Female Mice Lacking LSD1 in Myeloid Cells Are Resistant to Inflammatory Bone Loss
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics
2.2. LSD1 Mice
2.3. Primary Osteoclast Culture from Femurs
2.4. Primary Osteoclast Culture from Mandibles
2.5. Bulk RNA-SEQ
2.6. Real-Time Quantitative PCR Analysis
2.7. Ligature-Induced Periodontitis (LIP)
2.8. Micro-CT Analysis for Alveolar Bone Loss
2.9. K/BxN Serum-Transfer Arthritis Mouse Moadel
2.10. Micro-CT Analysis for Quantification of Rheumatoid Arthritis-Induced Boney Lesions
2.11. Paraffin-Embedded TRAP Staining
2.12. TGF-β- and TNF-Induced Osteoclast Differentiation
2.13. Statistical Analysis
3. Results
3.1. Deletion of LSD1 Inhibits LIP-Induced Alveolar Bone Loss
3.2. Knockout of LSD1 Results in Decreased Bone Lesions and Ankle Thickness in Mice with K/BxN-Serum-Transferred Arthritis
3.3. Increase in IFN-β Regulated Genes in LSD1cKO Preosteoclasts
3.4. LSD1 Expression in the Femur Is Necessary for TNF-Induced Osteoclast Differentiation
3.5. LSD1cKO Preosteoclasts Have Dysregulated Inflammatory Genes
3.6. Loss of LSD1 Expression Enhances Lipid Metabolism and Expression of Transport Genes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Boyle, W.J.; Simonet, W.S.; Lacey, D.L. Osteoclast differentiation and activation. Nature 2003, 423, 337–342. [Google Scholar] [CrossRef] [PubMed]
- Quinn, J.M.; Elliott, J.; Gillespie, M.T.; Martin, T.J. A combination of osteoclast differentiation factor and macrophage-colony stimulating factor is sufficient for both human and mouse osteoclast formation in vitro. Endocrinology 1998, 139, 4424–4427. [Google Scholar] [CrossRef] [PubMed]
- Hascoet, E.; Blanchard, F.; Blin-Wakkach, C.; Guicheux, J.; Lesclous, P.; Cloitre, A. New insights into inflammatory osteoclast precursors as therapeutic targets for rheumatoid arthritis and periodontitis. Bone Res. 2023, 11, 26. [Google Scholar] [CrossRef] [PubMed]
- Li, R.; Tian, C.; Postlethwaite, A.; Jiao, Y.; Garcia-Godoy, F.; Pattanaik, D.; Wei, D.; Gu, W.; Li, J. Rheumatoid arthritis and periodontal disease: What are the similarities and differences? Int. J. Rheum. Dis. 2017, 20, 1887–1901. [Google Scholar] [CrossRef] [PubMed]
- Lin, Y.J.; Anzaghe, M.; Schulke, S. Update on the Pathomechanism, Diagnosis, and Treatment Options for Rheumatoid Arthritis. Cells 2020, 9, 880. [Google Scholar] [CrossRef] [PubMed]
- Zhao, B. Intrinsic Restriction of TNF-Mediated Inflammatory Osteoclastogenesis and Bone Resorption. Front. Endocrinol. 2020, 11, 583561. [Google Scholar] [CrossRef] [PubMed]
- Lam, J.; Takeshita, S.; Barker, J.E.; Kanagawa, O.; Ross, F.P.; Teitelbaum, S.L. TNF-alpha induces osteoclastogenesis by direct stimulation of macrophages exposed to permissive levels of RANK ligand. J. Clin. Investig. 2000, 106, 1481–1488. [Google Scholar] [CrossRef] [PubMed]
- Kim, N.; Kadono, Y.; Takami, M.; Lee, J.; Lee, S.H.; Okada, F.; Kim, J.H.; Kobayashi, T.; Odgren, P.R.; Nakano, H.; et al. Osteoclast differentiation independent of the TRANCE-RANK-TRAF6 axis. J. Exp. Med. 2005, 202, 589–595. [Google Scholar] [CrossRef] [PubMed]
- Kobayashi, K.; Takahashi, N.; Jimi, E.; Udagawa, N.; Takami, M.; Kotake, S.; Nakagawa, N.; Kinosaki, M.; Yamaguchi, K.; Shima, N.; et al. Tumor necrosis factor alpha stimulates osteoclast differentiation by a mechanism independent of the ODF/RANKL-RANK interaction. J. Exp. Med. 2000, 191, 275–286. [Google Scholar] [CrossRef] [PubMed]
- Marahleh, A.; Kitaura, H.; Ohori, F.; Kishikawa, A.; Ogawa, S.; Shen, W.R.; Qi, J.; Noguchi, T.; Nara, Y.; Mizoguchi, I. TNF-alpha Directly Enhances Osteocyte RANKL Expression and Promotes Osteoclast Formation. Front. Immunol. 2019, 10, 2925. [Google Scholar] [CrossRef]
- Brennan, F.M.; McInnes, I.B. Evidence that cytokines play a role in rheumatoid arthritis. J. Clin. Investig. 2008, 118, 3537–3545. [Google Scholar] [CrossRef] [PubMed]
- Xia, Y.; Inoue, K.; Du, Y.; Baker, S.J.; Reddy, E.P.; Greenblatt, M.B.; Zhao, B. TGFbeta reprograms TNF stimulation of macrophages towards a non-canonical pathway driving inflammatory osteoclastogenesis. Nat. Commun. 2022, 13, 3920. [Google Scholar] [CrossRef] [PubMed]
- Gurkan, A.; Emingil, G.; Cinarcik, S.; Berdeli, A. Gingival crevicular fluid transforming growth factor-beta1 in several forms of periodontal disease. Arch. Oral Biol. 2006, 51, 906–912. [Google Scholar] [CrossRef] [PubMed]
- Skaleric, U.; Kramar, B.; Petelin, M.; Pavlica, Z.; Wahl, S.M. Changes in TGF-beta 1 levels in gingiva, crevicular fluid and serum associated with periodontal inflammation in humans and dogs. Eur. J. Oral Sci. 1997, 105, 136–142. [Google Scholar] [CrossRef] [PubMed]
- Shi, C.; Pamer, E.G. Monocyte recruitment during infection and inflammation. Nat. Rev. Immunol. 2011, 11, 762–774. [Google Scholar] [CrossRef] [PubMed]
- Charles, J.F.; Hsu, L.Y.; Niemi, E.C.; Weiss, A.; Aliprantis, A.O.; Nakamura, M.C. Inflammatory arthritis increases mouse osteoclast precursors with myeloid suppressor function. J. Clin. Investig. 2012, 122, 4592–4605. [Google Scholar] [CrossRef] [PubMed]
- Hasegawa, T.; Kikuta, J.; Sudo, T.; Matsuura, Y.; Matsui, T.; Simmons, S.; Ebina, K.; Hirao, M.; Okuzaki, D.; Yoshida, Y.; et al. Identification of a novel arthritis-associated osteoclast precursor macrophage regulated by FoxM1. Nat. Immunol. 2019, 20, 1631–1643. [Google Scholar] [CrossRef] [PubMed]
- Astleford-Hopper, K.; Abrahante Llorens, J.E.; Bradley, E.W.; Mansky, K.C. Lysine specific demethylase 1 conditional myeloid cell knockout mice have decreased osteoclast differentiation due to increased IFN-beta gene expression. JBMR Plus 2025, 9, ziae142. [Google Scholar] [CrossRef] [PubMed]
- Clark, R.; Park, S.Y.; Bradley, E.W.; Mansky, K.; Tasca, A. Mouse mandibular-derived osteoclast progenitors have differences in intrinsic properties compared with femoral-derived progenitors. JBMR Plus 2024, 8, ziae029. [Google Scholar] [CrossRef] [PubMed]
- Abe, T.; Hajishengallis, G. Optimization of the ligature-induced periodontitis model in mice. J. Immunol. Methods 2013, 394, 49–54. [Google Scholar] [CrossRef] [PubMed]
- Johnstone, K.F.; Wei, Y.; Bittner-Eddy, P.D.; Vreeman, G.W.; Stone, I.A.; Clayton, J.B.; Reilly, C.S.; Walbon, T.B.; Wright, E.N.; Hoops, S.L.; et al. Calprotectin (S100A8/A9) Is an Innate Immune Effector in Experimental Periodontitis. Infect. Immun. 2021, 89, e0012221. [Google Scholar] [CrossRef] [PubMed]
- Das, M.; Deb, M.; Laha, D.; Joseph, M.; Kanji, S.; Aggarwal, R.; Iwenofu, O.H.; Pompili, V.J.; Jarjour, W.; Das, H. Myeloid Kruppel-Like Factor 2 Critically Regulates K/BxN Serum-Induced Arthritis. Cells 2019, 8, 908. [Google Scholar] [CrossRef] [PubMed]
- Bouxsein, M.L.; Boyd, S.K.; Christiansen, B.A.; Guldberg, R.E.; Jepsen, K.J.; Muller, R. Guidelines for assessment of bone microstructure in rodents using micro-computed tomography. J. Bone Min. Res. 2010, 25, 1468–1486. [Google Scholar] [CrossRef] [PubMed]
- Takayanagi, H.; Kim, S.; Matsuo, K.; Suzuki, H.; Suzuki, T.; Sato, K.; Yokochi, T.; Oda, H.; Nakamura, K.; Ida, N.; et al. RANKL maintains bone homeostasis through c-Fos-dependent induction of interferon-beta. Nature 2002, 416, 744–749. [Google Scholar] [CrossRef] [PubMed]
- Jiang, N.; An, J.; Yang, K.; Liu, J.; Guan, C.; Ma, C.; Tang, X. NLRP3 Inflammasome: A New Target for Prevention and Control of Osteoporosis? Front. Endocrinol. 2021, 12, 752546. [Google Scholar] [CrossRef] [PubMed]
- Semenza, G.L. Hypoxia-inducible factors in physiology and medicine. Cell 2012, 148, 399–408. [Google Scholar] [CrossRef] [PubMed]
- Yee Koh, M.; Spivak-Kroizman, T.R.; Powis, G. HIF-1 regulation: Not so easy come, easy go. Trends Biochem. Sci. 2008, 33, 526–534. [Google Scholar] [CrossRef] [PubMed]
- Kachler, K.; Andreev, D.; Thapa, S.; Royzman, D.; Giessl, A.; Karuppusamy, S.; Llerins Perez, M.; Liu, M.; Hofmann, J.; Gessner, A.; et al. Acod1-mediated inhibition of aerobic glycolysis suppresses osteoclast differentiation and attenuates bone erosion in arthritis. Ann. Rheum. Dis. 2024, 83, 1691–1706. [Google Scholar] [CrossRef] [PubMed]
- Saavedra, F.M.; Brotto, D.B.; Joag, V.; Matson, C.A.; Nesmiyanov, P.P.; Herzberg, M.C.; Vezys, V.; Masopust, D.; Stolley, J.M. Triggering mouth-resident antiviral CD8(+) T cells potentiates experimental periodontitis. Mucosal. Immunol. 2025, 18, 620–630. [Google Scholar] [CrossRef] [PubMed]
- Martin-Millan, M.; Almeida, M.; Ambrogini, E.; Han, L.; Zhao, H.; Weinstein, R.S.; Jilka, R.L.; O’Brien, C.A.; Manolagas, S.C. The estrogen receptor-alpha in osteoclasts mediates the protective effects of estrogens on cancellous but not cortical bone. Mol. Endocrinol. 2010, 24, 323–334. [Google Scholar] [CrossRef] [PubMed]
- Nakamura, T.; Imai, Y.; Matsumoto, T.; Sato, S.; Takeuchi, K.; Igarashi, K.; Harada, Y.; Azuma, Y.; Krust, A.; Yamamoto, Y.; et al. Estrogen prevents bone loss via estrogen receptor alpha and induction of Fas ligand in osteoclasts. Cell 2007, 130, 811–823. [Google Scholar] [CrossRef] [PubMed]
- Weitzmann, M.N.; Pacifici, R. Estrogen deficiency and bone loss: An inflammatory tale. J. Clin. Investig. 2006, 116, 1186–1194. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.N.; Ponte, F.; Nookaew, I.; Ucer Ozgurel, S.; Marques-Carvalho, A.; Iyer, S.; Warren, A.; Aykin-Burns, N.; Krager, K.; Sardao, V.A.; et al. Estrogens decrease osteoclast number by attenuating mitochondria oxidative phosphorylation and ATP production in early osteoclast precursors. Sci. Rep. 2020, 10, 11933. [Google Scholar] [CrossRef] [PubMed]
- Chakraborty, B.; Byemerwa, J.; Shepherd, J.; Haines, C.N.; Baldi, R.; Gong, W.; Liu, W.; Mukherjee, D.; Artham, S.; Lim, F.; et al. Inhibition of estrogen signaling in myeloid cells increases tumor immunity in melanoma. J. Clin. Investig. 2021, 131, e151347. [Google Scholar] [CrossRef] [PubMed]
- Kovats, S. Estrogen receptors regulate innate immune cells and signaling pathways. Cell. Immunol. 2015, 294, 63–69. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Carnesecchi, J.; Cerutti, C.; Tribollet, V.; Perian, S.; Forcet, C.; Wong, J.; Vanacker, J.M. LSD1-ERRalpha complex requires NRF1 to positively regulate transcription and cell invasion. Sci. Rep. 2018, 8, 10041. [Google Scholar] [CrossRef]
- Bennesch, M.A.; Segala, G.; Wider, D.; Picard, D. LSD1 engages a corepressor complex for the activation of the estrogen receptor alpha by estrogen and cAMP. Nucleic Acids Res. 2016, 44, 8655–8670. [Google Scholar] [CrossRef] [PubMed]
- Rummukainen, P.; Tarkkonen, K.; Dudakovic, A.; Al-Majidi, R.; Nieminen-Pihala, V.; Valensisi, C.; Hawkins, R.D.; van Wijnen, A.J.; Kiviranta, R. Lysine-Specific Demethylase 1 (LSD1) epigenetically controls osteoblast differentiation. PLoS ONE 2022, 17, e0265027. [Google Scholar] [CrossRef] [PubMed]
- Andersen, C.J. Lipid Metabolism in Inflammation and Immune Function. Nutrients 2022, 14, 1414. [Google Scholar] [CrossRef] [PubMed]
- Michelucci, A.; Cordes, T.; Ghelfi, J.; Pailot, A.; Reiling, N.; Goldmann, O.; Binz, T.; Wegner, A.; Tallam, A.; Rausell, A.; et al. Immune-responsive gene 1 protein links metabolism to immunity by catalyzing itaconic acid production. Proc. Natl. Acad. Sci. USA 2013, 110, 7820–7825. [Google Scholar] [CrossRef] [PubMed]
- Degrandi, D.; Hoffmann, R.; Beuter-Gunia, C.; Pfeffer, K. The proinflammatory cytokine-induced IRG1 protein associates with mitochondria. J. Interferon Cytokine Res. 2009, 29, 55–67. [Google Scholar] [CrossRef] [PubMed]
- Wu, R.; Chen, F.; Wang, N.; Tang, D.; Kang, R. ACOD1 in immunometabolism and disease. Cell. Mol. Immunol. 2020, 17, 822–833. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Yang, Q.; Lv, C.; Chen, Y.; Zhao, W.; Li, W.; Chen, H.; Wang, H.; Sun, W.; Yuan, H. NLRP3 regulates alveolar bone loss in ligature-induced periodontitis by promoting osteoclastic differentiation. Cell Prolif. 2021, 54, e12973. [Google Scholar] [CrossRef] [PubMed]
- Qi, X.; Bie, M.; Jiang, R.; Kang, F. HIF-1alpha regulates osteoclastogenesis and alveolar bone resorption in periodontitis via ANGPTL4. Arch. Oral Biol. 2023, 153, 105736. [Google Scholar] [CrossRef] [PubMed]






| Mouse Model | Source and Catalog Number | Providing Laboratory |
|---|---|---|
| LSD1 floxed | Jackson Labs 023969 | Dr. Stuart Orkin |
| LysM-Cre | Jackson Labs 026861 | none |
| C57Bl/6J | Jackson Labs 000664 | none |
| Genotyping primers | ||
| LSD1 | F:GCTGGATTGAGTTGGTTGTG | |
| R:CTGCTCCTGAAAGACCTGCT | ||
| LysM-Cre | F:TCCAATTTACTGACCGTACACCAA | |
| R:CCTGATCCTGGCAATTTCGGCTA | ||
| Gene | 5′–3′ Primer |
|---|---|
| Cyp1b | F: GCCACTATTACGGACATCTTCGG R: ACAACCTGGTCCAACTCAGCCT |
| Cyp27 | F: TCAGGAGACCATCGGCACCTT R: CCAGTCACTTCCTTGTGCAAGG |
| Cyp39 | F: ATCCAAAAGATGGCTCCTGGC R: TGTTTCCGTCTCCACCACTTCC |
| Abcg2 | F: CAGTTCTCAGCAGCTCTTCGA R: TCCTCCAGAGATGCCACGGAT |
| Abcg3 | F: CTTCATGGACGAAGCTGACCTG R: GTGCGGTTCTTTTACCAGCGTC |
| Alox5 | F: TCTTCCTGGCACGACTTTGCTG R: GCAGCCATTCAGGAACTGGTAG |
| Alox15 | F: GACACTTGGTGGCTGAGGTCTT R: TCTCTGAGATCAGGTCGCTCCT |
| Ifit1 | F: CAACTGAGGACATCCCGAAACA R: ATGTGGGCCTCAGTTTCAAAGT |
| Ifit2 | F: AGTACAACGAGTAAGGAGTCACT R: AGGCCAGTATGTTGCACATGG |
| Ifit3 | F: TGAGGAAGGGTGGACACAAC R: ACATCGCAATTGCCAGTCCA |
| Oasl2 | F: AGGGGACAACCCTGAACCA R: TAGGCCAGGCTTCTGCTACA |
| Nlrp3 | F: TCACAACTCGCCCAAGGAGGAA R: AAGAGACCACGGCAGAAGCTAG |
| Acod1 | F: GGCACAGAAGTGTTCCATAAAGT R: GAGGCAGGGCTTCCGATA |
| Hif1a | F: CCTGCACTGAATCAAGAGGTTGC R: CCATCAGAAGGACTTGCTGGCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Astleford-Hopper, K.; Saavedra, F.; Bittner-Eddy, P.; Stein, C.; Auger, J.; Clark, R.; Abrahante Llorens, J.E.; Binstadt, B.A.; Thumbigere-Math, V.; Mansky, K.C. Female Mice Lacking LSD1 in Myeloid Cells Are Resistant to Inflammatory Bone Loss. Cells 2025, 14, 1111. https://doi.org/10.3390/cells14141111
Astleford-Hopper K, Saavedra F, Bittner-Eddy P, Stein C, Auger J, Clark R, Abrahante Llorens JE, Binstadt BA, Thumbigere-Math V, Mansky KC. Female Mice Lacking LSD1 in Myeloid Cells Are Resistant to Inflammatory Bone Loss. Cells. 2025; 14(14):1111. https://doi.org/10.3390/cells14141111
Chicago/Turabian StyleAstleford-Hopper, Kristina, Flavia Saavedra, Peter Bittner-Eddy, Clara Stein, Jennifer Auger, Rachel Clark, Juan E. Abrahante Llorens, Bryce A. Binstadt, Vivek Thumbigere-Math, and Kim C. Mansky. 2025. "Female Mice Lacking LSD1 in Myeloid Cells Are Resistant to Inflammatory Bone Loss" Cells 14, no. 14: 1111. https://doi.org/10.3390/cells14141111
APA StyleAstleford-Hopper, K., Saavedra, F., Bittner-Eddy, P., Stein, C., Auger, J., Clark, R., Abrahante Llorens, J. E., Binstadt, B. A., Thumbigere-Math, V., & Mansky, K. C. (2025). Female Mice Lacking LSD1 in Myeloid Cells Are Resistant to Inflammatory Bone Loss. Cells, 14(14), 1111. https://doi.org/10.3390/cells14141111

