Cloning and Functional Characterization of a Flavonoid Transport-Related MATE Gene in Asiatic Hybrid Lilies (Lilium spp.)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. Isolation of a MATE-Like Gene
2.3. Sequence Bioinformatics Analysis
2.4. Phylogenetic Analysis
2.5. Gene Expression Analysis
2.6. Subcellular Localization Analysis
2.7. Complementation Analysis
3. Results
3.1. Cloning and Sequence Analysis of the LhDTX35 Gene
3.2. Expression Analysis of LhDTX35
3.3. Subcellular Localization of LhDTX35
3.4. Functional Analysis of the LhDTX35 Gene in the Arabidopsis DTX35 Gene Mutant
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Jeknić, Z.; Morré, J.T.; Jeknić, S.; Jevremović, S.; Subotić, A.; Chen, T.H.H. Cloning and Functional Characterization of a Gene for Capsanthin-Capsorubin Synthase from Tiger Lily (Lilium lancifolium Thunb. ‘Splendens’). Plant Cell Physiol. 2012, 53, 1899–1912. [Google Scholar] [CrossRef] [PubMed]
- Lai, Y.S.; Shimoyamada, Y.; Nakayama, M.; Yamagishi, M. Pigment accumulation and transcription of LhMYB12 and anthocyanin biosynthesis genes during flower development in the Asiatic hybrid lily (Lilium spp.). Plant Sci. 2012, 193, 136–147. [Google Scholar] [CrossRef] [PubMed]
- Yamagishi, M.; Kishimoto, S.; Nakayama, M. Carotenoid composition and changes in expression of carotenoid biosynthetic genes in tepals of Asiatic hybrid lily. Plant Breed. 2010, 129, 100–107. [Google Scholar] [CrossRef]
- Yamagishi, M.; Yoshida, Y.; Nakayama, M. The transcription factor LhMYB12 determines anthocyanin pigmentation in the tepals of Asiatic hybrid lilies (Lilium spp.) and regulates pigment quantity. Mol. Breed. 2012, 30, 913–925. [Google Scholar] [CrossRef]
- Winkel-Shirley, B. Flavonoid biosynthesis. A colorful model for genetics, biochemistry, cell biology, and biotechnology. Plant Physiol. 2001, 126, 485–493. [Google Scholar] [CrossRef] [Green Version]
- Zhao, J.; Dixon, R.A. The ‘ins’ and ‘outs’ of flavonoid transport. Trends Plant Sci. 2010, 15, 72–80. [Google Scholar] [CrossRef] [Green Version]
- Holton, T.A.; Cornish, E.C. Genetics and biochemistry of anthocyanin biosynthesis. Plant Cell 1995, 7, 1071. [Google Scholar] [CrossRef]
- Liu, Y.; Tikunov, Y.; Schouten, R.E.; Marcelis, L.F.; Visser, R.G.; Bovy, A. Anthocyanin biosynthesis and degradation mechanisms in Solanaceous vegetables: A review. Front. Chem. 2018, 6, 52. [Google Scholar] [CrossRef]
- Hu, B.; Zhao, J.; Lai, B.; Qin, Y.; Wang, H.; Hu, G. LcGST4 is an anthocyanin-related glutathioneS-transferase gene in Litchi chinensis Sonn. Plant Cell Rep. 2016, 35, 831–843. [Google Scholar] [CrossRef]
- Hu, D.G.; Sun, C.H.; Ma, Q.J.; You, C.X.; Cheng, L.; Hao, Y.J. MdMYB1 regulates anthocyanin and malate accumulation by directly facilitating their transport into vacuoles in apples. Plant Physiol. 2016, 170, 1315–1330. [Google Scholar] [CrossRef] [Green Version]
- Luo, H.; Dai, C.; Li, Y.; Feng, J.; Liu, Z.; Kang, C. Reduced Anthocyanins in Petioles codes for a GST anthocyanin transporter that is essential for the foliage and fruit coloration in strawberry. J. Exp. Bot. 2018, 69, 2595–2608. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Takanashi, K.; Shitan, N.; Yazaki, K. The multidrug and toxic compound extrusion (MATE) family in plants. Plant Biotechnol. 2014, 31, 417–430. [Google Scholar] [CrossRef] [Green Version]
- Debeaujon, I.; Peeters, A.J.M.; Léon-Kloosterziel, K.M.; Koornneef, M. The TRANSPARENT TESTA12 gene of Arabidopsis encodes a multidrug secondary transporter-like protein required for flavonoid sequestration in vacuoles of the seed coat endothelium. Plant Cell 2001, 13, 853. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, L.; Liu, Y.; Liu, H.; Kang, L.; Geng, J.; Gai, Y.; Ding, Y.; Sun, H.; Li, Y. Identification and expression analysis of MATE genes involved in flavonoid transport in blueberry Plants. PLoS ONE 2015, 10, e0118578. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Frank, S.; Keck, M.; Sagasser, M.; Niehaus, K.; Weisshaar, B.; Stracke, R. Two differentially expressed MATE factor genes from apple complement the Arabidopsis transparent testa12 mutant. Plant Biol. 2011, 13, 42–50. [Google Scholar] [CrossRef] [PubMed]
- Gomez, C.; Terrier, N.; Torregrosa, L.; Vialet, S.; Fournier-Level, A.; Verriès, C.; Souquet, J.M.; Mazauric, J.P.; Klein, M.; Cheynier, V.; et al. Grapevine MATE-type proteins act as vacuolar H+-dependent acylated anthocyanin transporters. Plant Physiol. 2009, 150, 402. [Google Scholar] [CrossRef] [Green Version]
- Xu, L.; Shen, Z.-L.; Chen, W.; Si, G.Y.; Meng, Y.; Guo, N.; Sun, X.; Cai, Y.P.; Lin, Y.; Gao, J.S. Phylogenetic analysis of upland cotton MATE gene family reveals a conserved subfamily involved in transport of proanthocyanidins. Mol. Biol. Rep. 2019, 46, 161–175. [Google Scholar] [CrossRef]
- Liu, Y.; Lou, Q.; Xu, W.; Xin, Y.; Bassett, C.; Wang, Y. Characterization of a chalcone synthase (CHS) flower-specific promoter from Lilium orential ‘Sorbonne’. Plant Cell Rep. 2011, 30, 2187–2194. [Google Scholar] [CrossRef]
- Nakatsuka, A.; Izumi, Y.; Yamagishi, M. Spatial and temporal expression of chalcone synthase and dihydroflavonol 4-reductase genes in the Asiatic hybrid lily. Plant Sci. 2003, 165, 759–767. [Google Scholar] [CrossRef]
- Yamagishi, M. Oriental hybrid lily Sorbonne homologue of LhMYB12 regulates anthocyanin biosyntheses in flower tepals and tepal spots. Mol. Breed. 2011, 28, 381–389. [Google Scholar] [CrossRef]
- Xu, L.; Yang, P.; Feng, Y.; Xu, H.; Cao, Y.; Tang, Y.; Yuan, S.; Liu, X.; Ming, J. Spatiotemporal transcriptome analysis provides insights into bicolor tepal development in Lilium “Tiny Padhye”. Front. Plant Sci. 2017, 8, 398. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Trivedi, U.; Kaushik, S.; Kunjadia, P.; Matheshwaran, S.; Nareshkumar, G. Expression and purification of functional Anabaena PCC 7120 XisA protein. Protein Expr. Purif. 2015, 118, 64–69. [Google Scholar] [CrossRef] [PubMed]
- Krogh, A.; Larsson, B.; Heijne, G.V.; Sonnhammer, E.L.L. Predicting transmembrane protein topology with a hidden markov model: Application to complete genomes. J. Mol. Biol. 2001, 305, 567–580. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Jyothishwaran, G.; Kotresha, D.; Selvaraj, T.; Srideshikan, S.H.; Rajvanshi, P.K.; Jayabaskaran, C. A modified freeze-thaw method for efficient transformation of Agrobacterium tumefaciens. Curr. Sci. Indian 2007, 6, 770–772. [Google Scholar]
- Clough, S.J.; Bent, A.F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998, 16, 735–743. [Google Scholar] [CrossRef] [Green Version]
- Eckardt, N.A. Move it on out with MATEs. Plant Cell 2001, 13, 1477–1480. [Google Scholar] [CrossRef] [Green Version]
- Thompson, E.P.; Wilkins, C.; Demidchik, V.; Davies, J.M.; Glover, B.J. An Arabidopsis flavonoid transporter is required for anther dehiscence and pollen development. J. Exp. Bot. 2009, 61, 439–451. [Google Scholar] [CrossRef] [Green Version]
- Tiwari, M.; Sharma, D.; Singh, M.; Tripathi, R.D.; Trivedi, P.K. Expression of OsMATE1 and OsMATE2 alters development, stress responses and pathogen susceptibility in Arabidopsis. Sci. Rep. 2014, 4, 3964. [Google Scholar] [CrossRef] [Green Version]
Primers | Primer Sequence (5′-3′) |
---|---|
LhMATE-YZ-F1 LhMATE-YZ-R1 | GTTGCGGTTATCACATCCCT CTTCTTCCCCTCACAGTCTA |
LhDTX35-3’RACE-GSP LhDTX35-3’RACE-nest | CGGTGGGTGGCAAGGTCTGGTAGC GGGCTATCCGTTACATTTGGGTGTGC |
LhDTX35-5’RACE, LhDTX35-5’RACE-nest | CCAAATCCCCTGCACACCCAAA TGGTTCATTCTGTCCACCCCAC |
LhDTX35-F, LhDTX35-R | AGTGGGAGAGAGAGAGAGGCGA CTTCTTCCCCTCACAGTCTATGC |
LhDTX35-YG-F LhDTX35-YG-R | CCAAGAGGATGACATTGCCGAG TGGAGGATGAGGGTGAAGAAGC |
LhDTX35-DW-F LhDTX35-DW-R | CCCCCGGGATGGAAGATCCGCTTCTGAGAC GCTCTAGACACTAACTTGACTTTGTTGGTT |
DW-YZ-F DW-YZ-R | CGGGCTGTTGCGAAAATA TGCCGTTCTTCTGCTTGTC |
LhACT-YG-F LhACT-YG-R | GCATCACACCTTCTACAACG GAAGAGCATAACCCTCATAGA |
Actin-F Actin-R | CGTGACCTTACTGATTACCT AGCGATACCTGAGAACATAG |
LhDTX35-noci-F LhDTX35-Bahm-R | CGGGGGACTCTTGACCATGGAAGATCCGCTTCTGAGACAT GGAAATTCGAGCTGGTCACCTGTAATCTAACTTGACTTTGTTGGTT |
LhDTX35-YZ-F LhDTX35-YZ-R | CGGGCTGTTGCGAAAATA TGCCGTTCTTCTGCTTGTC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, H.; Yang, P.; Cao, Y.; Tang, Y.; He, G.; Xu, L.; Ming, J. Cloning and Functional Characterization of a Flavonoid Transport-Related MATE Gene in Asiatic Hybrid Lilies (Lilium spp.). Genes 2020, 11, 418. https://doi.org/10.3390/genes11040418
Xu H, Yang P, Cao Y, Tang Y, He G, Xu L, Ming J. Cloning and Functional Characterization of a Flavonoid Transport-Related MATE Gene in Asiatic Hybrid Lilies (Lilium spp.). Genes. 2020; 11(4):418. https://doi.org/10.3390/genes11040418
Chicago/Turabian StyleXu, Hua, Panpan Yang, Yuwei Cao, Yuchao Tang, Guoren He, Leifeng Xu, and Jun Ming. 2020. "Cloning and Functional Characterization of a Flavonoid Transport-Related MATE Gene in Asiatic Hybrid Lilies (Lilium spp.)" Genes 11, no. 4: 418. https://doi.org/10.3390/genes11040418