The N-Terminal Domain of Bfa1 Coordinates Mitotic Exit Independent of GAP Activity in Saccharomyces cerevisiae
Abstract
:1. Introduction
2. Materials and Methods
2.1. Yeast Strains and Culture
2.2. Plasmid Construct
2.3. Spotting Assay
2.4. Bimolecular Fluorescence Complementation (BiFC) Analysis
2.5. Fluorescence Microscopy and Image Quantification
2.6. Co-Immunoprecipitation (Co-IP) and Western Blot
2.7. Statistical Analysis
3. Results
3.1. Overexpression of Bfa1 Induces Growth Arrest with Hyper-Elongated aMTs
3.2. Overexpression of the N-Terminal Domain of Bfa1 Induces Growth Arrest with Hyper-Elongated aMTs
3.3. Overexpressed Bfa1-D16 Inhibits MEN Activity Independent of GAP
3.4. Bfa1-D16 Exhibits SPOC Function in a Bub2-Independent Manner
3.5. Hyper-Elongated aMTs Are Conserved in the Cells of Late Mitotic Arrest
3.6. Overexpression of Hyper-Elongated aMTs by Bfa1 or Bfa1-D16 Is Not Mediated by Their Interaction with MAPs
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Beach, D.L.; Thibodeaux, J.; Maddox, P.; Yeh, E.; Bloom, K. The role of the proteins Kar9 and Myo2 in orienting the mitotic spindle of budding yeast. Curr. Biol. 2000, 10, 1497–1506. [Google Scholar] [CrossRef] [Green Version]
- Lee, L.; Tirnauer, J.S.; Li, J.; Schuyler, S.C.; Liu, J.Y.; Pellman, D. Positioning of the mitotic spindle by a cortical-microtubule capture mechanism. Science 2000, 287, 2260–2262. [Google Scholar] [CrossRef] [PubMed]
- Liakopoulos, D.; Kusch, J.; Grava, S.; Vogel, J.; Barral, Y. Asymmetric loading of Kar9 onto spindle poles and microtubules ensures proper spindle alignment. Cell 2003, 112, 561–574. [Google Scholar] [CrossRef] [Green Version]
- Carminati, J.L.; Stearns, T. Microtubules orient the mitotic spindle in yeast through dynein-dependent interactions with the cell cortex. J. Cell Biol. 1997, 138, 629–641. [Google Scholar] [CrossRef] [Green Version]
- Heil-Chapdelaine, R.A.; Oberle, J.R.; Cooper, J.A. The cortical protein Num1p is essential for dynein-dependent interactions of microtubules with the cortex. J. Cell Biol. 2000, 151, 1337–1343. [Google Scholar] [CrossRef]
- Mohl, D.A.; Huddleston, M.J.; Collingwood, T.S.; Annan, R.S.; Deshaies, R.J. Dbf2-Mob1 drives relocalization of protein phosphatase Cdc14 to the cytoplasm during exit from mitosis. J. Cell Biol. 2009, 184, 527–539. [Google Scholar] [CrossRef] [Green Version]
- Zhou, X.; Li, W.; Liu, Y.; Amon, A. Cross-compartment signal propagation in the mitotic exit network. Elife 2021, 10, e63645. [Google Scholar] [CrossRef]
- Campbell, I.W.; Zhou, X.X.; Amon, A. Spindle pole bodies function as signal amplifiers in the mitotic exit network. Mol. Biol. Cell 2020, 31, 906–916. [Google Scholar] [CrossRef]
- Bardin, A.J.; Visintin, R.; Amon, A. A mechanism for coupling exit from mitosis to partitioning of the nucleus. Cell 2000, 102, 21–31. [Google Scholar] [CrossRef] [Green Version]
- Rock, J.M.; Lim, D.; Stach, L.; Ogrodowicz, R.W.; Keck, J.M.; Jones, M.H.; Wong, C.C.; Yates, J.R., 3rd; Winey, M.; Smerdon, S.J.; et al. Activation of the yeast Hippo pathway by phosphorylation-dependent assembly of signaling complexes. Science 2013, 340, 871–875. [Google Scholar] [CrossRef]
- Mah, A.S.; Jang, J.; Deshaies, R.J. Protein kinase Cdc15 activates the Dbf2-Mob1 kinase complex. Proc. Natl. Acad. Sci. USA 2001, 98, 7325–7330. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Campbell, I.W.; Zhou, X.; Amon, A. The mitotic exit network integrates temporal and spatial signals by distributing regulation across multiple components. Elife 2019, 8, e41139. [Google Scholar] [CrossRef] [PubMed]
- Visintin, R.; Craig, K.; Hwang, E.S.; Prinz, S.; Tyers, M.; Amon, A. The phosphatase Cdc14 triggers mitotic exit by reversal of Cdk-dependent phosphorylation. Mol. Cell 1998, 2, 709–718. [Google Scholar] [CrossRef]
- Rock, J.M.; Amon, A. Cdc15 integrates Tem1 GTPase-mediated spatial signals with polo kinase-mediated temporal cues to activate mitotic exit. Genes Dev. 2011, 25, 1943–1954. [Google Scholar] [CrossRef] [Green Version]
- Valerio-Santiago, M.; Monje-Casas, F. Tem1 localization to the spindle pole bodies is essential for mitotic exit and impairs spindle checkpoint function. J. Cell Biol. 2011, 192, 599–614. [Google Scholar] [CrossRef] [Green Version]
- Maekawa, H.; Priest, C.; Lechner, J.; Pereira, G.; Schiebel, E. The yeast centrosome translates the positional information of the anaphase spindle into a cell cycle signal. J. Cell Biol. 2007, 179, 423–436. [Google Scholar] [CrossRef] [Green Version]
- Pereira, G.; Schiebel, E. Kin4 kinase delays mitotic exit in response to spindle alignment defects. Mol. Cell 2005, 19, 209–221. [Google Scholar] [CrossRef]
- D’Aquino, K.E.; Monje-Casas, F.; Paulson, J.; Reiser, V.; Charles, G.M.; Lai, L.; Shokat, K.M.; Amon, A. The protein kinase Kin4 inhibits exit from mitosis in response to spindle position defects. Mol. Cell 2005, 19, 223–234. [Google Scholar] [CrossRef]
- Geymonat, M.; Spanos, A.; Smith, S.J.; Wheatley, E.; Rittinger, K.; Johnston, L.H.; Sedgwick, S.G. Control of mitotic exit in budding yeast. In vitro regulation of Tem1 GTPase by Bub2 andBfa1. J. Biol. Chem. 2002, 277, 28439–28445. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.; Jang, S.S.; Song, K. Different levels of Bfa1/Bub2 GAP activity are required to prevent mitotic exit of budding yeast depending on the type of perturbations. Mol. Biol. Cell 2008, 19, 4328–4340. [Google Scholar] [CrossRef]
- Ro, H.S.; Song, S.; Lee, K.S. Bfa1 can regulate Tem1 function independently of Bub2 in the mitotic exit network of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 2002, 99, 5436–5441. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, J.; Jeong, J.; Song, K.W. The C-terminus of Bfa1p in budding yeast is essential to induce mitotic arrest in response to diverse checkpoint-activating signals. Genes Cells 2004, 9, 399–418. [Google Scholar] [CrossRef] [PubMed]
- Bertazzi, D.T.; Kurtulmus, B.; Pereira, G. The cortical protein Lte1 promotes mitotic exit by inhibiting the spindle position checkpoint kinase Kin4. J. Cell Biol. 2011, 193, 1033–1048. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Geymonat, M.; Spanos, A.; Walker, P.A.; Johnston, L.H.; Sedgwick, S.G. In vitro regulation of budding yeast Bfa1/Bub2 GAP activity by Cdc5. J. Biol. Chem. 2003, 278, 14591–14594. [Google Scholar] [CrossRef] [Green Version]
- Caydasi, A.K.; Pereira, G. Spindle alignment regulates the dynamic association of checkpoint proteins with yeast spindle pole bodies. Dev. Cell 2009, 16, 146–156. [Google Scholar] [CrossRef] [Green Version]
- Gryaznova, Y.; Caydasi, A.K.; Malengo, G.; Sourjik, V.; Pereira, G. A FRET-based study reveals site-specific regulation of spindle position checkpoint proteins at yeast centrosomes. Elife 2016, 5, e14029. [Google Scholar] [CrossRef]
- Longtine, M.S.; McKenzie, A., 3rd; Demarini, D.J.; Shah, N.G.; Wach, A.; Brachat, A.; Philippsen, P.; Pringle, J.R. Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 1998, 14, 953–961. [Google Scholar] [CrossRef]
- Janke, C.; Magiera, M.M.; Rathfelder, N.; Taxis, C.; Reber, S.; Maekawa, H.; Moreno-Borchart, A.; Doenges, G.; Schwob, E.; Schiebel, E.; et al. A versatile toolbox for PCR-based tagging of yeast genes: New fluorescent proteins, more markers and promoter substitution cassettes. Yeast 2004, 21, 947–962. [Google Scholar] [CrossRef]
- Sung, M.K.; Huh, W.K. Bimolecular fluorescence complementation analysis system for in vivo detection of protein-protein interaction in Saccharomyces cerevisiae. Yeast 2007, 24, 767–775. [Google Scholar] [CrossRef]
- Sambrook, J.; Russell, D.W. Molecular Cloning: A Laboratory Manual, 3rd ed.; Cold Spring Harbor Laboratory Press: Long Island, NY, USA, 2001. [Google Scholar]
- Peng, T.; Thorn, K.; Schroeder, T.; Wang, L.; Theis, F.J.; Marr, C.; Navab, N. A BaSiC tool for background and shading correction of optical microscopy images. Nat. Commun. 2017, 8, 14836. [Google Scholar] [CrossRef]
- Konig, C.; Maekawa, H.; Schiebel, E. Mutual regulation of cyclin-dependent kinase and the mitotic exit network. J. Cell Biol. 2010, 188, 351–368. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pereira, G.; Hofken, T.; Grindlay, J.; Manson, C.; Schiebel, E. The Bub2p spindle checkpoint links nuclear migration with mitotic exit. Mol. Cell 2000, 6, 1–10. [Google Scholar] [CrossRef]
- de Los Santos-Velazquez, A.I.; de Oya, I.G.; Manzano-Lopez, J.; Monje-Casas, F. Late rDNA condensation ensures timely Cdc14 release and coordination of mitotic exit signaling with nucleolar segregation. Curr. Biol. 2017, 27, 3248–3263. [Google Scholar] [CrossRef] [PubMed]
- Yeh, E.; Skibbens, R.V.; Cheng, J.W.; Salmon, E.D.; Bloom, K. Spindle dynamics and cell cycle regulation of dynein in the budding yeast, Saccharomyces cerevisiae. J. Cell Biol. 1995, 130, 687–700. [Google Scholar] [CrossRef] [Green Version]
- Scarfone, I.; Venturetti, M.; Hotz, M.; Lengefeld, J.; Barral, Y.; Piatti, S. Asymmetry of the budding yeast Tem1 GTPase at spindle poles is required for spindle positioning but not for mitotic exit. PLoS Genet. 2015, 11, e1004938. [Google Scholar] [CrossRef] [Green Version]
- Tong, A.H.; Lesage, G.; Bader, G.D.; Ding, H.; Xu, H.; Xin, X.; Young, J.; Berriz, G.F.; Brost, R.L.; Chang, M.; et al. Global mapping of the yeast genetic interaction network. Science 2004, 303, 808–813. [Google Scholar] [CrossRef] [Green Version]
- Drechsler, H.; Tan, A.N.; Liakopoulos, D. Yeast GSK-3 kinase regulates astral microtubule function through phosphorylation of the microtubule-stabilizing kinesin Kip2. J. Cell Sci. 2015, 128, 3910–3921. [Google Scholar]
- Chen, X.; Widmer, L.A.; Stangier, M.M.; Steinmetz, M.O.; Stelling, J.; Barral, Y. Remote control of microtubule plus-end dynamics and function from the minus-end. Elife 2019, 8, e48627. [Google Scholar] [CrossRef]
- Carvalho, P.; Gupta, M.L., Jr.; Hoyt, M.A.; Pellman, D. Cell cycle control of kinesin-mediated transport of Bik1 (CLIP-170) regulates microtubule stability and dynein activation. Dev. Cell 2004, 6, 815–829. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.; Luo, G.; Bahk, Y.Y.; Song, K. Cdc5-dependent asymmetric localization of Bfa1 fine-tunes timely mitotic exit. PLoS Genet. 2012, 8, e1002450. [Google Scholar] [CrossRef] [Green Version]
- Khmelinskii, A.; Lawrence, C.; Roostalu, J.; Schiebel, E. Cdc14-regulated midzone assembly controls anaphase b. J. Cell Biol. 2007, 177, 981–993. [Google Scholar] [CrossRef] [PubMed]
- Hotz, M.; Leisner, C.; Chen, D.; Manatschal, C.; Wegleiter, T.; Ouellet, J.; Lindstrom, D.; Gottschling, D.E.; Vogel, J.; Barral, Y. Spindle pole bodies exploit the mitotic exit network in metaphase to drive their age-dependent segregation. Cell 2012, 148, 958–972. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maekawa, H.; Usui, T.; Knop, M.; Schiebel, E. Yeast Cdk1 translocates to the plus end of cytoplasmic microtubules to regulate bud cortex interactions. EMBO J. 2003, 22, 438–449. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Strains | Genotype | Source |
---|---|---|
W303 | MATa ade2-1 ura3-1 trp1-1 leu2-3,112 his3-11,15 can1-100 | S. Elledge |
YSK3278 | W303a bar1 GFP-TUB1::URA3 (pAFS125) | This study |
YSK3279 | W303a bar1 Δbfa1::KanMx6 GFP-TUB1::URA3 (pAFS125) | This study |
YSK3302 | W303a bar1 Δbub2::KanMx6 -GFP-TUB1::URA3 (pAFS125) | This study |
YSK556 | W303a tem1-3 GFP-TUB1::URA3 (pAFS125) | Laboratory stock |
YSK553 | W303a cdc15-2 GFP-TUB1::URA3 (pAFs125) | Laboratory stock |
YSK3322 | cdc15-2 GFP-TUB1::URA3 (pAFs125) Δkip2::KanMx6 | This study |
YSK3254 | dbf2-2 Δdbf20::TRP1 GFP-TUB1::URA3 (pAFs125) | This study |
YSK3283 | W303a bar1 KIP2-VC::TRP1 | This study |
YSK3284 | W303a bar1 KIP2-VC::TRP1 BIK1-VN::HIS3 | This study |
YSK3150 | W303a bar1 BFA1-VN::HIS3 | This study |
YSK3304 | W303a bar1 BIM1-VC::TRP1 BFA1-VN::HIS3 | This study |
YSK3359 | W303a bar1 BIM1-VC::TRP1 BFA1-VN::HIS3 SPC42-CFP-KAN | This study |
YSK3360 | W303a bar1 BIM1-VC::TRP1 BFA1-VN::HIS3 pRS306-mCherry-TUB1 | This study |
YSK3361 | W303a bar1 BIM1-VC::TRP1 BFA1-VN::HIS3 Δbub2::KAN | This study |
YSK3268 | W303a bar1 Δbfa1::KanMx6 KAR9-9myc::hphNT1 | This study |
YSK3269 | W303a bar1 Δbfa1::KanMx6 KAR9-9myc::hphNT1 BIM1-3HA::HIS5 | This study |
YSK3243 | W303a bar1 Δbfa1::KanMx6 KIP2-9myc::hphNT1 | This study |
YSK3244 | W303a bar1 Δbfa1:: KanMx6 KIP2-9myc-hphNT1 BIM1-3HA::HIS5 | This study |
YSK3434 | W303a bar1 GFP-TUB1::URA3(pAFs125) Δkip2:: KanMx6 | This study |
YSK368 | W303a bar1 | A.Amon |
YSK3344 | W303a bar1 Δkar9::KanMx6 | This study |
YSK3345 | W303a bar1 Δbim1::KanMx6 | This study |
YSK3346 | W303a bar1 Δkar3::KanMx6 | This study |
YSK3347 | W303a bar1 Δcik1::KanMx6 | This study |
YSK3348 | W303a bar1 Δkip2::KanMx6 | This study |
YSK3349 | W303a bar1 Δbik1::KanMx6 | This study |
YSK1610 | cdc14-1 Δbfa1::hphNT1 MOB1-GFP::KAN | Laboratory stock |
YSK3424 | W303a Δbfa1::HIS3 Δbub2::URA3 MOB1-GFP::KAN | This study |
YSK3356 | W303a bar1 Δdyn1::LEU2 | This study |
YSK3421 | W303a bar1 Δdyn1::LEU2 BFA1-D16-3HA::HIS3 | This study |
YSK1133 | W303a bar1 Δbfa1::KanMx6 Δdyn1::LEU2 | Laboratory stock |
YSK1879 | W303a Δbfa1::HIS3 Δbub2::KAN | Laboratory stock |
YSK3270 | W303a bar1 Δbfa1::KanMx6 | This study |
YSK3435 | BY4741 Δspc72::KanMx6 | Laboratory stock |
YSK3422 | W303a bar1 Δbfa1::KanMx6 pRS304-BFA1-3HA | This study |
YSK3423 | W303a bar1 Δ bfa1::KanMx6 pRS304-BFA1-D16-3HA | This study |
YSK3444 | W303a bar1 Δbfa1::KanMx6 Δdyn1::LEU2 pRS304-BFA1-3HA | This study |
YSK3445 | W303a bar1 Δbfa1::KanMx6 Δdyn1::LEU2 pRS304-BFA1-D16-3HA | This study |
YSK2115 | W303a bar1 Δdyn1::LEU2 Δbfa1::KAN Δkin4::hphNT1 | Laboratory stock |
YSK3446 | W303a bar1 Δdyn1::LEU2 Δbfa1::KAN Δkin4::hphNT1 pRS304-BFA1-3HA | This study |
YSK3447 | W303a bar1 Δdyn1::LEU2 Δbfa1::KAN Δkin4::hphNT1 pRS304-BFA1-D16-3HA | This study |
YSK3451 | W303a cdc15-2 Δbfa1::HIS5 TEM1-RFP::KAN GFP-TUB1::URA3 (pAFs125) | This study |
YSK2874 | W303a bar1 Δbfa1::KAN pRS304-mCherry-TUB1 (pAK010-1) | Laboratory stock |
YSK3448 | W303a Δbfa1::HIS3 Δbub2::URA3 MOB1-GFP::KAN pRS304-mCherry-TUB1 (pAK010-1) | This study |
Plasmid | Source |
---|---|
pMW(L)20- pGAL | Laboratory stock |
pMW(L)20- pGAL -BFA1 | Laboratory stock |
pMW(L)20- pGAL -BFA1-D16 | This study |
pMW(L)20- pGAL -BFA1-D8 | This study |
GFP-TUB1::URA3 (pAFs125) | Beth Lalonde |
pMW(L)20- pGAL -BUB2 | This study |
pMW(U)20-pGAL-GFP | Laboratory stock |
pMW(U)20-pGAL-GFP-BFA1 | This study |
pMW(U)20-pGAL-GFP-BFA1-D16 | This study |
pMW(U)20-pGAL | Laboratory stock |
pMW(U)20-pGAL-KIN4 | This study |
pMW(U)20-pGAL-SNU13 | This study |
pMW(U)20-pGAL-GFP-SNU13 | This study |
pRS304-BFA1-3HA | This study |
pRS304-BFA1-D16-3HA | This study |
pMW(L)20- pGAL -BFA12A | This study |
pMW(L)20- pGAL -BFA1-D162A | This study |
pRS306-mCherry-TUB1 | D. Liakopoulos |
pRS304-mCherry-TUB1 | E. Schiebel |
Constructs | Primername | Sequence | Restriction Site |
---|---|---|---|
pMW(L)20-pGAL-BFA1-D8 | KS1782 (Forward) | GCAGAGCTCATGAAGCAAAAATATTCTGAT | Sac I |
KS1783 (Reverse) | CCATGGATCCGCTAAAGGGCTAATCTTTTG | BamH I | |
pMW(L)20-pGAL-BFA1-D16 | KS1784 (Forward) | TTGAGCTCATGTCAATTAGGCCTCTCAC | Sac I |
KS1785 (Reverse) | CGCGGATCCCTAAGCTTTCCTGTTTGCGGT | BamH I | |
pMW(L)20- pGAL-BUB2 | KS1825 (Forward) | GCAGAGCTCATGACCTCAATTGAAGAT | Sac I |
KS1826 (Reverse) | CGCGCATGCTTACGGTATATATATGTC | Sph I | |
pMW(U)20-pGAL-SNU13 | KS2132 (Forward) | GATGAGCTCGGATGTCTGCCCCAAACCCAAA GGCT | Sac I |
KS2133 (Reverse) | GTCGGATCCTTAAATTAATAAAGTTTCAATCTTG | BamH I | |
pMW(U)20-pGAL-KIN4 | KS1970 (Forward) | GATGAGCTCGGATGGCTTCTGTACCTAAACG | Sac I |
KS1971 (Reverse) | GTCGGATCCTCAAACCCTCATGCTCCTTC | BamH I | |
pRS304-BFA1-3HA | KS1337 (Forward) | ACTGGTACCCGGAGCAAGAGATAGTCTGAG | Kpn I |
KS2140 (Reverse) | CTCACTAGTTCAGCACTGAGCAGCGTAATCT | Spe I | |
pRS304-BFA1-D16-3HA | KS1337 (Forward) | ACTGGTACCCGGAGCAAGAGATAGTCTGAG | Kpn I |
KS2140 (Reverse) | CTCACTAGTTCAGCACTGAGCAGCGTAATCT | Spe I | |
pMW(L)20-pGAL-BFA1S150A(or BFA1-D16 S150A) | KS1568 (Forward) | CCAAGGCTAAAGCAACCTAGAGCAATGATGGAATTGAAACCAAAA | NA |
KS1569 (Reverse) | TTTTGGTTTCAATTCCATCATTGCTCTAGGTTGCTTTAGCCTTGG | NA | |
pMW(L)20-pGAL-BFA1S180A(or BFA1-D16 S180A) | KS1570 (Forward) | AATTCTGTAAGATTTAAGAAAGCAATGCCTAACTTAGCTTTAGTT | NA |
KS1571 (Reverse) | AACTAAAGCTAAGTTAGGCATTGCTTTCTTAAATCTTACAGAATT | NA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, Y.; Song, K. The N-Terminal Domain of Bfa1 Coordinates Mitotic Exit Independent of GAP Activity in Saccharomyces cerevisiae. Cells 2022, 11, 2179. https://doi.org/10.3390/cells11142179
Li Y, Song K. The N-Terminal Domain of Bfa1 Coordinates Mitotic Exit Independent of GAP Activity in Saccharomyces cerevisiae. Cells. 2022; 11(14):2179. https://doi.org/10.3390/cells11142179
Chicago/Turabian StyleLi, Yan, and Kiwon Song. 2022. "The N-Terminal Domain of Bfa1 Coordinates Mitotic Exit Independent of GAP Activity in Saccharomyces cerevisiae" Cells 11, no. 14: 2179. https://doi.org/10.3390/cells11142179