Aberrant Expression of COX-2 and FOXG1 in Infrapatellar Fat Pad-Derived ASCs from Pre-Diabetic Donors
Abstract
:1. Introduction
2. Materials and Methods
2.1. IPFP-ASC Isolation and Expansion
2.2. Flow Cytometry
2.3. Colony-Forming Unit Assay (CFU)
2.4. Osteogenic and Adipogenic Differentiation
2.5. Co-Culture of ASCs with Monocyte-Derived Macrophages
2.6. IL-1β Induction
2.7. Quantitative Polymerase Chain Reaction (qPCR)
2.8. Enzyme-Linked Immunosorbent Assay (ELISA)
2.9. Statistical Analysis
3. Results
3.1. Altered Cell Surface Antigen Expression in Pre-T2D IPFP ASCs
3.2. Decreased COX-2 and IL-6 Gene Expression in Adipogenically Differentiated IPFP-ASCs
3.3. Increased COX-2, IL-6 and FOXG1 Gene Expression in IL-1β Stimulated Pre-T2D IPFP-ASCs
3.4. Reduced Expression of TNFα and IL-6 in M1 Macrophages Co-Cultured with Pre-T2D IPFP-ASCs
3.5. Decreased Expression of Leptin and IL-10 and Increased Expression of COX-2 and FOXG1 in Pre-T2D IPFP-ASCs Co-Cultured with M1 Macrophages
3.6. Increased PGE2 Secretion by Pre-T2D IPFP-ASCs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Deshpande, B.R.; Katz, J.N.; Solomon, D.H.; Yelin, E.H.; Hunter, D.J.; Messier, S.P.; Suter, L.G.; Losina, E. Number of persons with symptomatic knee osteoarthritis in the US: Impact of race and ethnicity, age, sex, and obesity. Arthritis Care Res. 2016, 68, 1743–1750. [Google Scholar] [CrossRef] [PubMed]
- Cross, M.; Smith, E.; Hoy, D.; Nolte, S.; Ackerman, I.; Fransen, M.; Bridgett, L.; Williams, S.; Guillemin, F.; Hill, C.L.; et al. The global burden of hip and knee osteoarthritis: Estimates from the global burden of disease 2010 study. Ann. Rheum. Dis. 2014, 73, 1323–1330. [Google Scholar] [CrossRef]
- Goldring, S.R.; Goldring, M.B. Clinical aspects, pathology and pathophysiology of osteoarthritis. J. Musculoskelet. Neuronal. Interact. 2006, 6, 376–378. [Google Scholar] [PubMed]
- Bondeson, J.; Wainwright, S.D.; Lauder, S.; Amos, N.; Hughes, C.E. The role of synovial macrophages and macrophage-produced cytokines in driving aggrecanases, matrix metalloproteinases, and other destructive and inflammatory responses in osteoarthritis. Arthritis Res. Ther. 2006, 8, R187. [Google Scholar] [CrossRef]
- Song, I.H.; Althoff, C.E.; Hermann, K.G.; Scheel, A.K.; Knetsch, T.; Schoenharting, M.; Werner, C.; Burmester, G.R.; Backhaus, M. Knee osteoarthritis. Efficacy of a new method of contrast-enhanced musculoskeletal ultrasonography in detection of synovitis in patients with knee osteoarthritis in comparison with magnetic resonance imaging. Ann. Rheum. Dis. 2008, 67, 19–25. [Google Scholar] [CrossRef] [PubMed]
- Krasnokutsky, S.; Belitskaya-Lévy, I.; Bencardino, J.; Samuels, J.; Attur, M.; Regatte, R.; Rosenthal, P.; Greenberg, J.; Schweitzer, M.; Abramson, S.B.; et al. Quantitative magnetic resonance imaging evidence of synovial proliferation is associated with radiographic severity of knee osteoarthritis. Arthritis Rheum. 2011, 63, 2983–2991. [Google Scholar] [CrossRef]
- Chen, D.; Shen, J.; Zhao, W.; Wang, T.; Han, L.; Hamilton, J.L.; Im, H.J. Osteoarthritis: Toward a comprehensive understanding of pathological mechanism. Bone Res. 2017, 5, 16044. [Google Scholar] [CrossRef]
- Rezuş, E.; Burlui, A.; Cardoneanu, A.; Macovei, L.A.; Tamba, B.I.; Rezuş, C. From pathogenesis to therapy in knee osteoarthritis: Bench-to-bedside. Int. J. Mol. Sci. 2021, 22, 2697. [Google Scholar] [CrossRef]
- Buschemeyer, W.C., 3rd; Freedland, S.J. Obesity and prostate cancer: Epidemiology and clinical implications. Eur. Urol. 2007, 52, 331–343. [Google Scholar] [CrossRef]
- Jiang, L.F.; Fang, J.H.; Wu, L.D. Role of infrapatellar fat pad in pathological process of knee osteoarthritis: Future applications in treatment. World J. Clin. Cases 2019, 7, 2134–2142. [Google Scholar] [CrossRef] [PubMed]
- Sohn, D.H.; Sokolove, J.; Sharpe, O.; Erhart, J.C.; Chandra, P.E.; Lahey, L.J.; Lindstrom, T.M.; Hwang, I.; Boyer, K.A.; Andriacchi, T.P.; et al. Plasma proteins present in osteoarthritic synovial fluid can stimulate cytokine production via Toll-like receptor 4. Arthritis Res. Ther. 2012, 14, R7. [Google Scholar] [CrossRef] [PubMed]
- Kaneko, S.; Satoh, T.; Chiba, J.; Ju, C.; Inoue, K.; Kagawa, J. Interleukin-6 and interleukin-8 levels in serum and synovial fluid of patients with osteoarthritis. Cytokines Cell Mol. Ther. 2000, 6, 71–79. [Google Scholar] [CrossRef] [PubMed]
- Goldring, M.B.; Birkhead, J.R.; Suen, L.F.; Yamin, R.; Mizuno, S.; Glowacki, J.; Arbiser, J.L.; Apperley, J.F. Interleukin-1 beta-modulated gene expression in immortalized human chondrocytes. J. Clin. Investig. 1994, 94, 2307–2316. [Google Scholar] [CrossRef] [PubMed]
- Westacott, C.I.; Atkins, R.M.; Dieppe, P.A.; Elson, C.J. Tumor necrosis factor-alpha receptor expression on chondrocytes isolated from human articular cartilage. J. Rheumatol. 1994, 21, 1710–1715. [Google Scholar] [PubMed]
- Xue, J.; Wang, J.; Liu, Q.; Luo, A. Tumor necrosis factor-α induces ADAMTS-4 expression in human osteoarthritis chondrocytes. Mol. Med. Rep. 2013, 8, 1755–1760. [Google Scholar] [CrossRef]
- Pearle, A.D.; Scanzello, C.R.; George, S.; Mandl, L.A.; DiCarlo, E.F.; Peterson, M.; Sculco, T.P.; Crow, M.K. Elevated high-sensitivity C-reactive protein levels are associated with local inflammatory findings in patients with osteoarthritis. Osteoarthr. Cartil. 2007, 15, 516–523. [Google Scholar] [CrossRef]
- Ballegaard, C.; Riis, R.G.; Bliddal, H.; Christensen, R.; Henriksen, M.; Bartels, E.M.; Lohmander, L.S.; Hunter, D.J.; Bouert, R.; Boesen, M. Knee pain and inflammation in the infrapatellar fat pad estimated by conventional and dynamic contrast-enhanced magnetic resonance imaging in obese patients with osteoarthritis: A cross-sectional study. Osteoarthr. Cartil. 2014, 22, 933–940. [Google Scholar] [CrossRef]
- Hotamisligil, G.S. Inflammation, metaflammation and immunometabolic disorders. Nature 2017, 542, 177. [Google Scholar] [CrossRef] [PubMed]
- Katsuki, A.; Sumida, Y.; Murashima, S.; Murata, K.; Takarada, Y.; Ito, K.; Fujii, M.; Tsuchihashi, K.; Goto, H.; Nakatani, K.; et al. Serum levels of tumor necrosis factor-alpha are increased in obese patients with noninsulin-dependent diabetes mellitus. J. Clin. Endocrinol. Metab. 1998, 83, 859–862. [Google Scholar] [CrossRef] [PubMed]
- Yusuf, E.; Nelissen, R.G.; Ioan-Facsinay, A.; Stojanovic-Susulic, V.; DeGroot, J.; van Osch, G.; Middeldorp, S.; Huizinga, T.W.; Kloppenburg, M. Association between weight or body mass index and hand osteoarthritis: A systematic review. Ann. Rheum. Dis. 2010, 69, 761–765. [Google Scholar] [CrossRef]
- Schett, G.; Kleyer, A.; Perricone, C.; Sahinbegovic, E.; Iagnocco, A.; Zwerina, J.; Lorenzini, R.; Aschenbrenner, F.; Berenbaum, F.; D’Agostino, M.A.; et al. Diabetes is an independent predictor for severe osteoarthritis: Results from a longitudinal cohort study. Diabetes Care 2013, 36, 403–409. [Google Scholar] [CrossRef]
- Presle, N.; Pottie, P.; Dumond, H.; Guillaume, C.; Lapicque, F.; Pallu, S.; Mainard, D.; Netter, P.; Terlain, B. Differential distribution of adipokines between serum and synovial fluid in patients with osteoarthritis. Contribution of joint tissues to their articular production. Osteoarthr. Cartil. 2006, 14, 690–695. [Google Scholar] [CrossRef] [PubMed]
- Simopoulou, T.; Malizos, K.N.; Iliopoulos, D.; Stefanou, N.; Papatheodorou, L.; Ioannou, M.; Tsezou, A. Differential expression of leptin and leptin’s receptor isoform (Ob-Rb) mRNA between advanced and minimally affected osteoarthritic cartilage; effect on cartilage metabolism. Osteoarthr. Cartil. 2007, 15, 872–883. [Google Scholar] [CrossRef] [PubMed]
- Hui, W.; Litherland, G.J.; Elias, M.S.; Kitson, G.I.; Cawston, T.E.; Rowan, A.D.; Young, D.A. Leptin produced by joint white adipose tissue induces cartilage degradation via upregulation and activation of matrix metalloproteinases. Ann. Rheum. Dis. 2012, 71, 455–462. [Google Scholar] [CrossRef]
- Sakaguchi, Y.; Sekiya, I.; Yagishita, K.; Muneta, T. Comparison of human stem cells derived from various mesenchymal tissues: Superiority of synovium as a cell source. Arthritis Rheum. 2005, 52, 2521–2529. [Google Scholar] [CrossRef]
- Lee, W.S.; Kim, H.J.; Kim, K.I.; Kim, G.B.; Jin, W. Intra-Articular Injection of Autologous Adipose Tissue-Derived Mesenchymal Stem Cells for the Treatment of Knee Osteoarthritis: A Phase IIb, Randomized, Placebo-Controlled Clinical Trial. Stem Cells Transl. Med. 2019, 8, 504–511. [Google Scholar] [CrossRef] [PubMed]
- Koh, Y.G.; Choi, Y.J. Infrapatellar fat pad-derived mesenchymal stem cell therapy for knee osteoarthritis. Knee 2012, 19, 902–907. [Google Scholar] [CrossRef]
- Ter Huurne, M.; Schelbergen, R.; Blattes, R.; Blom, A.; de Munter, W.; Grevers, L.C.; Jeanson, J.; Noël, D.; Casteilla, L.; Jorgensen, C.; et al. Antiinflammatory and chondroprotective effects of intraarticular injection of adipose-derived stem cells in experimental osteoarthritis. Arthritis Rheum. 2012, 64, 3604. [Google Scholar] [CrossRef] [PubMed]
- Cramer, C.; Freisinger, E.; Jones, R.K.; Slakey, D.P.; Dupin, C.L.; Newsome, E.R.; Alt, E.U.; Izadpanah, R. Persistent high glucose concentrations alter the regenerative potential of mesenchymal stem cells. Stem Cells Dev. 2010, 19, 1875–1884. [Google Scholar] [CrossRef] [PubMed]
- Choudhery, M.S.; Badowski, M.; Muise, A.; Pierce, J.; Harris, D.T. Donor age negatively impacts adipose tissue-derived mesenchymal stem cell expansion and differentiation. J. Transl. Med. 2014, 12, 8. [Google Scholar] [CrossRef] [PubMed]
- Dufrane, D. Impact of Age on Human Adipose Stem Cells for Bone Tissue Engineering. Cell Transpl. 2017, 26, 1496–1504. [Google Scholar] [CrossRef] [PubMed]
- Silva, K.R.; Côrtes, I.; Liechocki, S.; Carneiro, J.R.; Souza, A.A.; Borojevic, R.; Maya-Monteiro, C.M.; Baptista, L.S. Characterization of stromal vascular fraction and adipose stem cells from subcutaneous, preperitoneal and visceral morbidly obese human adipose tissue depots. PLoS ONE 2017, 12, e0174115. [Google Scholar] [CrossRef]
- Skalska, U.; Kontny, E. Adipose-derived mesenchymal stem cells from infrapatellar fat pad of patients with rheumatoid arthritis and osteoarthritis have comparable immunomodulatory properties. Autoimmunity 2016, 49, 124–131. [Google Scholar] [CrossRef]
- Bohnsack, M.; Meier, F.; Walter, G.; Hurschler, C.; Schmolke, S.; Wirth, C.; Rühmann, O. Distribution of substance-P nerves inside the infrapatellar fat pad and the adjacent synovial tissue: A neurohistological approach to anterior knee pain syndrome. Arch. Orthop. Trauma Surg. 2005, 125, 592–597. [Google Scholar] [CrossRef]
- Klein-Wieringa, I.R.; de Lange-Brokaar, B.J.E.; Yusuf, E.; Andersen, S.N.; Kwekkeboom, J.C.; Kroon, H.M.; van Osch, G.J.V.M.; Zuurmond, A.-M.; Stojanovic-Susulic, V.; Nelissen, R.G.H.H.; et al. Inflammatory cells in patients with endstage knee osteoarthritis: A comparison between the synovium and the infrapatellar fat pad. J. Rheumatol. 2016, 43, 771. [Google Scholar] [CrossRef]
- Liu, Y.; Buckley, C.T.; Almeida, H.V.; Mulhall, K.J.; Kelly, D.J. Infrapatellar fat pad- derived stem cells maintain their chondrogenic capacity in disease and can be used to engineer cartilaginous grafts of clinically relevant dimensions. Tissue Eng. Part A 2014, 20, 3050. [Google Scholar] [CrossRef] [PubMed]
- Skalska, U.; Kontny, E.; Prochorec-Sobieszek, M.; Maśliński, W. Intra-articular adipose-derived mesenchymal stem cells from rheumatoid arthritis patients maintain the function of chondrogenic differentiation. Rheumatology 2012, 51, 1757–1764. [Google Scholar] [CrossRef] [PubMed]
- Bunnell, B.A.; Flaat, M.; Gagliardi, C.; Patel, B.; Ripoll, C. Adipose-derived stem cells: Isolation, expansion and differentiation. Methods 2008, 45, 115–120. [Google Scholar] [CrossRef] [PubMed]
- Lin, Z.; Li, Z.; Li, E.N.; Li, X.; Del Duke, C.J.; Shen, H.; Hao, T.; O’Donnell, B.; Bunnell, B.A.; Goodman, S.B.; et al. Osteochondral tissue chip derived from iPSCs: Modeling OA pathologies and testing drugs. Front. Bioeng. Biotechnol. 2019, 7, 411. [Google Scholar] [CrossRef]
- Arendt-Nielsen, L.; Egsgaard, L.L.; Petersen, K.K. Evidence for a central mode of action for etoricoxib (COX-2 inhibitor) in patients with painful knee osteoarthritis. Pain 2016, 157, 1634–1644. [Google Scholar] [CrossRef] [PubMed]
- Alicka, M.; Major, P.; Wysocki, M.; Marycz, K. Adipose-derived mesenchymal stem cells isolated from patients with type 2 diabetes show reduced “stemness” through an altered secretome profile, impaired anti-oxidative protection, and mitochondrial dynamics deterioration. J. Clin. Med. 2019, 8, 765. [Google Scholar] [CrossRef] [PubMed]
- Goldberg, R.B.; Bray, G.A.; Marcovina, S.M.; Mather, K.J.; Orchard, T.J.; Perreault, L.; Temprosa, M. Non-traditional biomarkers and incident diabetes in the Diabetes Prevention Program: Comparative effects of lifestyle and metformin interventions. Diabetologia 2019, 62, 58–69. [Google Scholar] [CrossRef]
- Jenkins, N.T.; Padilla, J.; Arce-Esquivel, A.A.; Bayless, D.S.; Martin, J.S.; Leidy, H.J.; Booth, F.W.; Rector, R.S.; Laughlin, M.H. Effects of endurance exercise training, metformin, and their combination on adipose tissue leptin and IL-10 secretion in OLETF rats. J. Appl. Physiol. 2012, 113, 1873–1883. [Google Scholar] [CrossRef] [PubMed]
- Nawrocka, D.; Kornicka, K.; Szydlarska, J.; Marycz, K. Basic fibroblast growth factor inhibits apoptosis and promotes proliferation of adipose-derived mesenchymal stromal cells isolated from patients with type 2 diabetes by reducing cellular oxidative stress. Oxid. Med. Cell. Longev. 2017, 2017, 3027109. [Google Scholar] [CrossRef]
- Mohsen-Kanson, T.; Hafner, A.-L.; Wdziekonski, B.; Villageois, P.; Chignon-Sicard, B.; Dani, C. Expression of cell surface markers during self-renewal and differentiation of human adipose-derived stem cells. Biochem. Bioph. Res. Commun. 2013, 430, 871–875. [Google Scholar] [CrossRef] [PubMed]
- Martel-Pelletier, J.; Pelletier, J.P.; Fahmi, H. Cyclooxygenase-2 and prostaglandins in articular tissues. Semin. Arthritis Rheum. 2003, 33, 155–167. [Google Scholar] [CrossRef]
- Anderson, G.D.; Hauser, S.D.; McGarity, K.L.; Bremer, M.E.; Isakson, P.C.; Gregory, S.A. Selective inhibition of cyclooxygenase (COX)-2 reverses inflammation and expression of COX-2 and interleukin 6 in rat adjuvant arthritis. J. Clin. Investig. 1996, 97, 2672–2679. [Google Scholar] [CrossRef]
- Attur, M.; Al-Mussawir, H.E.; Patel, J.; Kitay, A.; Dave, M.; Palmer, G.; Pillinger, M.H.; Abramson, S.B. Prostaglandin E2 exerts catabolic effects in osteoarthritis cartilage: Evidence for signaling via the EP4 receptor. J. Immunol. 2008, 181, 5082–5088. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Li, F.; Fan, C.; Wang, C.; Ruan, H. Analysis of isoform specific ERK signaling on the effects of interleukin-1β on COX-2 expression and PGE2 production in human chondrocytes. Biochem. Biophys. Res. Commun. 2010, 402, 23–29. [Google Scholar] [CrossRef]
- Griffin, T.M.; Scanzello, C.R. Innate inflammation and synovial macrophages in osteoarthritis pathophysiology. Clin. Exp. Rheumatol. 2019, 37 (Suppl. S120), 57–63. [Google Scholar] [PubMed]
- Murray, P.J.; Allen, J.E.; Biswas, S.K.; Fisher, E.A.; Gilroy, D.W.; Goerdt, S.; Gordon, S.; Hamilton, J.A.; Ivashkiv, L.B.; Lawrence, T.; et al. Macrophage activation and polarization: Nomenclature and experimental guidelines. Immunity 2014, 41, 14–20. [Google Scholar] [CrossRef] [PubMed]
- Bouffi, C.; Bony, C.; Courties, G.; Jorgensen, C.; Noël, D. IL-6-dependent PGE2 secretion by mesenchymal stem cells inhibits local inflammation in experimental arthritis. PLoS ONE 2010, 5, e14247. [Google Scholar] [CrossRef] [PubMed]
- Yañez, R.; Oviedo, A.; Aldea, M.; Bueren, J.A.; Lamana, M.L. Prostaglandin E2 plays a key role in the immunosuppressive properties of adipose and bone marrow tissue-derived mesenchymal stromal cells. Exp. Cell Res. 2010, 316, 3109–3123. [Google Scholar] [CrossRef] [PubMed]
- Macchi, V.; Stocco, E.; Stecco, C.; Belluzzi, E.; Favero, M.; Porzionato, A.; De Caro, R. The infrapatellar fat pad and the synovial membrane: An anatomo-functional unit. J. Anat. 2018, 233, 146–154. [Google Scholar] [CrossRef] [PubMed]
- Stocco, E.; Barbon, S.; Piccione, M.; Belluzzi, E.; Petrelli, L.; Pozzuoli, A.; Ramonda, R.; Rossato, M.; Favero, M.; Ruggieri, P.; et al. Infrapatellar Fat Pad Stem Cells Responsiveness to Microenvironment in Osteoarthritis: From Morphology to Function. Front. Cell Dev. Biol. 2019, 7, 323. [Google Scholar] [CrossRef]
- Arden, K.C. FoxO: Linking new signaling pathways. Mol. Cell 2004, 14, 416–418. [Google Scholar] [CrossRef]
- Wang, L.; Wang, J.; Jin, T.; Zhou, Y.; Chen, Q. FoxG1 facilitates proliferation and inhibits differentiation by downregulating FoxO/Smad signaling in glioblastoma. Biochem. Biophys. Res. Commun. 2018, 504, 46–53. [Google Scholar] [CrossRef]
- Maiese, K. FoxO transcription factors and regenerative pathways in diabetes mellitus. Curr. Neurovasc. Res. 2015, 12, 404–413. [Google Scholar] [CrossRef]
- Suri, S.; Gill, S.E.; Massena de Camin, S.; McWilliams, D.F.; Wilson, D.; Walsh, D.A. Neurovascular invasion at the osteochondral junction and in osteophytes in osteoarthritis. Ann. Rheum. Dis. 2007, 66, 1423. [Google Scholar] [CrossRef]
- Sommer, C.; Kress, M. Recent findings on how proinflammatory cytokines cause pain: Peripheral mechanisms in inflammatory and neuropathic hyperalgesia. Neurosci. Lett. 2004, 361, 184–187. [Google Scholar] [CrossRef]
- Hu, F.; Sun, B.; Xu, P.; Zhu, Y.; Meng, X.H.; Teng, G.J.; Xiao, Z.D. MiR-218 induces neuronal differentiation of ASCs in a temporally sequential manner with fibroblast growth factor by regulation of the wnt signaling pathway. Sci. Rep. 2017, 7, 39427. [Google Scholar] [CrossRef] [PubMed]
- O’Donnell, B.T.; Al-Ghadban, S.; Ives, C.J.; L’Ecuyer, M.P.; Monjure, T.A.; Romero-Lopez, M.; Li, Z.; Goodman, S.B.; Lin, H.; Tuan, R.S.; et al. Adipose tissue-derived stem cells retain their adipocyte differentiation potential in three-dimensional hydrogels and bioreactors. Biomolecules 2020, 10, 1070. [Google Scholar] [CrossRef] [PubMed]
- Romero-López, M.; Li, Z.; Rhee, C.; Maruyama, M.; Pajarinen, J.; O’Donnell, B.; Lin, T.H.; Lo, C.W.; Hanlon, J.; Dubowitz, R.; et al. Macrophage effects on mesenchymal stem cell osteogenesis in a three-dimensional in vitro bone model. Tissue Eng. Part A 2020, 26, 1099–1111. [Google Scholar] [CrossRef]
Group | Age | Body Mass Index (BMI) |
---|---|---|
Non-Diabetic (Non-T2D, n = 3) | 65.7 ± 8.7 | 32.1 ± 9.0 |
Pre-Diabetic (Pre-T2D, n = 3) | 65.7 ± 4.50 | 36.6 ± 6.0 |
Diabetic (T2D, n = 3) | 53.3 ± 11.3 | 32.1 ± 3.6 |
Name | Forward (5′-3′) | Reverse (5′-3′) |
---|---|---|
GAPDH | TGGTGCTCAGTGTAGCCCAG | GGACCTGACCTGCCGTCTAG |
PPARγ | AGGCGAGGGCGATCTTG | CCCATCATTAAGGAATTCATGTCATA |
ADIPOQ | AACATGCCCATTCGCTTTAC | AGAGGCTGACCTTCACATCC |
LEP | GAAGACCACATCCACACACG | AGCTCAGCCAGACCCATCTA |
FABP4 | AGCACCATAACCTTAGATGGGG | CGTGGAAGTGACGCCTTTCA |
PL1N | ACAAGTTCAGTGAGGTAG | CCTTGGTTGAGGAGACAG |
LPL | GAGATTTCTCTGTATGGCACTG | CTGCAAATGAGACACTTTCTC |
FOXG1 | GGCAAGGGCAACTACTGGAT | CTGAGTCAACACGGAGCTGT |
IRS2 | TCTCAGGAAAAGCAGCGAGG | TCACGTCGATGGCGATGTAG |
IL-33 | GCCTTGTGTTTCAAGCTGGG | CCAAAGGCAAAGCACTCCAC |
ICAM-1 | ACCATCTACAGCTTTCCGGC | CAATCCCTCTCGTCCAGTCG |
IGFBP5 | AAGCCTCCCTCACTCTCCAT | TTCCTCCCCACATCGACTCT |
IL-1β | TCCCCAGCCCTTTTGTTGA | TTAGAACCAAATGTG |
TNFα | TCTTCTCGAACCCCGAGTGA | CCTCTGATGGCACCACCA |
CCL-5 | CCCCATATTCCTCGGACACC | TCCTTGACCTGTGGACGACT |
COX-2 | TTGCTGGCAGGGTTGCTGGTGGTA | CATCTGCCTGCTCTGGTCAATCGAA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
O’Donnell, B.T.; Monjure, T.A.; Al-Ghadban, S.; Ives, C.J.; L’Ecuyer, M.P.; Rhee, C.; Romero-Lopez, M.; Li, Z.; Goodman, S.B.; Lin, H.; et al. Aberrant Expression of COX-2 and FOXG1 in Infrapatellar Fat Pad-Derived ASCs from Pre-Diabetic Donors. Cells 2022, 11, 2367. https://doi.org/10.3390/cells11152367
O’Donnell BT, Monjure TA, Al-Ghadban S, Ives CJ, L’Ecuyer MP, Rhee C, Romero-Lopez M, Li Z, Goodman SB, Lin H, et al. Aberrant Expression of COX-2 and FOXG1 in Infrapatellar Fat Pad-Derived ASCs from Pre-Diabetic Donors. Cells. 2022; 11(15):2367. https://doi.org/10.3390/cells11152367
Chicago/Turabian StyleO’Donnell, Benjamen T., Tia A. Monjure, Sara Al-Ghadban, Clara J. Ives, Michael P. L’Ecuyer, Claire Rhee, Monica Romero-Lopez, Zhong Li, Stuart B. Goodman, Hang Lin, and et al. 2022. "Aberrant Expression of COX-2 and FOXG1 in Infrapatellar Fat Pad-Derived ASCs from Pre-Diabetic Donors" Cells 11, no. 15: 2367. https://doi.org/10.3390/cells11152367
APA StyleO’Donnell, B. T., Monjure, T. A., Al-Ghadban, S., Ives, C. J., L’Ecuyer, M. P., Rhee, C., Romero-Lopez, M., Li, Z., Goodman, S. B., Lin, H., Tuan, R. S., & Bunnell, B. A. (2022). Aberrant Expression of COX-2 and FOXG1 in Infrapatellar Fat Pad-Derived ASCs from Pre-Diabetic Donors. Cells, 11(15), 2367. https://doi.org/10.3390/cells11152367