MiR-34b Regulates Muscle Growth and Development by Targeting SYISL
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Overexpression of MiR-34b in Muscles and Phenotype Measurement
2.3. Cell Isolation, Culture, and Transfection
2.4. Plasmid Construction
2.5. Cell Immunofluorescence Staining
2.6. Total RNA Preparation and Quantitative Real-Time PCR (RT-qPCR)
2.7. Western Blotting
2.8. Dual-Luciferase Reporter Assay
2.9. Biotin-Labeled RNA Pulldown
2.10. RNA Binding Protein Immunoprecipitation (RIP) Assay
2.11. Bioinformatics Pipeline for miRNA Target Prediction
2.12. Statistical Analysis
3. Results
3.1. Effects of miR-34b on Skeletal Muscle Mass and Related Genes
3.2. Effects of miR-34b on Genes Related to Myoblast Proliferation and Differentiation
3.3. MiR-34b Directly Binds to SYISL
3.4. MiR-34b Regulates Myoblast Proliferation and Differentiation by Targeting SYISL
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
miRNA | microRNA |
Myf5 | myogenic factor 5 |
MyoD | myogenic determinants |
MyoG | Myogenin |
MyHC | Myosin Heavy Chain |
CDKs | Cyclin-dependent kinases |
WT | wild-type |
Qu | quadriceps |
Gas | gastrocnemius |
TA | tibialis anterior |
DMEM | Dulbecco’s Modified Eagle’s Medium |
HS | horse serum |
RIP | RNA binding protein immunoprecipitation |
FBS | fetal bovine serum |
SD | standard deviation |
RT-qPCR | quantitative real-time PCR |
BW | body weight |
Hela | human cervical cancer cells |
References
- Fielding, R.A.; Ralston, S.H.; Rizzoli, R. Emerging impact of skeletal muscle in health and disease. Calcif. Tissue Int. 2015, 96, 181–182. [Google Scholar] [CrossRef]
- Chal, J.; Pourquié, O. Making muscle: Skeletal myogenesis in vivo and in vitro. Development 2017, 144, 2104–2122. [Google Scholar] [CrossRef]
- Lehka, L.; Rędowicz, M.J. Mechanisms regulating myoblast fusion: A multilevel interplay. Semin. Cell Dev. Biol. 2020, 104, 81–92. [Google Scholar] [CrossRef] [PubMed]
- Campbell, G.J.; Hands, E.L.; Van de Pette, M. The Role of CDKs and CDKIs in Murine Development. Int. J. Mol. Sci. 2020, 21, 5343. [Google Scholar] [CrossRef] [PubMed]
- Karimian, A.; Ahmadi, Y.; Yousefi, B. Multiple functions of p21 in cell cycle, apoptosis and transcriptional regulation after DNA damage. DNA Repair 2016, 42, 63–71. [Google Scholar] [CrossRef]
- Vicente-García, C.; Hernández-Camacho, J.D.; Carvajal, J.J. Regulation of myogenic gene expression. Exp. Cell Res. 2022, 419, 113299. [Google Scholar] [CrossRef] [PubMed]
- Wright, W.E.; Sassoon, D.A.; Lin, V.K. Myogenin, a factor regulating myogenesis, has a domain homologous to MyoD. Cell 1989, 56, 607–617. [Google Scholar] [CrossRef]
- Hill, M.; Tran, N. miRNA interplay: Mechanisms and consequences in cancer. Dis. Models Mech. 2021, 14, dmm047662. [Google Scholar] [CrossRef]
- Harding, R.L.; Velleman, S.G. MicroRNA regulation of myogenic satellite cell proliferation and differentiation. Mol. Cell. Biochem. 2016, 412, 181–195. [Google Scholar] [CrossRef]
- Wu, P.; He, M.; Zhang, X.; Zhou, K.; Zhang, T.; Xie, K.; Dai, G.; Wang, J.; Wang, X.; Zhang, G. miRNA-seq analysis in skeletal muscle of chicken and function exploration of miR-24-3p. Poult. Sci. 2022, 101, 102120. [Google Scholar] [CrossRef]
- He, J.; Wang, F.; Zhang, P.; Li, W.; Wang, J.; Li, J.; Liu, H.; Chen, X. miR-491 inhibits skeletal muscle differentiation through targeting myomaker. Arch. Biochem. Biophys. 2017, 625–626, 30–38. [Google Scholar] [CrossRef]
- Shao, X.; Gong, W.; Wang, Q.; Wang, P.; Shi, T.; Mahmut, A.; Qin, J.; Yao, Y.; Yan, W.; Chen, D.; et al. Atrophic skeletal muscle fibre-derived small extracellular vesicle miR-690 inhibits satellite cell differentiation during ageing. J. Cachexia Sarcopenia Muscle 2022, 13, 3163–3180. [Google Scholar] [CrossRef] [PubMed]
- Alexander, M.S.; Kawahara, G.; Motohashi, N.; Casar, J.C.; Eisenberg, I.; Myers, J.A.; Gasperini, M.J.; Estrella, E.A.; Kho, A.T.; Mitsuhashi, S.; et al. MicroRNA-199a is induced in dystrophic muscle and affects WNT signaling, cell proliferation, and myogenic differentiation. Cell Death Differ. 2013, 20, 1194–1208. [Google Scholar] [CrossRef]
- Khan, R.; Abbasi, S.A.; Mansoor, Q.; Ahmed, M.N.; Mir, K.B.; Baig, R.M. Analysis of Rare Alleles of miRNA-146a (rs2910164) and miRNA-34b/c (rs4938723) as a Prognostic Marker in Thyroid Cancer in Pakistani Population. Diagnostics 2022, 12, 2495. [Google Scholar] [CrossRef] [PubMed]
- Daugaard, I.; Knudsen, A.; Kjeldsen, T.E.; Hager, H.; Hansen, L.L. The association between miR-34 dysregulation and distant metastases formation in lung adenocarcinoma. Exp. Mol. Pathol. 2017, 102, 484–491. [Google Scholar] [CrossRef]
- Liu, C.; Rokavec, M.; Huang, Z.; Hermeking, H. Curcumin activates a ROS/KEAP1/NRF2/miR-34a/b/c cascade to suppress colorectal cancer metastasis. Cell Death Differ. 2023, 30, 1771–1785. [Google Scholar] [CrossRef] [PubMed]
- Córdova-Rivas, S.; Fraire-Soto, I.; Mercado-Casas Torres, A.; Servín-González, L.S.; Granados-López, A.J.; López-Hernández, Y.; Reyes-Estrada, C.A.; Gutiérrez-Hernández, R.; Castañeda-Delgado, J.E.; Ramírez-Hernández, L.; et al. 5p and 3p Strands of miR-34 Family Members Have Differential Effects in Cell Proliferation, Migration, and Invasion in Cervical Cancer Cells. Int. J. Mol. Sci. 2019, 20, 545. [Google Scholar] [CrossRef]
- Otto, T.; Candido, S.V.; Pilarz, M.S.; Sicinska, E.; Bronson, R.T.; Bowden, M.; Lachowicz, I.A.; Mulry, K.; Fassl, A.; Han, R.C.; et al. Cell cycle-targeting microRNAs promote differentiation by enforcing cell-cycle exit. Proc. Natl. Acad. Sci. USA 2017, 114, 10660–10665. [Google Scholar] [CrossRef]
- Jin, J.J.; Lv, W.; Xia, P.; Xu, Z.Y.; Zheng, A.D.; Wang, X.J.; Wang, S.S.; Zeng, R.; Luo, H.M.; Li, G.L.; et al. Long noncoding RNA SYISL regulates myogenesis by interacting with polycomb repressive complex 2. Proc. Natl. Acad. Sci. USA 2018, 115, E9802–E9811. [Google Scholar] [CrossRef]
- Lv, W.; Peng, Y.; Hu, J.; Zhu, M.; Mao, Y.; Wang, L.; Wang, G.; Xu, Z.; Wu, W.; Zuo, B. Functional SNPs in SYISL promoter significantly affect muscle fiber density and muscle traits in pigs. Anim. Genet. 2024, 55, 66–78. [Google Scholar] [CrossRef]
- Jin, J.; Du, M.; Wang, J.; Guo, Y.; Zhang, J.; Zuo, H.; Hou, Y.; Wang, S.; Lv, W.; Bai, W.; et al. Conservative analysis of Synaptopodin-2 intron sense-overlapping lncRNA reveals its novel function in promoting muscle atrophy. J. Cachexia Sarcopenia Muscle 2022, 13, 2017–2030. [Google Scholar] [CrossRef]
- Yue, F.; Bi, P.; Wang, C.; Li, J.; Liu, X.; Kuang, S. Conditional Loss of Pten in Myogenic Progenitors Leads to Postnatal Skeletal Muscle Hypertrophy but Age-Dependent Exhaustion of Satellite Cells. Cell Rep. 2016, 17, 2340–2353. [Google Scholar] [CrossRef] [PubMed]
- Lv, W.; Jin, J.; Xu, Z.; Luo, H.; Guo, Y.; Wang, X.; Wang, S.; Zhang, J.; Zuo, H.; Bai, W.; et al. LncMGPF is a novel positive regulator of muscle growth and regeneration. J. Cachexia Sarcopenia Muscle 2020, 11, 1723–1746. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Zhang, Y.; Li, W.; Zhu, M.; Li, Y.; Xu, Z.; Zuo, B. FHL3 differentially regulates the expression of MyHC isoforms through interactions with MyoD and pCREB. Cell. Signal. 2016, 28, 60–73. [Google Scholar] [CrossRef] [PubMed]
- Rion, N.; Castets, P.; Lin, S.; Enderle, L.; Reinhard, J.R.; Eickhorst, C.; Rüegg, M.A. mTOR controls embryonic and adult myogenesis via mTORC1. Development 2019, 146, dev17247. [Google Scholar] [CrossRef]
- Guan, H.; Zhu, T.; Wu, S.; Liu, S.; Liu, B.; Wu, J.; Cai, J.; Zhu, X.; Zhang, X.; Zeng, M.; et al. Long noncoding RNA LINC00673-v4 promotes aggressiveness of lung adenocarcinoma via activating WNT/β-catenin signaling. Proc. Natl. Acad. Sci. USA 2019, 116, 14019–14028. [Google Scholar] [CrossRef]
- Wadley, G.D.; Lamon, S.; Alexander, S.E.; McMullen, J.R.; Bernardo, B.C. Noncoding RNAs regulating cardiac muscle mass. J. Appl. Physiol. 2019, 127, 633–644. [Google Scholar] [CrossRef]
- Li, Y.; Meng, X.; Li, G.; Zhou, Q.; Xiao, J. Noncoding RNAs in Muscle Atrophy. Adv. Exp. Med. Biol. 2018, 1088, 249–266. [Google Scholar]
- Pan, W.; Chai, B.; Li, L.; Lu, Z.; Ma, Z. p53/MicroRNA-34 axis in cancer and beyond. Heliyon 2023, 9, e15155. [Google Scholar] [CrossRef]
- Ali Syeda, Z.; Langden, S.S.S.; Munkhzul, C.; Lee, M.; Song, S.J. Regulatory Mechanism of MicroRNA Expression in Cancer. Int. J. Mol. Sci. 2020, 21, 1723. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.; Bai, X.; Zeng, X.; Liu, J.; Liu, F.; Zhang, Z. circRNA-miRNA-mRNA in breast cancer. Clin. Chim. Acta Int. J. Clin. Chem. 2021, 523, 120–130. [Google Scholar] [CrossRef] [PubMed]
- Natarelli, L.; Geißler, C.; Csaba, G.; Wei, Y.; Zhu, M.; di Francesco, A.; Hartmann, P.; Zimmer, R.; Schober, A. miR-103 promotes endothelial maladaptation by targeting lncWDR59. Nat. Commun. 2018, 9, 2645. [Google Scholar] [CrossRef] [PubMed]
- Chahal, J.; Gebert, L.F.R.; Gan, H.H.; Camacho, E.; Gunsalus, K.C.; MacRae, I.J.; Sagan, S.M. miR-122 and Ago interactions with the HCV genome alter the structure of the viral 5’ terminus. Nucleic Acids Res. 2019, 47, 5307–5324. [Google Scholar] [CrossRef]
Primer | Sequence | Tm (°C) |
---|---|---|
SYISL | F: CTCGTGGTCCCTCCCTGTAA | 60 |
R: GTCTGCGTGCTCCTGTGGTT | ||
MyHC | F: CAAGTCATCGGTGTTTGTGG | 60 |
R: TGTCGTACTTGGGCGGGTTC | ||
MyoG | F: CCATCCAGTACATTGAGCGCCTACA | 60 |
R: ACGATGGACGTAAGGGAGTGCAGAT | ||
MyoD | F: CGAGCACTACAGTTGGCGACTAAGA | 60 |
R: GCTCCACTATGCTGGACAGGCAGT | ||
β-actin | F: GCCTCACTGTCCACCTTCCA | 60 |
R: AGCCATGCCAATGTTGTCTCTT | ||
CDK6 | F: GGCGTACCCACAGAAACCATA | 60 |
R: AGGTAAGGGCCATCTGAAAACT | ||
Ki67 | F: ATCATTGACCGCTCCTTTAGGT | 60 |
R: GCTCGCCTTGATGGTTCCT | ||
p21 | F: ATGTCCAATCCTGGTGATGTCC | 60 |
R: AGTCAAAGTTCCACCGTTCTCG | ||
miR-34b | F: GCGCGAATCACTAACTCCACT | 60 |
R: AGTGCAGGGTCCGAGGTATT | ||
U6 | F: GCTTCGGCAGCACATATACT | 60 |
R: TTCACGAATTTGCGTGTCAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, Y.; Liu, X.; Fan, Y.; Zuo, H.; Niu, X.; Zuo, B.; Xu, Z. MiR-34b Regulates Muscle Growth and Development by Targeting SYISL. Cells 2025, 14, 379. https://doi.org/10.3390/cells14050379
Wu Y, Liu X, Fan Y, Zuo H, Niu X, Zuo B, Xu Z. MiR-34b Regulates Muscle Growth and Development by Targeting SYISL. Cells. 2025; 14(5):379. https://doi.org/10.3390/cells14050379
Chicago/Turabian StyleWu, Yuting, Xiao Liu, Yonghui Fan, Hao Zuo, Xiaoyu Niu, Bo Zuo, and Zaiyan Xu. 2025. "MiR-34b Regulates Muscle Growth and Development by Targeting SYISL" Cells 14, no. 5: 379. https://doi.org/10.3390/cells14050379
APA StyleWu, Y., Liu, X., Fan, Y., Zuo, H., Niu, X., Zuo, B., & Xu, Z. (2025). MiR-34b Regulates Muscle Growth and Development by Targeting SYISL. Cells, 14(5), 379. https://doi.org/10.3390/cells14050379