Protective Effects of Growth Differentiation Factor-6 on the Intervertebral Disc: An In Vitro and In Vivo Study
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Human IVD Experiments
2.2.1. Tissues
2.2.2. Cells
2.2.3. Protein Extraction
2.2.4. Western Blotting
2.2.5. In Vitro Immunofluorescence
2.2.6. RNA Isolation and Real-Time Reverse Transcription–Polymerase Chain Reaction
2.2.7. p38 Mitogen-Activated Protein Kinase Phosphorylation Assay
2.3. Rat IVD Experiments
2.3.1. Animals
2.3.2. Radiography
2.3.3. Paraffin-Embedded Tissue Preparation
2.3.4. Histomorphology
2.3.5. In Vivo Immunofluorescence
2.4. Statistical Analysis
3. Results
3.1. In Vivo Human IVD Experiments
3.2. In Vitro Human IVD Experiments
3.2.1. Effects of GDF-6 Treatment on CD24, Aggrecan and Type II Collagen
3.2.2. Effects of GDF-6 Treatment on TNF-α, IL-6, MMP-3, and ADAMTS-4 Gene Expression
3.2.3. Effects of GDF-6 on p38 Phosphorylation under Pro-Inflammatory Conditions
3.3. In Vivo Rat IVD Experiments
3.3.1. Effect of Co-Administration of GDF-6 and AC on Radiographic Disc Height in a Rat Tail IVD Annular Puncture Model
3.3.2. Effect of Co-Administration of GDF-6 and AC on Histological IVD Degeneration in a Rat Tail Puncture Model
3.3.3. Effects of Co-Administration of GDF-6 and AC on Aggrecan and Type II Collagen Expression in a Rat Tail Puncture Model
3.3.4. Effects of Co-Administration of GDF-6 and AC on TNF-α and IL-6 Expression in a Rat Tail Puncture Model
3.3.5. Effects of Co-Administration of GDF-6 and AC on p-p38 Expression in a Rat Tail Puncture Model
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Andersson, G.B. Epidemiological features of chronic low-back pain. Lancet 1999, 354, 581–585. [Google Scholar] [CrossRef]
- Dagenais, S.; Caro, J.; Haldeman, S. A systematic review of low back pain cost of illness studies in the United States and internationally. Spine J. 2008, 8, 8–20. [Google Scholar] [CrossRef]
- Livshits, G.; Popham, M.; Malkin, I.; Sambrook, P.N.; Macgregor, A.J.; Spector, T.; Williams, F.M. Lumbar disc degeneration and genetic factors are the main risk factors for low back pain in women: The UK Twin Spine Study. Ann. Rheum. Dis. 2011, 70, 1740–1745. [Google Scholar] [CrossRef]
- Urban, J.P.; Roberts, S. Degeneration of the intervertebral disc. Arthritis Res. Ther. 2003, 5, 120–130. [Google Scholar] [CrossRef][Green Version]
- Urban, J.P.; Smith, S.; Fairbank, J.C. Nutrition of the intervertebral disc. Spine 2004, 29, 2700–2709. [Google Scholar] [CrossRef]
- Antoniou, J.; Steffen, T.; Nelson, F.; Winterbottom, N.; Hollander, A.P.; Poole, R.A.; Aebi, M.; Alini, M. The human lumbar intervertebral disc: Evidence for changes in the biosynthesis and denaturation of the extracellular matrix with growth, maturation, ageing, and degeneration. J. Clin. Investig. 1996, 98, 996–1003. [Google Scholar] [CrossRef]
- Poiraudeau, S.; Monteiro, I.; Anract, P.; Blanchard, O.; Revel, M.; Corvol, M.T. Phenotypic characteristics of rabbit intervertebral disc cells. Comparison with cartilage cells from the same animals. Spine 1999, 24, 837–844. [Google Scholar] [CrossRef]
- Zhang, Y.; He, F.; Chen, Z.; Su, Q.; Yan, M.; Zhang, Q.; Tan, J.; Qian, L.; Han, Y. Melatonin modulates IL-1beta-induced extracellular matrix remodeling in human nucleus pulposus cells and attenuates rat intervertebral disc degeneration and inflammation. Aging (Albany NY) 2019, 11, 10499–10512. [Google Scholar] [CrossRef]
- Le Maitre, C.L.; Freemont, A.J.; Hoyland, J.A. Localization of degradative enzymes and their inhibitors in the degenerate human intervertebral disc. J. Pathol. 2004, 204, 47–54. [Google Scholar] [CrossRef]
- Gilbertson, L.; Ahn, S.H.; Teng, P.N.; Studer, R.K.; Niyibizi, C.; Kang, J.D. The effects of recombinant human bone morphogenetic protein-2, recombinant human bone morphogenetic protein-12, and adenoviral bone morphogenetic protein-12 on matrix synthesis in human annulus fibrosis and nucleus pulposus cells. Spine J. 2008, 8, 449–456. [Google Scholar] [CrossRef]
- Masuda, K.; Imai, Y.; Okuma, M.; Muehleman, C.; Nakagawa, K.; Akeda, K.; Thonar, E.; Andersson, G.; An, H.S. Osteogenic protein-1 injection into a degenerated disc induces the restoration of disc height and structural changes in the rabbit anular puncture model. Spine 2006, 31, 742–754. [Google Scholar] [CrossRef]
- Chujo, T.; An, H.S.; Akeda, K.; Miyamoto, K.; Muehleman, C.; Attawia, M.; Andersson, G.; Masuda, K. Effects of growth differentiation factor-5 on the intervertebral disc--in vitro bovine study and in vivo rabbit disc degeneration model study. Spine 2006, 31, 2909–2917. [Google Scholar] [CrossRef]
- Masuda, K.; Oegema, T.R., Jr.; An, H.S. Growth factors and treatment of intervertebral disc degeneration. Spine 2004, 29, 2757–2769. [Google Scholar] [CrossRef]
- Chang, S.C.; Hoang, B.; Thomas, J.T.; Vukicevic, S.; Luyten, F.P.; Ryba, N.J.; Kozak, C.A.; Reddi, A.H.; Moos, M., Jr. Cartilage-derived morphogenetic proteins. New members of the transforming growth factor-beta superfamily predominantly expressed in long bones during human embryonic development. J. Biol. Chem. 1994, 269, 28227–28234. [Google Scholar] [CrossRef]
- Shen, B.; Bhargav, D.; Wei, A.; Williams, L.A.; Tao, H.; Ma, D.D.; Diwan, A.D. BMP-13 emerges as a potential inhibitor of bone formation. Int. J. Biol. Sci. 2009, 5, 192–200. [Google Scholar] [CrossRef]
- Wei, A.; Shen, B.; Williams, L.A.; Bhargav, D.; Gulati, T.; Fang, Z.; Pathmanandavel, S.; Diwan, A.D. Expression of growth differentiation factor 6 in the human developing fetal spine retreats from vertebral ossifying regions and is restricted to cartilaginous tissues. J. Orthop. Res. 2016, 34, 279–289. [Google Scholar] [CrossRef]
- Williams, L.A.; Bhargav, D.; Diwan, A.D. Unveiling the bmp13 enigma: Redundant morphogen or crucial regulator? Int. J. Biol. Sci. 2008, 4, 318–329. [Google Scholar] [CrossRef]
- Le Maitre, C.L.; Freemont, A.J.; Hoyland, J.A. Expression of cartilage-derived morphogenetic protein in human intervertebral discs and its effect on matrix synthesis in degenerate human nucleus pulposus cells. Arthritis Res. Ther. 2009, 11, R137. [Google Scholar] [CrossRef]
- Tassabehji, M.; Fang, Z.M.; Hilton, E.N.; McGaughran, J.; Zhao, Z.; de Bock, C.E.; Howard, E.; Malass, M.; Donnai, D.; Diwan, A.; et al. Mutations in GDF6 are associated with vertebral segmentation defects in Klippel-Feil syndrome. Hum. Mutat. 2008, 29, 1017–1027. [Google Scholar] [CrossRef]
- Wei, A.; Williams, L.A.; Bhargav, D.; Shen, B.; Kishen, T.; Duffy, N.; Diwan, A.D. BMP13 prevents the effects of annular injury in an ovine model. Int. J. Biol. Sci. 2009, 5, 388–396. [Google Scholar] [CrossRef]
- Miyazaki, S.; Diwan, A.D.; Kato, K.; Cheng, K.; Bae, W.C.; Sun, Y.; Yamada, J.; Muehleman, C.; Lenz, M.E.; Inoue, N.; et al. ISSLS PRIZE IN BASIC SCIENCE 2018: Growth differentiation factor-6 attenuated pro-inflammatory molecular changes in the rabbit anular-puncture model and degenerated disc-induced pain generation in the rat xenograft radiculopathy model. Eur. Spine J. 2018, 27, 739–751. [Google Scholar] [CrossRef] [PubMed]
- Hodgkinson, T.; Gilbert, H.T.J.; Pandya, T.; Diwan, A.D.; Hoyland, J.A.; Richardson, S.M. Regenerative Response of Degenerate Human Nucleus Pulposus Cells to GDF6 Stimulation. Int. J. Mol. Sci. 2020, 21, 7143. [Google Scholar] [CrossRef] [PubMed]
- Hodgkinson, T.; Wignall, F.; Hoyland, J.A.; Richardson, S.M. High BMPR2 expression leads to enhanced SMAD1/5/8 signalling and GDF6 responsiveness in human adipose-derived stem cells: Implications for stem cell therapies for intervertebral disc degeneration. J. Tissue Eng. 2020, 11, 2041731420919334. [Google Scholar] [CrossRef] [PubMed]
- Priyadarshani, P.; Li, Y.; Yao, L. Advances in biological therapy for nucleus pulposus regeneration. Osteoarthr. Cartil. 2016, 24, 206–212. [Google Scholar] [CrossRef]
- Kato, Y.; Chavez, J.; Yamada, S.; Hattori, S.; Takazawa, S.; Ohuchi, H. A large knee osteochondral lesion treated using a combination of osteochondral autograft transfer and second-generation autologous chondrocyte implantation: A case report. Regen. Ther. 2019, 10, 10–16. [Google Scholar] [CrossRef]
- Sakai, D.; Mochida, J.; Yamamoto, Y.; Nomura, T.; Okuma, M.; Nishimura, K.; Nakai, T.; Ando, K.; Hotta, T. Transplantation of mesenchymal stem cells embedded in Atelocollagen gel to the intervertebral disc: A potential therapeutic model for disc degeneration. Biomaterials 2003, 24, 3531–3541. [Google Scholar] [CrossRef]
- Sano, A.; Maeda, M.; Nagahara, S.; Ochiya, T.; Honma, K.; Itoh, H.; Miyata, T.; Fujioka, K. Atelocollagen for protein and gene delivery. Adv. Drug Deliv. Rev. 2003, 55, 1651–1677. [Google Scholar] [CrossRef]
- Pfirrmann, C.W.; Metzdorf, A.; Zanetti, M.; Hodler, J.; Boos, N. Magnetic resonance classification of lumbar intervertebral disc degeneration. Spine 2001, 26, 1873–1878. [Google Scholar] [CrossRef]
- Risbud, M.V.; Shapiro, I.M. Role of cytokines in intervertebral disc degeneration: Pain and disc content. Nat. Rev. Rheumatol. 2014, 10, 44–56. [Google Scholar] [CrossRef]
- Richardson, S.M.; Hodgkinson, T.; Wei, A.; Shen, B.; Diwan, A.; Hoyland, J. Growth differentiation factor 6 promotes a healthy nucleus pulposus cell phenotype through smad and smad-independent signalling pathways. Osteoarthr. Cartil. 2018, 26, S423. [Google Scholar] [CrossRef]
- Ni, B.; Huang, X.; Xi, Y.; Mao, Z.; Chu, X.; Zhang, R.; Ma, X.; You, H. Neferine Inhibits Expression of Inflammatory Mediators and Matrix Degrading Enzymes in IL-1beta-Treated Rat Chondrocytes via Suppressing MAPK and NF-kappaB Signaling Pathways. Inflammation 2020, 43, 1209–1221. [Google Scholar] [CrossRef] [PubMed]
- Kakiuchi, Y.; Yurube, T.; Kakutani, K.; Takada, T.; Ito, M.; Takeoka, Y.; Kanda, Y.; Miyazaki, S.; Kuroda, R.; Nishida, K. Pharmacological inhibition of mTORC1 but not mTORC2 protects against human disc cellular apoptosis, senescence, and extracellular matrix catabolism through Akt and autophagy induction. Osteoarthr. Cartil. 2019, 27, 965–976. [Google Scholar] [CrossRef] [PubMed]
- Clarke, L.E.; McConnell, J.C.; Sherratt, M.J.; Derby, B.; Richardson, S.M.; Hoyland, J.A. Growth differentiation factor 6 and transforming growth factor-beta differentially mediate mesenchymal stem cell differentiation, composition, and micromechanical properties of nucleus pulposus constructs. Arthritis Res. Ther. 2014, 16, R67. [Google Scholar] [CrossRef] [PubMed]
- Kameyama, K.; Motoyama, K.; Tanaka, N.; Yamashita, Y.; Higashi, T.; Arima, H. Induction of mitophagy-mediated antitumor activity with folate-appended methyl-beta-cyclodextrin. Int. J. Nanomed. 2017, 12, 3433–3446. [Google Scholar] [CrossRef]
- Yamamoto, J.; Maeno, K.; Takada, T.; Kakutani, K.; Yurube, T.; Zhang, Z.; Hirata, H.; Kurakawa, T.; Sakai, D.; Mochida, J.; et al. Fas ligand plays an important role for the production of pro-inflammatory cytokines in intervertebral disc nucleus pulposus cells. J. Orthop. Res. 2013, 31, 608–615. [Google Scholar] [CrossRef]
- Ito, M.; Yurube, T.; Kakutani, K.; Maeno, K.; Takada, T.; Terashima, Y.; Kakiuchi, Y.; Takeoka, Y.; Miyazaki, S.; Kuroda, R.; et al. Selective interference of mTORC1/RAPTOR protects against human disc cellular apoptosis, senescence, and extracellular matrix catabolism with Akt and autophagy induction. Osteoarthr. Cartil. 2017, 25, 2134–2146. [Google Scholar] [CrossRef]
- Han, B.; Zhu, K.; Li, F.C.; Xiao, Y.X.; Feng, J.; Shi, Z.L.; Lin, M.; Wang, J.; Chen, Q.X. A simple disc degeneration model induced by percutaneous needle puncture in the rat tail. Spine 2008, 33, 1925–1934. [Google Scholar] [CrossRef]
- Masuda, K.; Aota, Y.; Muehleman, C.; Imai, Y.; Okuma, M.; Thonar, E.J.; Andersson, G.B.; An, H.S. A novel rabbit model of mild, reproducible disc degeneration by an anulus needle puncture: Correlation between the degree of disc injury and radiological and histological appearances of disc degeneration. Spine 2005, 30, 5–14. [Google Scholar] [CrossRef]
- Lai, A.; Gansau, J.; Gullbrand, S.E.; Crowley, J.; Cunha, C.; Dudli, S.; Engiles, J.B.; Fusellier, M.; Goncalves, R.M.; Nakashima, D.; et al. Development of a standardized histopathology scoring system for intervertebral disc degeneration in rat models: An initiative of the ORS spine section. JOR Spine 2021, 4, e1150. [Google Scholar] [CrossRef]
- Okuda, S.; Nakase, T.; Yonenobu, K.; Ariga, K.; Meng, W.; Ochi, T.; Yoshikawa, H. Age-dependent expression of transforming growth factor β1 (TGF-β1) and its receptors and age-related stimulatory effect of TGF-b1 on proteoglycan synthesis in rat intervertebral discs. J. Musculoskelet. Res. 2000, 4, 151–159. [Google Scholar] [CrossRef]
- Yukawa, H.; Ikeuchi, M.; Noguchi, H.; Miyamoto, Y.; Ikuta, K.; Hayashi, S. Embryonic body formation using the tapered soft stencil for cluster culture device. Biomaterials 2011, 32, 3729–3738. [Google Scholar] [CrossRef] [PubMed]
- Hodgkinson, T.; Shen, B.; Diwan, A.; Hoyland, J.A.; Richardson, S.M. Therapeutic potential of growth differentiation factors in the treatment of degenerative disc diseases. JOR Spine 2019, 2, e1045. [Google Scholar] [CrossRef] [PubMed]
- Chen, T.; Cheng, X.; Wang, J.; Feng, X.; Zhang, L. Time-Course Investigation of Intervertebral Disc Degeneration Induced by Different Sizes of Needle Punctures in Rat Tail Disc. Med. Sci. Monit. 2018, 24, 6456–6465. [Google Scholar] [CrossRef] [PubMed]
- Collin, E.C.; Grad, S.; Zeugolis, D.I.; Vinatier, C.S.; Clouet, J.R.; Guicheux, J.J.; Weiss, P.; Alini, M.; Pandit, A.S. An injectable vehicle for nucleus pulposus cell-based therapy. Biomaterials 2011, 32, 2862–2870. [Google Scholar] [CrossRef] [PubMed]
- Uchio, Y.; Ochi, M.; Matsusaki, M.; Kurioka, H.; Katsube, K. Human chondrocyte proliferation and matrix synthesis cultured in Atelocollagen gel. J. Biomed. Mater. Res. 2000, 50, 138–143. [Google Scholar] [CrossRef]
- Cui, H.; Zhang, J.; Li, Z.; Chen, F.; Cui, H.; Du, X.; Liu, H.; Wang, J.; Diwan, A.D.; Zheng, Z. Growth differentiation factor-6 attenuates inflammatory and pain-related factors and degenerated disc-induced pain behaviors in rat model. J. Orthop. Res. 2021, 39, 959–970. [Google Scholar] [CrossRef] [PubMed]









| Gene Name | Forward Primer Sequence (5′–3′) | Reverse Primer Sequence (5′–3′) |
|---|---|---|
| ACAN | AAGAATCAAGTGGAGCCGTGTGTC | TGAGACCTTGTCCTGATAGGCACT |
| COL2A1 | AAGGTGCTTCTGGTCCTGCTG | GGGATTCCATTAGCACCATCTTTG |
| TNFA | GTGACAAGCCTGTAGCCCATGTT | TTATCTCTCAGCTCCACGCCATT |
| IL-6 | AAGCCAGAGCTGTGCAGATGAGTA | TGTCCTGCAGCCACTGGTTC |
| MMP-3 | CAAGGAGGCAGGCAAGACAGC | GCCACGCACAGCAACAGTAGG |
| ADAMTS-4 | GGATTACAGGTGTGAGCCACCA | GGATGCAACCACATCTGTCTGA |
| GAPDH | GAGGCCGGTGCTGAGTAT | GCGGAGATGATGACCCTTTTGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Miyazaki, K.; Miyazaki, S.; Yurube, T.; Takeoka, Y.; Kanda, Y.; Zhang, Z.; Kakiuchi, Y.; Tsujimoto, R.; Ohnishi, H.; Matsuo, T.; et al. Protective Effects of Growth Differentiation Factor-6 on the Intervertebral Disc: An In Vitro and In Vivo Study. Cells 2022, 11, 1174. https://doi.org/10.3390/cells11071174
Miyazaki K, Miyazaki S, Yurube T, Takeoka Y, Kanda Y, Zhang Z, Kakiuchi Y, Tsujimoto R, Ohnishi H, Matsuo T, et al. Protective Effects of Growth Differentiation Factor-6 on the Intervertebral Disc: An In Vitro and In Vivo Study. Cells. 2022; 11(7):1174. https://doi.org/10.3390/cells11071174
Chicago/Turabian StyleMiyazaki, Kunihiko, Shingo Miyazaki, Takashi Yurube, Yoshiki Takeoka, Yutaro Kanda, Zhongying Zhang, Yuji Kakiuchi, Ryu Tsujimoto, Hiroki Ohnishi, Tomoya Matsuo, and et al. 2022. "Protective Effects of Growth Differentiation Factor-6 on the Intervertebral Disc: An In Vitro and In Vivo Study" Cells 11, no. 7: 1174. https://doi.org/10.3390/cells11071174
APA StyleMiyazaki, K., Miyazaki, S., Yurube, T., Takeoka, Y., Kanda, Y., Zhang, Z., Kakiuchi, Y., Tsujimoto, R., Ohnishi, H., Matsuo, T., Ryu, M., Kuroda, R., & Kakutani, K. (2022). Protective Effects of Growth Differentiation Factor-6 on the Intervertebral Disc: An In Vitro and In Vivo Study. Cells, 11(7), 1174. https://doi.org/10.3390/cells11071174

