie susceptibility-associated indel polymorphism of shadow of prion protein gene (SPRN) in Korean native black goats. Sci. Rep. 2019, 9, 15261. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, Y.C.; Won, S.Y.; Do, K.; Jeong, B.H. Identification of the novel polymorphisms and potential genetic features of the prion protein gene (PRNP) in horses, a prion disease-resistant animal. Sci. Rep. 2020, 10, 8926. [Google Scholar] [CrossRef] [PubMed]
- Won, S.Y.; Kim, Y.C.; Jeong, B.H. First Report of the Potential Bovine Spongiform Encephalopathy (BSE)-Related Somatic Mutation E211K of the Prion Protein Gene (PRNP) in Cattle. Int. J. Mol. Sci. 2020, 21, 4246. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.C.; Won, S.Y.; Jeong, B.-H. Identification of Prion Disease-Related Somatic Mutations in the Prion Protein Gene (PRNP) in Cancer Patients. Cells. 2020, 9, 1480. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.C.; Kim, S.K.; Won, S.Y.; Jeong, B.H. Polymorphisms of shadow of prion protein gene (SPRN) in Korean native cattle (Hanwoo) and Holstein cattle. Sci. Rep. 2020, 10, 15272. [Google Scholar] [CrossRef]
- Wyatt, J.; Pearson, G.; Smerdon, T.; Gruffydd-Jones, T.; Wells, G. Spongiform encephalopathy in a cat. Vet. Rec. 1990, 126, 513. [Google Scholar]
- Kirkwood, J.; Cunningham, A.A. Epidemiological observations on spongiform encephalopathies in captive wild animals in the British Isles. Vet. Rec. 1994, 135, 296–303. [Google Scholar] [CrossRef]
- The Center for Food Security and Public Health. Available online: http://www.cfsph.iastate.edu/Factsheets/pdfs/feline_spongiform_encephalopathy.pdf (accessed on 2 August 2016).
- Animal and Plant Health Agency. Available online: https://www.gov.uk/government/publications/exotic-species-and-domestic-cats-tse-surveillance-statistics (accessed on 14 October 2020).
- Bratberg, B.; Ueland, K.; Wells, G. Feline spongiform encephalopathy in a cat in Norway. Vet. Rec. 1995, 136, 444. [Google Scholar] [CrossRef]
- Demierre, S.; Botteron, C.; Cizinauskas, S.; Doherr, M.; Fatzer, R.; Jaggy, A. Feline spongiform encephalopathy: First clinical case in Switzerland. Schweiz. Arch. Tierheilkd. 2002, 144, 550–557. [Google Scholar] [CrossRef]
- Hilbe, M.M.; Soldati, G.G.; Zlinszky, K.K.; Wunderlin, S.S.; Ehrensperger, F.F. Immunohistochemical study of PrP Sc distribution in neural and extraneural tissues of two cats with feline spongiform encephalopathy. BMC Vet. Res. 2009, 5, 11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Young, S.; Slocombe, R. Prion-associated spongiform encephalopathy in an imported Asiatic golden cat (Catopuma temmincki). Aust. Vet. J. 2003, 81, 295–296. [Google Scholar] [CrossRef] [PubMed]
- Zanusso, G.; Nardelli, E.; Rosati, A.; Fabrizi, G.; Ferrari, S. Simultaneous occurrence of spongiform encephalopathy in a man and his cat in Italy. Lancet. 1998, 352, 1116–1117. [Google Scholar] [CrossRef]
- Eiden, M.; Hoffmann, C.; Balkema-Buschmann, A.; Müller, M.; Baumgartner, K.; Groschup, M.H. Biochemical and immunohistochemical characterization of feline spongiform encephalopathy in a German captive cheetah. J. Gen. Virol. 2010, 91, 2874–2883. [Google Scholar] [CrossRef]
- Lysek, D.A.; Nivon, L.G.; Wüthrich, K. Amino acid sequence of the Felis catus prion protein. Gene 2004, 341, 249–253. [Google Scholar] [CrossRef]
- Stewart, P.; Campbell, L.; Skogtvedt, S.; Griffin, K.A.; Arnemo, J.M.; Tryland, M.; Girling, S.; Miller, M.W.; Tranulis, M.A.; Goldmann, W. Genetic predictions of prion disease susceptibility in carnivore species based on variability of the prion gene coding region. PLoS ONE. 2012, 7, e50623. [Google Scholar] [CrossRef] [Green Version]
- Vidal, E.; Fernández-Borges, N.; Eraña, H.; Parra, B.; Pintado, B.; Sánchez-Martín, M.A.; Charco, J.M.; Ordoñez, M.; Pérez-Castro, M.A.; Pumarola, M. Dogs are resistant to prion infection, due to the presence of aspartic or glutamic acid at position 163 of their prion protein. FASEB J. 2020, 34, 3969–3982. [Google Scholar] [CrossRef]
- Won, S.Y.; Kim, Y.C.; Kim, K.; Kim, A.D.; Jeong, B.H. The First Report of Polymorphisms and Genetic Features of the prion-like Protein Gene (PRND) in a Prion Disease-Resistant Animal, Dog. Int. J. Mol. Sci. 2019, 20, 1404. [Google Scholar] [CrossRef] [Green Version]
- Kim, D.-J.; Kim, Y.-C.; Kim, A.-D.; Jeong, B.-H. Novel Polymorphisms and Genetic Characteristics of the Prion Protein Gene (PRNP) in Dogs—A Resistant Animal of Prion Disease. Int. J. Mol. Sci. 2020, 21, 4160. [Google Scholar] [CrossRef]
- Polymenidou, M.; Trusheim, H.; Stallmach, L.; Moos, R.; Julius, C.; Miele, G.; Lenz-Bauer, C.; Aguzzi, A. Canine MDCK cell lines are refractory to infection with human and mouse prions. Vaccine. 2008, 26, 2601–2614. [Google Scholar] [CrossRef] [Green Version]
- Vidal, E.; Fernández-Borges, N.; Pintado, B.; Ordóñez, M.; Márquez, M.; Fondevila, D.; Torres, J.M.; Pumarola, M.; Castilla, J. Bovine spongiform encephalopathy induces misfolding of alleged prion-resistant species cellular prion protein without altering its pathobiological features. J. Neurosci. 2013, 33, 7778–7786. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Watts, J.C.; Westaway, D. The prion protein family: Diversity, rivalry, and dysfunction. Biochim. Biophys. Acta. 2007, 1772, 654–672. [Google Scholar] [CrossRef] [Green Version]
- Scheckel, C.; Aguzzi, A. Prions, prionoids and protein misfolding disorders. Nat. Rev. Genet. 2018, 19, 405–418. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jeong, B.H.; Lee, K.H.; Kim, N.H.; Jin, J.K.; Kim, J.I.; Carp, R.I.; Kim, Y.S. Association of sporadic Creutzfeldt–Jakob disease with homozygous genotypes at PRNP codons 129 and 219 in the Korean population. Neurogenetics 2005, 6, 229–232. [Google Scholar] [CrossRef] [PubMed]
- Bossers, A.; De Vries, R.; Smits, M. Susceptibility of Sheep for Scrapie as Assessed by In Vitro Conversion of Nine Naturally Occurring Variants of PrP. J. Virol. 2000, 74, 1407–1414. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vaccari, G.; Panagiotidis, C.H.; Acin, C.; Peletto, S.; Barillet, F.; Acutis, P.; Bossers, A.; Langeveld, J.; Van Keulen, L.; Sklaviadis, T. State-of-the-art review of goat TSE in the European Union, with special emphasis on PRNP genetics and epidemiology. Vet. Res. 2009, 40, 48. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jeong, B.H.; Lee, Y.J.; Kim, N.H.; Carp, R.; Kim, Y.S. Genotype distribution of the prion protein gene (PRNP) promoter polymorphisms in Korean cattle. Genome 2006, 49, 1539–1544. [Google Scholar] [CrossRef]
- Kim, S.K.; Kim, Y.C.; Won, S.Y.; Jeong, B.H. Potential scrapie-associated polymorphisms of the prion protein gene (PRNP) in Korean native black goats. Sci. Rep. 2019, 9, 15293. [Google Scholar] [CrossRef] [Green Version]
- Won, S.Y.; Kim, Y.C.; Do, K.; Jeong, B.H. Absence of Strong Genetic Linkage Disequilibrium between Single Nucleotide Polymorphisms (SNPs) in the Prion Protein Gene (PRNP) and the Prion-Like Protein Gene (PRND) in the Horse, a Prion-Resistant Species. Genes 2020, 11, 518. [Google Scholar] [CrossRef]
- Roh, I.S.; Kim, Y.C.; Kim, H.J.; Won, S.Y.; Jeong, M.J.; Kang, H.E.; Sohn, H.J.; Jeong, B.H. Identification of the prion-related protein gene (PRNT) sequences in various species of the Cervidae family. Mol. Biol. Rep. 2020, 47, 6155–6164. [Google Scholar] [CrossRef]
- Kim, Y.C.; Jeong, M.J.; Jeong, B.H. The first report of genetic variations in the chicken prion protein gene. Prion 2018, 12, 197–203. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sanchez-Garcia, J.; Fernandez-Funez, P. D159 and S167 are protective residues in the prion protein from dog and horse, two prion-resistant animals. Neurobiol. Dis. 2018, 119, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Fernández-Borges, N.; Parra, B.; Vidal, E.; Eraña, H.; Sánchez-Martín, M.A.; de Castro, J.; Elezgarai, S.R.; Pumarola, M.; Mayoral, T.; Castilla, J. Unraveling the key to the resistance of canids to prion diseases. PLoS Pathog. 2017, 13, e1006716. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, C.; Pang, W.; Yang, J.; Zhou, X.; Zhao, D. Amino acid sequence of the Pekingese dog prion protein gene. Xenotransplantation 2006, 13, 471–474. [Google Scholar] [CrossRef] [PubMed]
- Kent, J.W., Jr. Rare variants, common markers: Synthetic association and beyond. Genet. Epidemiol. 2011, 35 (Suppl. 1), S80–S84. [Google Scholar] [CrossRef] [Green Version]
- Morrissey, M.; Shakhnovich, E. Evidence for the role of PrPC helix 1 in the hydrophilic seeding of prion aggregates. Proc. Natl. Acad. Sci. USA 1999, 96, 11293–11298. [Google Scholar] [CrossRef] [Green Version]
- Norstrom, E.M.; Mastrianni, J.A. The charge structure of helix 1 in the prion protein regulates conversion to pathogenic PrPSc. J. Virol. 2006, 80, 8521–8529. [Google Scholar] [CrossRef] [Green Version]
- Pace, C.N.; Fu, H.; Lee Fryar, K.; Landua, J.; Trevino, S.R.; Schell, D.; Thurlkill, R.L.; Imura, S.; Scholtz, J.M.; Gajiwala, K.; et al. Contribution of hydrogen bonds to protein stability. Protein. Sci. 2014, 23, 652–661. [Google Scholar] [CrossRef] [PubMed]
- Jeffrey, G.A. An Introduction to Hydrogen Bonding; Oxford University Press: Oxford, UK, 1997; p. 12. [Google Scholar]
- Hospital, A.; Goni, J.R.; Orozco, M.; Gelpi, J.L. Molecular dynamics simulations: Advances and applications. Adv. Appl. Bioinform. Chem. 2015, 8, 37–47. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hollingsworth, S.A.; Dror, R.O. Molecular Dynamics Simulation for All. Neuron 2018, 99, 1129–1143. [Google Scholar] [CrossRef] [Green Version]
Polymorphisms | Genotype Frequency, n (%) | Allele Frequency, n (%) | HWE | |||
---|---|---|---|---|---|---|
c.-3G>A | GG 205 (98.56) | GA 3 (1.44) | AA 0 (0) | G 413 (99.28) | A 3 (0.72) | 0.916 |
c.128G>A | GG 207 (99.52) | GA 1 (0.48) | AA 0 (0) | G 415 (99.76) | A 1 (0.24) | 0.972 |
c.171C>T | CC 84 (40.38) | CT 64 (30.77) | TT 60 (28.85) | C 232 (55.77) | T 184 (44.23) | 0.000 |
c.201C>T | CC 111 (53.37) | CT 51 (24.52) | TT 46 (22.12) | C 273 (65.63) | T 143 (34.38) | 0.000 |
c.214_240delCCC CACGCCGGCGGA GGCTGGGGTCAG | WT/WT 200 (96.15) | WT/DEL 8 (3.85) | DEL/DEL 0 (0.0) | WT 408 (98.08) | DEL 8 (1.82) | 0.777 |
c.255T>C, G | TT 178 (85.58) | TC 12 (5.77) | CC 0 (0) | T 386 (92.79) | C 12 (2.88) | 0.534 |
TG 18 (8.65) | GG 0 (0) | G 18 (4.33) | ||||
c.264T>C | TT 156 (75.00) | TC 42 (20.19) | CC 10 (4.81) | T 354 (85.10) | C 62 (19.90) | 0.003 |
c.279C>T | CC 204 (98.08) | CT 4 (1.92) | TT 0 (0) | T 412 (99.04) | C 4 (0.96) | 0.888 |
c.457G>A | GG 165 (79.33) | GA 42 (20.19) | AA 1 (0.48) | G 372 (89.42) | A 44 (10.58) | 0.330 |
c.714C>T | CC 202 (97.12) | CT 6 (2.88) | TT 0 (0) | C 410 (98.56) | T 6 (1.44) | 0.832 |
c.774C>T | CC 163 (78.37) | CT 27 (12.98) | TT 18 (8.65) | C 353 (84.86) | T 63 (15.14) | 0.000 |
c.787C>T | CC 206 (99.04) | CT 2 (0.96) | TT 0 (0) | C 414 (99.52) | T 2 (0.48) | 0.944 |
c.789G>A | GG 197 (94.71) | GA 9 (4.33) | AA 2 (0.96) | G 403 (96.88) | A 13 (3.13) | 0.000 |
c.790C>T | CC 197 (94.71) | CT 11 (5.29) | TT 0 (0) | C 405 (97.36) | T 11 (2.64) | 0.695 |
c.797G>A | GG 205 (98.56) | GA 3 (1.44) | AA 0 (0) | G 413 (99.28) | A 3 (0.72) | 0.916 |
c.-3G>A | c.128G>A | c.171C>T | c.201C>T | c.214_240del CCCCACGCCGGCGGAGGCTGGGGTCAG | c.255T>C, G | c.264T>C | c.279C>T | c.457G>A | c.714C>T | c.774C>T | c.787C>T | c.789G>A | c.790C>T | c.797G>A | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
c.-3G>A | - | ||||||||||||||
c.128G>A | 0 | - | |||||||||||||
c.171C>T | 0.009 | 0.002 | - | ||||||||||||
c.201C>T | 0.004 | 0.001 | 0.415 | - | |||||||||||
c.214_240del CCCCACGCCGGCGGAGGCTGGGGTCAG | 0 | 0 | 0.025 | 0.01 | - | ||||||||||
c.255T>C, G | 0.001 | 0 | 0.008 | 0 | 0.252 | - | |||||||||
c.264T>C | 0 | 0.014 | 0.11 | 0.092 | 0.003 | 0.008 | - | ||||||||
c.279C>T | 0 | 0 | 0.012 | 0.005 | 0 | 0.001 | 0 | - | |||||||
c.457G>A | 0.001 | 0.02 | 0.001 | 0 | 0.002 | 0.01 | 0 | 0.001 | - | ||||||
c.714C>T | 0 | 0 | 0.018 | 0.008 | 0.014 | 0 | 0.003 | 0 | 0.003 | - | |||||
c.774C>T | 0.011 | 0 | 0.134 | 0.093 | 0.001 | 0.005 | 0.003 | 0.002 | 0.002 | 0.003 | - | ||||
c.787C>T | 0 | 0 | 0.006 | 0.009 | 0 | 0 | 0.001 | 0 | 0.041 | 0 | 0.002 | - | |||
c.789G>A | 0 | 0.075 | 0.026 | 0.017 | 0.001 | 0.003 | 0.001 | 0 | 0 | 0 | 0 | 0 | - | ||
c.790C>T | 0.024 | 0 | 0.001 | 0 | 0.001 | 0.001 | 0.001 | 0 | 0.001 | 0 | 0 | 0.178 | 0.001 | - | |
c.797G>A | 1.0 | 0 | 0.009 | 0.004 | 0 | 0.001 | 0 | 0 | 0.001 | 0 | 0.011 | 0 | 0 | 0.024 | - |
Haplotype | c.-3G>A | c.128G>A | c.171C>T | c.201C>T | c.214_240del CCCCACGCCGGCGGAGGCTGGGGTCAG | c.255T>C, G | c.264T>C | c.279C>T | c.457G>A | c.714C>T | c.774C>T | c.787C>T | c.789G>A | c.790C>T | c.797G>A | Frequency (n = 416) |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
ht1 | G | G | C | T | Wt | T | T | C | G | C | C | C | G | C | G | 124 (0.298) |
ht2 | G | G | T | C | Wt | T | T | C | G | C | C | C | G | C | G | 92 (0.220) |
ht3 | G | G | T | C | Wt | T | T | C | G | C | T | C | G | C | G | 47 (0.114) |
ht4 | G | G | C | C | Wt | T | C | C | G | C | C | C | G | C | G | 42 (0.101) |
ht5 | G | G | T | C | Wt | T | T | C | A | C | C | C | G | C | G | 13 (0.031) |
ht6 | G | G | C | C | Wt | T | T | C | G | C | C | C | A | C | G | 9 (0.022) |
ht7 | G | G | C | C | Wt | T | T | C | G | C | C | C | G | C | G | 8 (0.020) |
Others | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 81 (0.194) |
Polymorphism | Method | Score | Prediction |
---|---|---|---|
c.128G>A (G43E) | PolyPhen-2 | 1.0 | Probably damaging |
PANTHER | Not scored | Invalid substitution * | |
PROVEAN | −1.381 | ||
c.214_240delCCC CACGCCGGCGG AGGCTGGGGTC AG (p. p.72_80del PHAGGGWGQ) | PROVEAN | −13.052 | Deleterious |
c.457G>A (E153K) | PolyPhen-2 | 0.998 | Probably damaging |
PANTHER | 361 | Possibly damaging | |
PROVEAN | −1.629 | Neutral |
Residue | Substitution | Method | Score | Prediction |
---|---|---|---|---|
Asn166 | Asp166 | Polyphen-2 | 0.000 | Benign |
PANTHER | 220 | Possibly damaging | ||
PROVEAN | −1.173 | Neutral |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, H.-H.; Kim, Y.-C.; Kim, K.; Kim, A.-D.; Jeong, B.-H. Novel Polymorphisms and Genetic Features of the Prion Protein Gene (PRNP) in Cats, Hosts of Feline Spongiform Encephalopathy. Genes 2021, 12, 13. https://doi.org/10.3390/genes12010013
Kim H-H, Kim Y-C, Kim K, Kim A-D, Jeong B-H. Novel Polymorphisms and Genetic Features of the Prion Protein Gene (PRNP) in Cats, Hosts of Feline Spongiform Encephalopathy. Genes. 2021; 12(1):13. https://doi.org/10.3390/genes12010013
Chicago/Turabian StyleKim, Hyeon-Ho, Yong-Chan Kim, Kiwon Kim, An-Dang Kim, and Byung-Hoon Jeong. 2021. "Novel Polymorphisms and Genetic Features of the Prion Protein Gene (PRNP) in Cats, Hosts of Feline Spongiform Encephalopathy" Genes 12, no. 1: 13. https://doi.org/10.3390/genes12010013