Discovery of 16-Androstenes (Androstenone and Androstenol), Their Synthesis Pathway, and Possible Role in Reproduction of Mouse Deer (Moschiola indica)
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Animal
2.2. Fecal Sample Collection
2.3. Tissue Collection
2.4. Extraction of Androstenone and Steroid Metabolites
2.5. Identification of 16-Androstenes Using GC-MS
2.6. Total RNA Isolation and cDNA Synthesis
2.7. Targetted Assembly of Candidate Gene Exons from Shotgun Sequencing
2.8. Construction of CYP17A1 and CYB5A
2.9. RT-PCR for Quantifying CYP17A1 Gene Expression in Tissues
2.10. Functional Characterization of Mouse Deer CYPA17A1 and CYB5A Expressed in Mammalian Cells
2.11. Androstenone Antibody Production
2.12. Androstenone EIA and Procedure
2.13. EIA for Progesterone, Estradiol, and Testosterone
2.14. EIA Validation for Androstenone, Progesterone, Estradiol, and Testosterone
2.15. Statistical Analysis
3. Results
3.1. Identification of 16-Androstenes Using GC-MS
3.2. Cloning of CYP17A1 and CYB5A in Mouse Deer
3.3. Conversion of 5,16-Androstadien-3β-ol by CYP17A1 Mouse Deer, In Vitro
3.4. Relative mRNA Transcript Expression of CYP17A1 in Testis and Ovary of Mouse Deer
3.5. Reproductive Monitoring
3.6. Fecal Androstenone Profile during Parturition, Postpartum Estrus, and Mating
3.7. Fecal Estrogens during Postpartum Estrus and Mating
3.8. Fecal Androstenone vs. Fecal Estrogens
3.9. Fecal Androstenone and Testosterone in Males
3.10. Fecal Progestogens Profile during Pregnancy and Postpartum Estrus
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Karlson, P.; Lüscher, M. ‘Pheromones’: A new term for a class of biologically active substances. Nature 1959, 183, 55–56. [Google Scholar] [CrossRef]
- Kreigenhofer, B.M. Exploring Social Interactions and Olfactory Communication in the Common Brushtail Possum: Implications for Management: A Thesis Presented in Partial Fulfilment of the Requirements for the Degree of Master of Science in Conservation Biology, Massey University, Albany, New Zealand. Doctoral Dissertation, Massey University, Albany, New Zealand, 2011. [Google Scholar]
- van den Hurk, R. Intraspecific Chemical Communication in Vertebrates with Special Attention to Sex Pheromones; Pheromone Information Centre: Zeist, The Netherlands, 2011; Volume 2. [Google Scholar]
- Raihani, G.; González, D.; Arteaga, L.; Hudson, R. Olfactory guidance of nipple attachment and suckling in kittens of the domestic cat: Inborn and learned responses. Dev. Psychobiol. J. Int. Soc. Dev. Psychobiol. 2009, 51, 662–671. [Google Scholar] [CrossRef]
- Da Silva, M.C.; Canário, A.V.M.; Hubbard, P.C.; Gonçalves, D.M.F. Physiology, endocrinology and chemical communication in aggressive behaviour of fishes. J. Fish Biol. 2021, 98, 1217–1233. [Google Scholar] [CrossRef]
- Gosling, L.M.; Roberts, S.C. Scent-marking by male mammals: Cheat proof signals to competitors and mates. Adv. Study Behav. 2001, 30, 169–217. [Google Scholar] [CrossRef]
- Hu, B.; Mo, Z.; Jiang, J.; Liang, J.; Wei, M.; Zhu, X.; Liang, Y.; Liu, Y.; Huang, Q.; Ouyang, Y.; et al. The pheromone affects reproductive physiology and behavior by regulating hormone in juvenile mice. Growth Factors 2022, 40, 1–13. [Google Scholar] [CrossRef]
- Chung-Davidson, Y.W.; Bussy, U.; Fissette, S.D.; Li, W. Sex-dependent pheromonal effects on steroid hormone levels in sea lampreys (Petromyzon marinus). Gen. Comp. Endocrinol. 2020, 299, 113608. [Google Scholar] [CrossRef] [PubMed]
- McGlone, J.J.; Aviles-Rosa, E.O.; Archer, C.; Wilson, M.M.; Jones, K.D.; Matthews, E.M.; Gonzalez, A.A.; Reyes, E. Understanding Sow Sexual Behavior and the Application of the Boar Pheromone to Stimulate Sow Reproduction. In Animal Reproduction in Veterinary Medicine; IntechOpen: Rijeka, Croatia, 2020; pp. 8–12. [Google Scholar]
- Babol, J.; Squires, E.J.; Lundtröm, K. Relationship between metabolism of androstenone and skatole in intact male pigs. J. Anim. Sci. 1999, 77, 84–92. [Google Scholar] [CrossRef] [PubMed]
- Dehnhard, M.; Heistermann, M.; Goritz, F.; Hermes, R.; Hildebrandt, T.; Haber, H. Demonstration of 2-unsaturated C~1~9-steroids in the urine of female Asian elephants, Elephas maximus, and their dependence on ovarian activity. Reprod.-Camb. 2001, 121, 475–484. [Google Scholar] [CrossRef] [PubMed]
- Fadem, B.H. Activation of estrus by pheromones in a marsupial: Stimulus control and endocrine factors. Biol. Reprod. 1987, 36, 328–332. [Google Scholar] [CrossRef] [PubMed]
- Rasmussen, L.E.L.; Lee, T.D.; Zhang, A.; Roelofs, W.L.; Daves, G.D., Jr. Purification, identification, concentration and bioactivity of (Z)-7-dodecen-1-yl acetate: Sex pheromone of the female Asian elephant, Elephas maximus. Chem. Senses 1997, 22, 417–437. [Google Scholar] [CrossRef] [PubMed][Green Version]
- McGlone, J.J.; Devaraj, S.; Garcia, A. A novel boar pheromone mixture induces sow estrus behaviors and reproductive success. Appl. Anim. Behav. Sci. 2019, 219, 104832. [Google Scholar] [CrossRef]
- Archunan, G.; Rajagopal, T. Detection of estrus in Indian blackbuck: Behavioural, hormonal and urinary volatiles evaluation. Gen. Comp. Endocrinol. 2013, 181, 156–166. [Google Scholar] [CrossRef] [PubMed]
- Kavaliers, M.; Kinsella, D.M. Male preference for the odors of estrous female mice is reduced by the neurosteroid pregnenolone sulfate. Brain Res. 1995, 682, 222–226. [Google Scholar] [CrossRef] [PubMed]
- Sankar, R.; Archunan, G. Identification of putative pheromones in bovine (Bos taurus) faeces in relation to estrus detection. Anim. Reprod. Sci. 2008, 103, 149–153. [Google Scholar] [CrossRef] [PubMed]
- Mozūraitis, R.; Kutra, J.; Borg-Karlson, A.K.; Būda, V. Dynamics of putative sex pheromone components during heat periods in estrus-induced cows. J. Dairy Sci. 2017, 100, 7686–7695. [Google Scholar] [CrossRef] [PubMed]
- Melrose, D.R.; Reed, H.C.; Patterson, R.L.S. Androgen steroids associated with boar odour as an aid to the detection of oestrus in pig artificial insemination. Br. Vet. J. 1971, 127, 497–502. [Google Scholar] [CrossRef] [PubMed]
- Perry, G.C.; Patterson, R.L.S.; MacFie, H.J.H.; Stinson, C.G. Pig courtship behaviour: Pheromonal property of androstene steroids in male submaxillary secretion. Anim. Sci. 1980, 31, 191–199. [Google Scholar] [CrossRef]
- Patterson, R.L.S. 5α-androst-16-ene-3-one:—Compound responsible for taint in boar fat. J. Sci. Food Agric. 1968, 19, 31–38. [Google Scholar] [CrossRef]
- Claus, R. Bestimmung von Testosteron und 5a.-Androst-16-en-3-on, Einem Ebergeruchsstoff, bei Schweinen. (Estimation of testosterone and 5a.-androst-16-en-3-one, an Odourus Compound, in Pigs). Ph.D. Thesis, Fakultat fUr Landwirtschaft und Gartenbau, Technishen Hochschule, Mtinchen, Germany, 1970. [Google Scholar]
- Reed, H.C.B.; Melrose, D.R.; Patterson, R.L.S. Androgen steroids as an aid to the detection of oestrus in pig artificial insemination. Br. Vet. J. 1974, 130, 61–67. [Google Scholar] [CrossRef]
- Dehnhard, M.; Rohrmann, H.; Kauffold, J. Measurement of 16-Androstenes (5α-Androst-16-en-3-One, 5α-Androst-16-en-3α-ol, 5α-Androst-16-en-3β-ol) in Saliva of German Landrace and Göttingen Minipig Boars. In Chemical Signals in Vertebrates 12; Springer: New York, NY, USA, 2013; pp. 381–390. [Google Scholar] [CrossRef]
- Nixon, A.; Mallet, A.I.; Gower, D.B. Simultaneous quantification of five odorous steroids (16-androstenes) in the axillary hair of men. J. Steroid Biochem. 1998, 29, 505–510. [Google Scholar] [CrossRef]
- Gower, D.B.; Ruparelia, B.A. Olfaction in humans with special reference to odorous 16-androstenes: Their occurrence, perception and possible social, psychological and sexual impact. J. Endocrinol. 1993, 137, 167–187. [Google Scholar] [CrossRef] [PubMed]
- Preti, G.; Wysocki, C.J.; Barnhart, K.T.; Sondheimer, S.J.; Leyden, J.J. Male axillary extracts contain pheromones that affect pulsatile secretion of luteinizing hormone and mood in women recipients. Biol. Reprod. 2003, 68, 2107–2113. [Google Scholar] [CrossRef] [PubMed]
- Morofushi, M.; Shinohara, K.; Funabashi, T.; Kimura, F. Positive relationship between menstrual synchrony and ability to smell 5α-androst-16-en-3α-ol. Chem. Senses 2000, 25, 407–411. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Benton, D. The influence of androstenol—A putative human pheromone—On mood throughout the menstrual cycle. Biol. Psychol. 1982, 15, 249–256. [Google Scholar] [CrossRef] [PubMed]
- Savic, I.; Berglund, H. Androstenol–a steroid derived odor activates the hypothalamus in women. PLoS ONE 2010, 5, e8651. [Google Scholar] [CrossRef] [PubMed]
- Booth, W.D. Sexual dimorphism involving steroidal pheromones and their binding protein in the submaxillary salivary gland of the Göttingen miniature pig. J. Endocrinol. 1984, 100, 195. [Google Scholar] [CrossRef]
- Kirkwood, R.N.; Hughes, P.E.; Booth, W.D. The influence of boar-related odours on puberty attainment in gilts. Anim. Sci. 1983, 36, 131–136. [Google Scholar] [CrossRef]
- Beaton, A.A.; Jones, L.; Benton, D.; Richards, G. Judgements of attractiveness of the opposite sex and nostril differences in self-rated mood: The effects of androstenol. Biol. Psychol. 2022, 167, 108237. [Google Scholar] [CrossRef]
- Robic, A.; Larzul, C.; Bonneau, M. Genetic and metabolic aspects of androstenone and skatole deposition in pig adipose tissue: A review (Open Access publication). Genet. Sel. Evol. 2008, 40, 1–15. [Google Scholar] [CrossRef]
- Katkov, T.; Gower, D.B. The biosynthesis of androst-16-enes in boar testis tissue. Biochem. J. 1970, 117, 533–538. [Google Scholar] [CrossRef]
- Meadus, W.J.; Mason, J.I.; Squires, E.J. Cytochrome P450c17 from porcine and bovine adrenal catalyses the formation of 5, 16-androstadien-3β-ol from pregnenolone in the presence of cytochrome b5. J. Steroid Biochem. Mol. Biol. 1993, 46, 565–572. [Google Scholar] [CrossRef] [PubMed]
- Lee-Robichaud, P.; Wright, J.N.; Akhtar, M.E.; Akhtar, M. Modulation of the activity of human 17 α-hydroxylase-17, 20-lyase (CYP17) by cytochrome b 5: Endocrinological and mechanistic implications. Biochem. J. 1995, 308, 901–908. [Google Scholar] [CrossRef] [PubMed]
- Nakajin, S.; Shively, J.; Yuan, P.M.; Hall, P.F. Microsomal cytochrome P-450 from neonatal pig testis: Two enzymic activities (17. alpha. -hydroxalase and C17, 20 associated with one protein. Biochemistry 1981, 20, 4037–4042. [Google Scholar] [CrossRef] [PubMed]
- Soucy, P.; Luu-The, V. Assessment of the ability of type 2 cytochrome b5 to modulate 17, 20-lyase activity of human P450c17. J. Steroid Biochem. Mol. Biol. 2002, 80, 71–75. [Google Scholar] [CrossRef] [PubMed]
- Robic, A.; Feve, K.; Louveau, I.; Riquet, J.; Prunier, A. Exploration of steroidogenesis-related genes in testes, ovaries, adrenals, liver and adipose tissue in pigs. Anim. Sci. J. 2016, 87, 1041–1047. [Google Scholar] [CrossRef] [PubMed]
- Parvathi, S.; Rao, M.; Kumar, V.; Umapathy, G. Observations on reproductive performance of Indian mouse deer (Moschiola indica) in captivity. Curr. Sci. 2014, 106, 439–441. [Google Scholar]
- Claus, R.; Kaufmann, B.; Dehnhard, M.; Spitzer, V. Demonstration of 16-Unsaturated C-19 Steroids (‘Boar Pheromones’) in Tissues of the Male Camel (Camelus dromedarius). Reprod. Domest. Anim. 1999, 34, 455–458. [Google Scholar] [CrossRef]
- Kusuda, S.; Adachi, I.; Fujioka, K.; Nakamura, M.; Amano-Hanzawa, N.; Goto, N.; Furuhashi, S.; Doi, O. Reproductive characteristics of female lesser mouse deers (Tragulus javanicus) based on fecal progestagens and breeding records. Anim. Reprod. Sci. 2013, 137, 69–73. [Google Scholar] [CrossRef]
- Weingrill, T.; Gray, D.A.; Barrett, L.; Henzi, S.P. Fecal cortisol levels in free-ranging female chacma baboons: Relationship to dominance, reproductive state and environmental factors. Horm. Behav. 2004, 45, 259–269. [Google Scholar] [CrossRef]
- McCarthy, T.W.; Chou, H.C.; Brendel, V.P. SRAssembler: Selective Recursive local Assembly of homologous genomic regions. BMC Bioinform. 2019, 20, 371. [Google Scholar] [CrossRef]
- Billen, M.J.; Squires, E.J. The role of porcine cytochrome b5A and cytochrome b5B in the regulation of cytochrome P45017A1 activities. J. Steroid Biochem. Mol. Biol. 2009, 113, 98–104. [Google Scholar] [CrossRef] [PubMed]
- Dawson, E.C.; Denissen, A.E.; van Weemen, B.K. A simple and efficient method for raising steroid antibodies in rabbits. Steroids 1978, 31, 357–365. [Google Scholar] [CrossRef] [PubMed]
- Umapathy, G.; Kumar, V.; Kabra, M.; Shivaji, S. Detection of pregnancy and fertility status in big cats using an enzyme immunoassay based on 5α-pregnan-3α-ol-20-one. Gen. Comp. Endocrinol. 2013, 180, 33–38. [Google Scholar] [CrossRef] [PubMed]
- Kumar, V.; Reddy, V.P.; Kokkiligadda, A.; Shivaji, S.; Umapathy, G. Non-invasive assessment of reproductive status and stress in captive Asian elephants in three south Indian zoos. Gen. Comp. Endocrinol. 2014, 201, 37–44. [Google Scholar] [CrossRef] [PubMed]
- Kumar, V.; Buragohain, S.; Deka, P.J.; Narayan, G.; Umapathy, G. Non-invasive reproductive hormone monitoring in the endangered pygmy hog (Porcula salvania). Animals 2021, 11, 1324. [Google Scholar] [CrossRef]
- Kumar, V.; Sood, S.; Vasudevan, K.; Umapathy, G. A practical method for storage, preservation and transportation of anuran urine samples using filter paper for hormone analysis. MethodsX 2021, 8, 101578. [Google Scholar] [CrossRef]
- Umapathy, G.; Deepak, V.; Kumar, V.; Chandrasekhar, M.; Vasudevan, K. Endocrine profiling of endangered tropical chelonians using noninvasive fecal steroid analyses. Chelonian Conserv. Biol. 2015, 14, 108–115. [Google Scholar] [CrossRef]
- Abraham, G.E. Solid-phase radioimmunoassay of estradiol-17β. J. Clin. Endocrinol. Metab. 1969, 29, 866–870. [Google Scholar] [CrossRef]
- Nakajin, S.; Takahashi, M.; Higashiyama, K.; Shinoda, M. Evidence for involvement of cytochrome P-450-linked oxygenase system in the conversion of C21-steroids to Δ16-C19-steroids catalyzed by pig testicular microsomes. J. Biochem. 1985, 98, 615–620. [Google Scholar] [CrossRef]
- Storbeck, K.H.; Swart, A.C.; Fox, C.L.; Swart, P. Cytochrome b5 modulates multiple reactions in steroidogenesis by diverse mechanisms. J. Steroid Biochem. Mol. Biol. 2015, 151, 66–73. [Google Scholar] [CrossRef]
- Gilep, A.A.; Sushko, T.A.; Usanov, S.A. At the crossroads of steroid hormone biosynthesis: The role, substrate specificity and evolutionary development of CYP17. Biochim. Biophys. Acta (BBA)-Proteins Proteom. 2011, 1814, 200–209. [Google Scholar] [CrossRef] [PubMed]
- Schenkman, J.B.; Jansson, I. The many roles of cytochrome b5. Pharmacol. Ther. 2003, 97, 139–152. [Google Scholar] [CrossRef] [PubMed]
- Im, S.C.; Waskell, L. The interaction of microsomal cytochrome P450 2B4 with its redox partners, cytochrome P450 reductase and cytochrome b5. Arch. Biochem. Biophys. 2011, 507, 144–153. [Google Scholar] [CrossRef] [PubMed]
- Conley, A.J.; Graham-Lorence, S.E.; Kagimoto, M.; Lorence, M.C.; Murry, B.A.; Oka, K.; Sanders, D.; Mason, J.I. Nucleotide sequence of a cDNA encoding porcine testis 17 alpha-hydroxylase cytochrome P-450. Biochim. Biophys. Acta 1992, 1130, 75–77. [Google Scholar] [CrossRef]
- Chung, B.C.; Picado-Leonard, J.; Haniu, M.; Bienkowski, M.H.P.F.; Hall, P.F.; Shively, J.E.; Miller, W.L. Cytochrome P450c17 (steroid 17 alpha-hydroxylase/17, 20 lyase): Cloning of human adrenal and testis cDNAs indicates the same gene is expressed in both tissues. Proc. Natl. Acad. Sci. USA 1987, 84, 407–411. [Google Scholar] [CrossRef]
- Rudd, C.D. Sexual behaviour of male and female tammar wallabies (Macropus eugenii) at post-partum oestrus. J. Zool. 1994, 232, 151–162. [Google Scholar] [CrossRef]
- Shaw, G.; Renfree, M.B. Concentrations of oestradiol-17β in plasma and corpora lutea throughout pregnancy in the tammar, Macropus eugenii. Reproduction 1984, 72, 29–37. [Google Scholar] [CrossRef]
- Renfree, M.B.; Lewis, A.M. Cleavage in vivo and in vitro in the marsupial Macropus eugenii. Reprod. Fertil. Dev. 1996, 8, 725–742. [Google Scholar] [CrossRef]
- Tyndale-Biscoe, C.H.; Rodger, J.C. Differential transport of spermatozoa into the two sides of the genital tract of a monovular marsupial, the tammar wallaby (Macropus eugenii). Reproduction 1978, 52, 37–43. [Google Scholar] [CrossRef]
- Paris, D.B.; Taggart, D.A.; Shaw, G.; Temple-Smith, P.D.; Renfree, M.B. Birth of pouch young after artificial insemination in the tammar wallaby (Macropus eugenii). Biol. Reprod. 2005, 72, 451–459. [Google Scholar] [CrossRef]
- Paris, D.B.; Taggart, D.A.; Paris, M.C.; Temple-Smith, P.D.; Renfree, M.B. Sperm transport, size of the seminal plug and the timing of ovulation after natural mating in the female tammar wallaby Macropus eugenii. Reprod. Fertil. Dev. 2005, 16, 811–822. [Google Scholar] [CrossRef] [PubMed]
- Birkhead, T.R.; Møller, A.P. Sexual selection and the temporal separation of reproductive events: Sperm storage data from reptiles, birds and mammals. Biol. J. Linn. Soc. 1993, 50, 295–311. [Google Scholar] [CrossRef]
- Booth, W.D. Development of some male characteristics supported by oestrone but not dehydroepiandrosterone in the boar. Reproduction 1983, 68, 9–16. [Google Scholar] [CrossRef] [PubMed]
- Bonneau, M. Compounds responsible for boar taint, with special emphasis on androstenone: A review. Livest. Prod. Sci. 1982, 9, 687–705. [Google Scholar] [CrossRef]
- Squires, E.J.; Gullett, E.A.; Fisher, K.R.S.; Partlow, G.D. Comparison of androst-16-ene steroid levels determined by a colorimetric assay with boar taint estimated by a trained sensory panel. J. Anim. Sci. 1991, 69, 1092–1100. [Google Scholar] [CrossRef]
S. No. | Animal ID/Name | Age (In Years) | Sex | No. of Samples Collected | Date of Parturition and Mating Observed |
---|---|---|---|---|---|
1 | Reena | 5.6 | F | 161 | 17 September 2019, 24 February 2020 |
2 | Pinky | 3.2 | F | 179 | 25 October 2019, 12 April 2020 |
3 | Tejaswini | 5.2 | F | 201 | 14 December 2019, 19 May 2020 |
4 | Padma | 5.4 | F | 139 | 24 February 2020, 23 July 2020 |
5 | Vaneja | 3.8 | F | 36 | 31 May 2020 |
6 | Kavya | 1.1 | F | 130 | 03 May 2020, 04 November 2020 |
7 | Harshita | 3.11 | F | 87 | 21 February 2020 |
8 | Sameera | 3.1 | F | 123 | 12 April 2020, 13 September 2020 |
9 | Rinky | 4.1 | F | 98 | - |
10 | Prameela | 5.3 | F | 123 | - |
11 | Rahul | 7 | M | 85 | - |
12 | Shashank | 5.3 | M | 106 | - |
13 | Vijay | 5.2 | M | 82 | - |
14 | Joshi | 3.2 | M | 77 | - |
S. No. | Primer | Forward Primer (5′ to 3′) | Reverse Primer (5′ to 3′) | Purpose |
---|---|---|---|---|
1 | Mouse deer CYP17A1 | ATGTGGGTGCTCGT | CATAGGGTGGAGTTTCGAGG | PCR and Cloning |
2 | Mouse deer CYB5A | ATGGCCGAGGAG | GTTTTCCGACGTGTAGAGGTG | PCR and Cloning |
3 | Pig CYP17A1 | ATGTGGGTGCTCTTG | GGAGGTACTCCCCTCAGTG | PCR and Cloning |
4 | Pig CYB5A | ATGGCCGAACAGT | GTTTTCCGATGTGTAGAAGTG | PCR and Cloning |
5 | Mouse deer CYP17A1 | TATCATTGACTCCAGCATTGGC | AAGCGCTCAGGCATGAACAG | qPCR and gene expression |
6 | β-actin | TCCTTCCTGGGCATGGAATC | GGCGCGATGATCTTGATCTTC | qPCR and gene expression |
S. No. | Steroid | Crossreactivity (%) |
---|---|---|
1 | Androstenone | 100.0 |
2 | 4, 16-androstadien-3-one | 164.0 |
3 | Androst-4-ene-3,17-dione | 32.7 |
4 | 5α-androst-16-en-3α-ol | 12.0 |
5 | Progesterone | 9.44 |
6 | 5, 16-Androstadien-3β-ol | 6.47 |
7 | Testosterone | 3.33 |
8 | 5α-dihydrotestosterone | 2.0 |
9 | 5-androstenediol | <1.0 |
10 | Estradiol | <1.0 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kumar, V.; Manu, S.; Caroline, K.; Sekhar, A.; Mamta, S.-K.; Sandeep, M.; ., W.; Senthilkumaran, B.; Umapathy, G. Discovery of 16-Androstenes (Androstenone and Androstenol), Their Synthesis Pathway, and Possible Role in Reproduction of Mouse Deer (Moschiola indica). Cells 2022, 11, 3837. https://doi.org/10.3390/cells11233837
Kumar V, Manu S, Caroline K, Sekhar A, Mamta S-K, Sandeep M, . W, Senthilkumaran B, Umapathy G. Discovery of 16-Androstenes (Androstenone and Androstenol), Their Synthesis Pathway, and Possible Role in Reproduction of Mouse Deer (Moschiola indica). Cells. 2022; 11(23):3837. https://doi.org/10.3390/cells11233837
Chicago/Turabian StyleKumar, Vinod, Shivakumara Manu, Karunakaran Caroline, Anupama Sekhar, Sajwan-Khatri Mamta, Mushkam Sandeep, Wasimuddin ., Balasubramanian Senthilkumaran, and Govindhaswamy Umapathy. 2022. "Discovery of 16-Androstenes (Androstenone and Androstenol), Their Synthesis Pathway, and Possible Role in Reproduction of Mouse Deer (Moschiola indica)" Cells 11, no. 23: 3837. https://doi.org/10.3390/cells11233837
APA StyleKumar, V., Manu, S., Caroline, K., Sekhar, A., Mamta, S.-K., Sandeep, M., ., W., Senthilkumaran, B., & Umapathy, G. (2022). Discovery of 16-Androstenes (Androstenone and Androstenol), Their Synthesis Pathway, and Possible Role in Reproduction of Mouse Deer (Moschiola indica). Cells, 11(23), 3837. https://doi.org/10.3390/cells11233837