Inherited Thrombocytopenia Related Genes: GPS2 Mediates the Interplay Between ANKRD26 and ETV6
Abstract
1. Introduction
2. Material and Methods
2.1. Cell Culture and Transfection
2.2. RNA Extraction and Quantitative Real-Time PCR
2.3. Western Blot and Coimmunoprecipitation (Co-IP) Experiments
2.4. Dual Luciferase Assays
2.5. Proximity Ligation Assay
2.6. Immunofluorescence
2.7. Plasmids
2.8. Statistical Analyses and Reproducibility
3. Results and Discussion
3.1. Unraveling the Interplay Between ANKRD26 and ETV6
3.2. GPS2 Mediates ANKRD26/ETV6 Interaction
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Savoia, A. Molecular basis of inherited thrombocytopenias. Clin. Genet. 2016, 89, 154–162. [Google Scholar] [CrossRef]
- Yan, H.; Chen, C.; Chen, H.; Hong, H.; Huang, Y.; Ling, K.; Hu, J.; Wei, Q. TALPID3 and ANKRD26 selectively orchestrate FBF1 localization and cilia gating. Nat. Commun. 2020, 11, 2196. [Google Scholar] [CrossRef] [PubMed]
- Fava, L.L.; Schuler, F.; Sladky, V.; Haschka, M.D.; Soratroi, C.; Eiterer, L.; Demetz, E.; Weiss, G.; Geley, S.; Nigg, E.A.; et al. The PIDDosome activates p53 in response to supernumerary centrosomes. Genes. Dev. 2017, 31, 34–45. [Google Scholar] [CrossRef]
- Burigotto, M.; Mattivi, A.; Migliorati, D.; Magnani, G.; Valentini, C.; Roccuzzo, M.; Offterdinger, M.; Pizzato, M.; Schmidt, A.; Villunger, A.; et al. Centriolar distal appendages activate the centrosome-PIDDosome-p53 signalling axis via ANKRD26. EMBO J. 2020, 40, e104844. [Google Scholar] [CrossRef]
- Evans, L.T.; Anglen, T.; Scott, P.; Lukasik, K.; Loncarek, J.; Holland, A.J. ANKRD26 recruits PIDD1 to centriolar distal appendages to activate the PIDDosome following centrosome amplification. EMBO J. 2020, 40, e105106. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.-F.; Bera, T.K.; Kahue, C.; Escobar, T.; Fei, Z.; Raciti, G.A.; Pastan, I. ANKRD26 and Its Interacting Partners TRIO, GPS2, HMMR and DIPA Regulate Adipogenesis in 3T3-L1 Cells. PLoS ONE 2012, 7, e38130. [Google Scholar] [CrossRef] [PubMed]
- Bluteau, D.; Balduini, A.; Balayn, N.; Currao, M.; Nurden, P.; Deswarte, C.; Leverger, G.; Noris, P.; Perrotta, S.; Solary, E.; et al. Thrombocytopenia-associated mutations in the ANKRD26 regulatory region induce MAPK hyperactivation. J. Clin. Investig. 2014, 124, 580–591. [Google Scholar] [CrossRef]
- Pippucci, T.; Savoia, A.; Perrotta, S.; Pujol-Moix, N.; Noris, P.; Castegnaro, G.; Pecci, A.; Gnan, C.; Punzo, F.; Marconi, C.; et al. Mutations in the 5′ UTR of ANKRD26, the Ankirin Repeat Domain 26 Gene, Cause an Autosomal-Dominant Form of Inherited Thrombocytopenia, THC2. Am. J. Hum. Genet. 2011, 88, 115–120. [Google Scholar] [CrossRef] [PubMed]
- Wahlster, L.; Verboon, J.M.; Ludwig, L.S.; Black, S.C.; Luo, W.; Garg, K.; Voit, R.A.; Collins, R.L.; Garimella, K.; Costello, M.; et al. Familial thrombocytopenia due to a complex structural variant resulting in a WAC-ANKRD26 fusion transcript. J. Exp. Med. 2021, 218, e20210444. [Google Scholar] [CrossRef] [PubMed]
- Yuan, J.; Dong, X.; Yap, J.; Hu, J. The MAPK and AMPK signalings: Interplay and implication in targeted cancer therapy. J. Hematol. Oncol. 2020, 13, 113. [Google Scholar] [CrossRef]
- Savoia, A. Inherited Thrombocytopenias with Predisposition the Hematological Malignancies. Annu. Rev. Hematol. Oncol. 2017, 1, 1001. [Google Scholar]
- Chakrabarti, S.R.; Nucifora, G. The Leukemia-Associated Gene TEL Encodes a Transcription Repressor Which Associates with SMRT and mSin3A. Biochem. Biophys. Res. Commun. 1999, 264, 871–877. [Google Scholar] [CrossRef]
- Wang, L.; Hiebert, S.W. TEL contacts multiple co-repressors and specifically associates with histone deacetylase-3. Oncogene 2001, 20, 3716–3725. [Google Scholar] [CrossRef] [PubMed]
- Fisher, M.H.; Kirkpatrick, G.D.; Stevens, B.; Jones, C.; Callaghan, M.; Rajpurkar, M.; Fulbright, J.; Cooper, M.A.; Rowley, J.; Porter, C.C.; et al. ETV6 Germline Mutations Cause HDAC3/NCOR2 Mislocalization and Upregulation of Interferon Response Genes. JCI Insight 2020, 5, e140332. [Google Scholar] [CrossRef]
- Noetzli, L.; Lo, R.W.; Lee-Sherick, A.B.; Callaghan, M.; Noris, P.; Savoia, A.; Rajpurkar, M.; Jones, K.; Gowan, K.; Balduini, C.L.; et al. Germline mutations in ETV6 are associated with thrombocytopenia, red cell macrocytosis and predisposition to lymphoblastic leukemia. Nat. Genet. 2015, 47, 535–538. [Google Scholar] [CrossRef] [PubMed]
- Faleschini, M.; Ammeti, D.; Papa, N.; Alfano, C.; Bottega, R.; Fontana, G.; Capaci, V.; Zanchetta, M.E.; Pozzani, F.; Montanari, F.; et al. ETV6-related thrombocytopenia: Dominant negative effect of mutations as common pathogenic mechanism. Haematologica 2022, 107, 2249–2254. [Google Scholar] [CrossRef] [PubMed]
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An open-source platform for biological-image analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef]
- Bolte, S.; Cordelières, F.P. A Guided Tour into Subcellular Colocalization Analysis in Light Microscopy. J. Microsc. 2006, 224, 213–232. [Google Scholar] [CrossRef]
- Marconi, C.; Canobbio, I.; Bozzi, V.; Pippucci, T.; Simonetti, G.; Melazzini, F.; Angori, S.; Martinelli, G.; Saglio, G.; Torti, M.; et al. 5′UTR point substitutions and N-terminal truncating mutations of ANKRD26 in acute myeloid leukemia. J. Hematol. Oncol. 2017, 10, 18. [Google Scholar] [CrossRef] [PubMed]
- Bera, T.K.; Liu, X.F.; Yamada, M.; Gavrilova, O.; Mezey, E.; Tessarollo, L.; Anver, M.; Hahn, Y.; Lee, B.; Pastan, I. A model for obesity and gigantism due to disruption of the Ankrd26 gene. Proc. Natl. Acad. Sci. USA 2008, 105, 270–275. [Google Scholar] [CrossRef] [PubMed]
- Fenrick, R.; Wang, L.; Nip, J.; Amann, J.M.; Rooney, R.J.; Walker-Daniels, J.; Crawford, H.C.; Hulboy, D.L.; Kinch, M.S.; Matrisian, L.M.; et al. TEL, a putative tumor suppressor, modulates cell growth and cell morphology of ras-transformed cells while repressing the transcription of stromelysin-1. Mol. Cell Biol. 2000, 20, 5828–5839. [Google Scholar] [CrossRef] [PubMed]
- Guenther, M.G.; Lane, W.S.; Fischle, W.; Verdin, E.; Lazar, M.A.; Shiekhattar, R. A core SMRT corepressor complex containing HDAC3 and TBL1, a WD40-repeat protein linked to deafness. Genes. Dev. 2000, 14, 1048–1057. [Google Scholar] [CrossRef] [PubMed]
- Guenther, M.G.; Barak, O.; Lazar, M.A. The SMRT and N-CoR corepressors are activating cofactors for histone deacetylase 3. Mol. Cell Biol. 2001, 21, 6091–6101. [Google Scholar] [CrossRef]
- Oberoi, J.; Fairall, L.; Watson, P.J.; Yang, J.-C.; Czimmerer, Z.; Kampmann, T.; Goult, B.T.; Greenwood, J.A.; Gooch, J.T.; Kallenberger, B.C.; et al. Structural basis for the assembly of the SMRT/NCoR core transcriptional repression machinery. Nat. Struct. Mol. Biol. 2011, 18, 177–184. [Google Scholar] [CrossRef]
- Zhang, J.; Kalkum, M.; Chait, B.T.; Roeder, R.G. The N-CoR-HDAC3 nuclear receptor corepressor complex inhibits the JNK pathway through the integral subunit GPS2. Mol. Cell. 2002, 9, 611–623. [Google Scholar] [CrossRef]
- Pecci, A.; Balduini, C.L. Inherited thrombocytopenias: An updated guide for clinicians. Blood Rev. 2020, 48, 100784. [Google Scholar] [CrossRef] [PubMed]


| Target | Sequence | Reference |
|---|---|---|
| CTRL | 5′-AGGUAGUGUAAUCGCCUUG-3′ | |
| ETV6_1 | 5′-AATTTACTGGAGCAGGGATGA-3′ | |
| ETV6_2 | 5′-AAGAGGACTTTCGCTATCGAT-3′ | |
| ANKRD26 | 5′-GAAAGAAGTTGAAGTGAAA-3′ | Bluteau, 2015 [6] |
| GPS2 | 5′-GUGACCAUCAGAUUAUAUCTT-3′ |
| qPCR Primers | ||
|---|---|---|
| Target | Primer Sequence (5′-3′) | Sense |
| Actin | CAACACAGTGCTGTCTGGC | FW |
| Actin | GGAGCAATGATCTTGATCTTC | RV |
| ANKRD26 | GACCGAGATCTCGGCAAG | FW |
| ANKRD26 | GGCATTGTACAGCCTTCATC | RV |
| ETV6 | TCTTAAATGACCGCGTCTGGC | FW |
| ETV6 | GAGGAAGCGTAACTCGGCAC | RV |
| GPS2 | AAACGGAGGCGAAAGGAACA | FW |
| GPS2 | AGCACTTGGGGTCCAAACAT | RV |
| MMP3 | TGAGGACACCAGCATGAACC | FW |
| MMP3 | ACTTCGGGATGCCAGGAAAG | RV |
| RUNX1 | TGCGGCGCACAGCCATGA | FW |
| RUNX1 | AGATGATCAGACCAAGCCCG | RV |
| Target Protein Name | Producer | ID Number | WB Dilution | IF Dilution |
|---|---|---|---|---|
| GAPDH | Santa Cruz Biotechnology | sc-47724, RRID:AB_627678 | 1:3000 | |
| HSP90 alpha/beta (F-8) | Santa Cruz Biotechnology | sc-13119; RRID: AB_675659 | 1:3000 | |
| ANKRD26 | Genetex | GTX128255 | 1:1000 | |
| ETV6 | Sigma | HPA000264 | 1:1000 | 1:50 |
| Myc-Tag | Santa Cruz | sc-40 | 1:50 | |
| Flag-Tag | Sigma | F3165 | 1:50 | |
| GPS2 | GeneTex | GTX117560 | 1:1000 | 1:50 |
| HDAC3 | GeneTex | GTX83173 | - | 1:50 |
| Mouse normal IgG | Santa Cruz Biotechnology | sc-2025; RRID: AB_737182 | - | |
| II anti mouse | Santa Cruz Biotechnology | sc-51602, RRID:AB_626603 | 1:2000 | |
| II anti rabbit | Santa Cruz Biotechnology | sc-2004, RRID:AB_631746 | 1:2000 | |
| Donkey anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 | Thermo Fisher Scientific | A-21202; RRID: AB_141607 | 1:1000 | |
| Goat anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 568 | Thermo Fisher Scientific | A-11031; RRID: AB_144696 | 1:1000 | |
| Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 568 | Thermo Fisher Scientific | A-11011; RRID: AB_143157 | 1:1000 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Capaci, V.; Zanchetta, M.E.; Fontana, G.; Ammeti, D.; Bottega, R.; Faleschini, M.; Savoia, A. Inherited Thrombocytopenia Related Genes: GPS2 Mediates the Interplay Between ANKRD26 and ETV6. Cells 2025, 14, 23. https://doi.org/10.3390/cells14010023
Capaci V, Zanchetta ME, Fontana G, Ammeti D, Bottega R, Faleschini M, Savoia A. Inherited Thrombocytopenia Related Genes: GPS2 Mediates the Interplay Between ANKRD26 and ETV6. Cells. 2025; 14(1):23. https://doi.org/10.3390/cells14010023
Chicago/Turabian StyleCapaci, Valeria, Melania Eva Zanchetta, Giorgia Fontana, Daniele Ammeti, Roberta Bottega, Michela Faleschini, and Anna Savoia. 2025. "Inherited Thrombocytopenia Related Genes: GPS2 Mediates the Interplay Between ANKRD26 and ETV6" Cells 14, no. 1: 23. https://doi.org/10.3390/cells14010023
APA StyleCapaci, V., Zanchetta, M. E., Fontana, G., Ammeti, D., Bottega, R., Faleschini, M., & Savoia, A. (2025). Inherited Thrombocytopenia Related Genes: GPS2 Mediates the Interplay Between ANKRD26 and ETV6. Cells, 14(1), 23. https://doi.org/10.3390/cells14010023

