SARS-CoV-2-Associated ssRNAs Activate Human Neutrophils in a TLR8-Dependent Fashion
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Isolation and Stimulation
2.2. Reverse-Transcription Quantitative Real-Time PCR (RT-qPCR)
2.3. RNA Sequencing (RNA-Seq)
2.4. Computational Analysis of RNA-Seq Data
2.5. Production of Neutrophil Extracellular Trap (NET)
2.6. Cytokine and Granule Protein Release
2.7. Flow Cytometry
2.8. Neutrophil Viability
2.9. Production of Superoxide Anion (O2−)
2.10. Statistical Analysis
3. Results
3.1. SCV2-RNAs Induce TNFα, CXCL8, and IL-1ra Production by Human Neutrophils
3.2. SCV2-RNAs Delay Spontaneous Apoptosis of, as Well as Activate, Neutrophils
3.3. SCV2-RNA2 and R848 Similarly Modify the Transcriptomic Profile in Human Neutrophils
3.4. The Transcriptomic Profile Induced by SCV2-RNA2 in Neutrophils Is Dependent on TLR8 Activation
3.5. SCV2-RNA2 Potently Induces the Release of NETs by Human Neutrophils in a TLR8-Dependent Manner
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Dong, E.; Du, H.; Gardner, L. An interactive web-based dashboard to track COVID-19 in real time. Lancet Infect. Dis. 2020, 20, 533–534. [Google Scholar] [CrossRef] [PubMed]
- Hu, B.; Guo, H.; Zhou, P.; Shi, Z.-L. Characteristics of SARS-CoV-2 and COVID-19. Nat. Rev. Microbiol. 2021, 19, 141–154. [Google Scholar] [CrossRef] [PubMed]
- Lu, R.; Zhao, X.; Li, J.; Niu, P.; Yang, B.; Wu, H.; Wang, W.; Song, H.; Huang, B.; Zhu, N.; et al. Genomic characterisation and epidemiology of 2019 novel coronavirus: Implications for virus origins and receptor binding. Lancet 2020, 395, 565–574. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, M.-Y.; Zhao, R.; Gao, L.-J.; Gao, X.-F.; Wang, D.-P.; Cao, J.-M. SARS-CoV-2: Structure, Biology, and Structure-Based Therapeutics Development. Front. Cell Infect. Microbiol. 2020, 10, 587269. [Google Scholar] [CrossRef]
- Gupta, A.; Madhavan, M.V.; Sehgal, K.; Nair, N.; Mahajan, S.; Sehrawat, T.S.; Bikdeli, B.; Ahluwalia, N.; Ausiello, J.C.; Wan, E.Y.; et al. Extrapulmonary manifestations of COVID-19. Nat. Med. 2020, 26, 1017–1032. [Google Scholar] [CrossRef] [PubMed]
- Chen, N.; Zhou, M.; Dong, X.; Qu, J.; Gong, F.; Han, Y.; Qiu, Y.; Wang, J.; Liu, Y.; Wei, Y.; et al. Epidemiological and clinical characteristics of 99 cases of 2019 novel coronavirus pneumonia in Wuhan, China: A descriptive study. Lancet 2020, 395, 507–513. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, D.; Hu, B.; Hu, C.; Zhu, F.; Liu, X.; Zhang, J.; Wang, B.; Xiang, H.; Cheng, Z.; Xiong, Y.; et al. Clinical Characteristics of 138 Hospitalized Patients With 2019 Novel Coronavirus—Infected Pneumonia in Wuhan, China. JAMA 2020, 323, 1061–1069. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Mao, B.; Liang, S.; Yang, J.-W.; Lu, H.-W.; Chai, Y.-H.; Wang, L.; Zhang, L.; Li, Q.-H.; Zhao, L.; et al. Association between age and clinical characteristics and outcomes of COVID-19. Eur. Respir. J. 2020, 55, 2001112. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, C.; Chen, X.; Cai, Y.; Xia, J.; Zhou, X.; Xu, S.; Huang, H.; Zhang, L.; Zhou, X.; Du, C.; et al. Risk Factors Associated With Acute Respiratory Distress Syndrome and Death in Patients With Coronavirus Disease 2019 Pneumonia in Wuhan, China. JAMA Intern. Med. 2020, 180, 934–943. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hu, B.; Huang, S.; Yin, L. The cytokine storm and COVID-19. J. Med. Virol. 2021, 93, 250–256. [Google Scholar] [CrossRef] [PubMed]
- Camp, J.V.; Jonsson, C.B. A Role for Neutrophils in Viral Respiratory Disease. Front. Immunol. 2017, 8, 550. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hayashi, F.; Means, F.H.T.K.; Luster, A.D. Toll-like receptors stimulate human neutrophil function. Blood 2003, 102, 2660–2669. [Google Scholar] [CrossRef] [PubMed]
- Berger, M.; Hsieh, C.-Y.; Bakele, M.; Marcos, V.; Rieber, N.; Kormann, M.; Mays, L.; Hofer, L.; Neth, O.; Vitkov, L.; et al. Neutrophils Express Distinct RNA Receptors in a Non-canonical Way. J. Biol. Chem. 2012, 287, 19409–19417. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tamassia, N.; Cassatella, M.A. Cytoplasmic receptors recognizing nucleic acids and mediating immune functions in neutrophils. Curr. Opin. Pharmacol. 2013, 13, 547–554. [Google Scholar] [CrossRef]
- Stegelmeier, A.; Darzianiazizi, M.; Hanada, K.; Sharif, S.; Wootton, S.; Bridle, B.; Karimi, K. Type I Interferon-Mediated Regulation of Antiviral Capabilities of Neutrophils. Int. J. Mol. Sci. 2021, 22, 4726. [Google Scholar] [CrossRef] [PubMed]
- Cassatella, M.A.; Huber, V.; Calzetti, F.; Margotto, D.; Tamassia, N.; Peri, G.; Mantovani, A.; Rivoltini, L.; Tecchio, C. Interferon-activated neutrophils store a TNF-related apoptosis-inducing ligand (TRAIL/Apo-2 ligand) intracellular pool that is readily mobilizable following exposure to proinflammatory mediators. J. Leukoc. Biol. 2005, 79, 123–132. [Google Scholar] [CrossRef] [PubMed]
- Zimmermann, M.; e Silva, F.A.; Bianchetto-Aguilera, F.; Finotti, G.; Calzetti, F.; Scapini, P.; Lunardi, C.; Cassatella, M.A.; Tamassia, N. IFNα enhances the production of IL-6 by human neutrophils activated via TLR8. Sci. Rep. 2016, 6, 19674. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zimmermann, M.; Aguilera, F.B.; Castellucci, M.; Rossato, M.; Costa, S.; Lunardi, C.; Ostuni, R.; Girolomoni, G.; Natoli, G.; Bazzoni, F.; et al. Chromatin remodelling and autocrine TNFα are required for optimal interleukin-6 expression in activated human neutrophils. Nat. Commun. 2015, 6, 6061. [Google Scholar] [CrossRef] [Green Version]
- Tamassia, N.; Bianchetto-Aguilera, F.; Gasperini, S.; Polletti, S.; Gardiman, E.; Ostuni, R.; Natoli, G.; Cassatella, M.A. Induction of OCT2 contributes to regulate the gene expression program in human neutrophils activated via TLR8. Cell Rep. 2021, 35, 109143. [Google Scholar] [CrossRef] [PubMed]
- Heil, F.; Hemmi, H.; Hochrein, H.; Ampenberger, F.; Kirschning, C.; Akira, S.; Lipford, G.; Wagner, H.; Bauer, S. Species-Specific Recognition of Single-Stranded RNA via Toll-like Receptor 7 and 8. Science 2004, 303, 1526–1529. [Google Scholar] [CrossRef]
- Salvi, V.; Nguyen, H.O.; Sozio, F.; Schioppa, T.; Gaudenzi, C.; Laffranchi, M.; Scapini, P.; Passari, M.; Barbazza, I.; Tiberio, L.; et al. SARS-CoV-2–associated ssRNAs activate inflammation and immunity via TLR7/8. J. Clin. Investig. 2021, 6, e150542. [Google Scholar] [CrossRef]
- Calzetti, F.; Tamassia, N.; Arruda-Silva, F.; Gasperini, S.; Cassatella, M.A. The importance of being “pure” neutrophils. J. Allergy Clin. Immunol. 2017, 139, 352–355.e356. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Muller, P.Y.; Janovjak, H.; Miserez, A.R.; Dobbie, Z. Processing of gene expression data generated by quantitative real-time RT-PCR. Biotechniques 2002, 32, 1372–1374+1376+1378–1379. [Google Scholar] [PubMed]
- Picelli, S.; Faridani, O.R.; Bjorklund, A.K.; Winberg, G.; Sagasser, S.; Sandberg, R. Full-length RNA-seq from single cells using Smart-seq2. Nat. Protoc. 2014, 9, 171–181. [Google Scholar] [CrossRef] [PubMed]
- Bray, N.L.; Pimentel, H.; Melsted, P.; Pachter, L. Near-optimal probabilistic RNA-seq quantification. Nat. Biotechnol. 2016, 34, 525–527. [Google Scholar] [CrossRef]
- Tibshirani, R.; Walther, G.; Hastie, T. Estimating the number of clusters in a data set via the gap statistic. J. R. Stat. Soc. Ser. B Stat. Methodol. 2001, 63, 411–423. [Google Scholar] [CrossRef]
- Wu, T.; Hu, E.; Xu, S.; Chen, M.; Guo, P.; Dai, Z.; Feng, T.; Zhou, L.; Tang, W.; Zhan, L.; et al. clusterProfiler 4.0: A universal enrichment tool for interpreting omics data. Innovation 2021, 2, 100141. [Google Scholar] [CrossRef]
- Bianchetto-Aguilera, F.; Tamassia, N.; Gasperini, S.; Calzetti, F.; Finotti, G.; Gardiman, E.; Montioli, R.; Bresciani, D.; Vermi, W.; Cassatella, M.A. Deciphering the fate of slan + -monocytes in human tonsils by gene expression profiling. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 2020, 34, 9269–9284. [Google Scholar] [CrossRef]
- Tamassia, N.; Bianchetto-Aguilera, F.; e Silva, F.A.; Gardiman, E.; Gasperini, S.; Calzetti, F.; Cassatella, M.A. Cytokine production by human neutrophils: Revisiting the “dark side of the moon”. Eur. J. Clin. Investig. 2018, 48 (Suppl. 2), e12952. [Google Scholar] [CrossRef]
- Cassatella, M.A.; Gardiman, E.; Arruda-Silva, F.; Bianchetto-Aguilera, F.; Gasperini, S.; Bugatti, M.; Vermi, W.; Larousserie, F.; Devergne, O.; Tamassia, N. Human neutrophils activated by TLR8 agonists, with or without IFNγ, synthesize and release EBI3, but not IL-12, IL-27, IL-35, or IL-39. J. Leukoc. Biol. 2020, 108, 1515–1526. [Google Scholar] [CrossRef]
- Arruda-Silva, F.; Bianchetto-Aguilera, F.; Gasperini, S.; Polletti, S.; Cosentino, E.; Tamassia, N.; Cassatella, M.A. Human Neutrophils Produce CCL23 in Response to Various TLR-Agonists and TNFα. Front. Cell Infect. Microbiol. 2017, 7, 176. [Google Scholar] [CrossRef] [Green Version]
- Zhang, S.; Shuting, Z.; Tanji, H.; Jiang, S.; Das, N.; Li, J.; Sakaniwa, K.; Jin, J.; Bian, Y.; Ohto, U.; et al. Small-molecule inhibition of TLR8 through stabilization of its resting state. Nat. Chem. Biol. 2018, 14, 58–64. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vlach, J.; Bender, A.T.; Przetak, M.; Pereira, A.; Deshpande, A.; Johnson, T.L.; Reissig, S.; Tzvetkov, E.; Musil, D.; Morse, N.T.; et al. Discovery of M5049: A Novel Selective Toll-Like Receptor 7/8 Inhibitor for Treatment of Autoimmunity. J. Pharmacol. Exp. Ther. 2021, 376, 397–409. [Google Scholar] [CrossRef] [PubMed]
- Lund, J.M.; Alexopoulou, L.; Sato, A.; Karow, M.; Adams, N.C.; Gale, N.W.; Iwasaki, A.; Flavell, R.A. Recognition of single-stranded RNA viruses by Toll-like receptor 7. Proc. Natl. Acad. Sci. USA 2004, 101, 5598–5603. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Middleton, E.A.; He, X.-Y.; Denorme, F.; Campbell, R.A.; Ng, D.; Salvatore, S.P.; Mostyka, M.; Baxter-Stoltzfus, A.; Borczuk, A.C.; Loda, M.; et al. Neutrophil extracellular traps contribute to immunothrombosis in COVID-19 acute respiratory distress syndrome. Blood 2020, 136, 1169–1179. [Google Scholar] [CrossRef] [PubMed]
- Neubert, E.; Senger-Sander, S.N.; Manzke, V.S.; Busse, J.; Polo, E.; Scheidmann, S.E.F.; Schön, M.P.; Kruss, S.; Erpenbeck, L. Serum and Serum Albumin Inhibit in vitro Formation of Neutrophil Extracellular Traps (NETs). Front. Immunol. 2019, 10, 12. [Google Scholar] [CrossRef] [PubMed]
- Khalifa, A.E.; Ghoneim, A.I. Potential value of pharmacological agents acting on toll-like receptor (TLR) 7 and/or TLR8 in COVID-19. Curr. Res. Pharmacol. Drug Discov. 2021, 2, 100068. [Google Scholar] [CrossRef] [PubMed]
- Cassatella, M.A.; Östberg, N.K.; Tamassia, N.; Soehnlein, O. Biological Roles of Neutrophil-Derived Granule Proteins and Cytokines. Trends Immunol. 2019, 40, 648–664. [Google Scholar] [CrossRef] [PubMed]
- Tanji, H.; Ohto, U.; Shibata, T.; Miyake, K.; Shimizu, T. Structural Reorganization of the Toll-Like Receptor 8 Dimer Induced by Agonistic Ligands. Science 2013, 339, 1426–1429. [Google Scholar] [CrossRef] [PubMed]
- Tanji, H.; Ohto, U.; Shibata, T.; Taoka, M.; Yamauchi, Y.; Isobe, T.; Miyake, K.; Shimizu, T. Toll-like receptor 8 senses degradation products of single-stranded RNA. Nat. Struct. Mol. Biol. 2015, 22, 109–115. [Google Scholar] [CrossRef] [PubMed]
- Silvin, A.; Chapuis, N.; Dunsmore, G.; Goubet, A.-G.; Dubuisson, A.; Derosa, L.; Almire, C.; Hénon, C.; Kosmider, O.; Droin, N.; et al. Elevated Calprotectin and Abnormal Myeloid Cell Subsets Discriminate Severe from Mild COVID-19. Cell 2020, 182, 1401–1418.e18. [Google Scholar] [CrossRef] [PubMed]
- Uematsu, S.; Akira, S. Toll-like Receptors and Type I Interferons. J. Biol. Chem. 2007, 282, 15319–15323. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jackson, C.B.; Farzan, M.; Chen, B.; Choe, H. Mechanisms of SARS-CoV-2 entry into cells. Nat. Rev. Mol. Cell Biol. 2022, 23, 3–20. [Google Scholar] [CrossRef]
- Lourda, M.; Dzidic, M.; Hertwig, L.; Bergsten, H.; Medina, L.M.P.; Sinha, I.; Kvedaraite, E.; Chen, P.; Muvva, J.R.; Gorin, J.-B.; et al. High-dimensional profiling reveals phenotypic heterogeneity and disease-specific alterations of granulocytes in COVID-19. Proc. Natl. Acad. Sci. USA 2021, 118, e2109123118. [Google Scholar] [CrossRef]
- Song, X.; Hu, W.; Yu, H.; Zhao, L.; Zhao, Y.; Zhao, X.; Xue, H.; Zhao, Y. Little to no expression of angiotensin-converting enzyme-2 on most human peripheral blood immune cells but highly expressed on tissue macrophages. Cytom. A 2020. [Google Scholar] [CrossRef]
- Rosin, N.L.; Jaffer, A.; Sinha, S.; Mulloy, R.P.; Robinson, C.; Labit, E.; Almeida, L.G.; Dufour, A.; Corcoran, J.A.; Yipp, B.; et al. SARS-CoV-2 infection of circulating immune cells is not responsible for virus dissemination in severe COVID-19 patients. Biorxiv 2021. [Google Scholar] [CrossRef]
- Veras, F.P.; Pontelli, M.C.; Silva, C.M.; Toller-Kawahisa, J.E.; de Lima, M.; Nascimento, D.C.; Schneider, A.H.; Caetité, D.; Tavares, L.A.; Paiva, I.M.; et al. SARS-CoV-2–triggered neutrophil extracellular traps mediate COVID-19 pathology. J. Exp. Med. 2020, 217, e20201129. [Google Scholar] [CrossRef] [PubMed]
- Calvert, B.A.; Quiroz, E.J.; Lorenzana, Z.; Doan, N.; Kim, S.; Senger, C.N.; Wallace, W.D.; Salomon, M.P.; Henley, J.; Ryan, A.L. Neutrophilic inflammation promotes SARS-CoV-2 infectivity and augments the inflammatory responses in airway epithelial cells. bioRxiv 2022. [Google Scholar] [CrossRef]
- Junqueira, C.; Crespo, A.; Ranjbar, S.; de Lacerda, L.B.; Lewandrowski, M.; Ingber, J.; Parry, B.; Ravid, S.; Clark, S.; Schrimpf, M.R.; et al. FcγR-mediated SARS-CoV-2 infection of monocytes activates inflammation. Nature 2022, 606, 576–584. [Google Scholar] [CrossRef]
- Bost, P.; De Sanctis, F.; Canè, S.; Ugel, S.; Donadello, K.; Castellucci, M.; Eyal, D.; Fiore, A.; Anselmi, C.; Barouni, R.M.; et al. Deciphering the state of immune silence in fatal COVID-19 patients. Nat. Commun. 2021, 12, 1428. [Google Scholar] [CrossRef] [PubMed]
- Radermecker, C.; Detrembleur, N.; Guiot, J.; Cavalier, E.; Henket, M.; D’Emal, C.; Vanwinge, C.; Cataldo, D.; Oury, C.; Delvenne, P.; et al. Neutrophil extracellular traps infiltrate the lung airway, interstitial, and vascular compartments in severe COVID-19. J. Exp. Med. 2020, 217, e20201012. [Google Scholar] [CrossRef]
- Hazeldine, J.; Lord, J.M. Neutrophils and COVID-19: Active Participants and Rational Therapeutic Targets. Front. Immunol. 2021, 12, 680134. [Google Scholar] [CrossRef] [PubMed]
- Barnes, B.J.; Adrover, J.M.; Baxter-Stoltzfus, A.; Borczuk, A.; Cools-Lartigue, J.; Crawford, J.M.; Daßler-Plenker, J.; Guerci, P.; Huynh, C.; Knight, J.S.; et al. Targeting potential drivers of COVID-19: Neutrophil extracellular traps. J. Exp. Med. 2020, 217, e20200652. [Google Scholar] [CrossRef] [PubMed]
- Arcanjo, A.; Logullo, J.; Menezes, C.C.B.; Giangiarulo, T.C.D.S.C.; Dos Reis, M.C.; De Castro, G.M.M.; Fontes, Y.D.S.; Todeschini, A.R.; Freire-De-Lima, L.; Decoté-Ricardo, D.; et al. The emerging role of neutrophil extracellular traps in severe acute respiratory syndrome coronavirus 2 (COVID-19). Sci. Rep. 2020, 10, 19630. [Google Scholar] [CrossRef] [PubMed]
- Saitoh, T.; Komano, J.; Saitoh, Y.; Misawa, T.; Takahama, M.; Kozaki, T.; Uehata, T.; Iwasaki, H.; Omori, H.; Yamaoka, S.; et al. Neutrophil Extracellular Traps Mediate a Host Defense Response to Human Immunodeficiency Virus-1. Cell Host Microbe 2012, 12, 109–116. [Google Scholar] [CrossRef] [Green Version]
- Hiroki, C.H.; Toller-Kawahisa, J.E.; Fumagalli, M.J.; Colon, D.; Figueiredo, L.T.M.; Fonseca, B.A.L.D.; Franca, R.F.O.; Cunha, F.Q. Neutrophil Extracellular Traps Effectively Control Acute Chikungunya Virus Infection. Front. Immunol. 2019, 10, 3108. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Janke, M.; Poth, J.; Wimmenauer, V.; Giese, T.; Coch, C.; Barchet, W.; Schlee, M.; Hartmann, G. Selective and direct activation of human neutrophils but not eosinophils by Toll-like receptor 8. J. Allergy Clin. Immunol. 2009, 123, 1026–1033. [Google Scholar] [CrossRef] [PubMed]
- Taylor, E.L.; Rossi, A.G.; Dransfield, I.; Hart, S.P. Analysis of Neutrophil Apoptosis. Methods Mol. Biol. 2007, 412, 177–200. [Google Scholar] [CrossRef] [PubMed]
- Yipp, B.G.; Kubes, P. NETosis: How vital is it? Blood 2013, 122, 2784–2794. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primers | Reverse Primers |
---|---|---|
GAPDH | AACAGCCTCAAGATCATCAGC | GGATGATGTTCTGGAGAGCC |
RPL32 | AGGGTTCGTAGAAGATTCAAGG | GGAAACATTGTGAGCGATCTC |
IL1RN | TTCCTGTTCCATTCAGAGACGAT | AATTGACATTTGGTCCTTGCAA |
IL6 | GGCACTGGCAGAAAACAACC | GCAAGTCTCCTCATTGAATCC |
TNF | GAGCACTGAAAGCATGATCC | CGAGAAGATGATCTGACTGCC |
CXCL8 | CTGGCCGTGGCTCTCTTG | CCTTGGCAAAACTGCACCTT |
IFNA(all) | GTGAGGAAATACTTCCAAAGAATCAC | TCTCATGATTTCTGCTCTGACAA |
IFNB1 | CAGCAATTTTCAGTGTCAGAAGC | TCATCCTGTCCTTGAGGCAGT |
IFIT1 | TCATCAGGTCAAGGATAGTCTG | GGTGTTTCACATAGGCTAGTAG |
ISG15 | ACTCATCTTTGCCAGTACAGGAG | CAGCATCTTCACCGTCAGGTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gardiman, E.; Bianchetto-Aguilera, F.; Gasperini, S.; Tiberio, L.; Scandola, M.; Lotti, V.; Gibellini, D.; Salvi, V.; Bosisio, D.; Cassatella, M.A.; et al. SARS-CoV-2-Associated ssRNAs Activate Human Neutrophils in a TLR8-Dependent Fashion. Cells 2022, 11, 3785. https://doi.org/10.3390/cells11233785
Gardiman E, Bianchetto-Aguilera F, Gasperini S, Tiberio L, Scandola M, Lotti V, Gibellini D, Salvi V, Bosisio D, Cassatella MA, et al. SARS-CoV-2-Associated ssRNAs Activate Human Neutrophils in a TLR8-Dependent Fashion. Cells. 2022; 11(23):3785. https://doi.org/10.3390/cells11233785
Chicago/Turabian StyleGardiman, Elisa, Francisco Bianchetto-Aguilera, Sara Gasperini, Laura Tiberio, Matteo Scandola, Virginia Lotti, Davide Gibellini, Valentina Salvi, Daniela Bosisio, Marco A. Cassatella, and et al. 2022. "SARS-CoV-2-Associated ssRNAs Activate Human Neutrophils in a TLR8-Dependent Fashion" Cells 11, no. 23: 3785. https://doi.org/10.3390/cells11233785