Next Article in Journal
Hydroponic Production of Reduced-Potassium Swiss Chard and Spinach: A Feasible Agronomic Approach to Tailoring Vegetables for Chronic Kidney Disease Patients
Previous Article in Journal
Effect of Biochar and Irrigation on Soybean-Rhizobium Symbiotic Performance and Soil Enzymatic Activity in Field Rhizosphere
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Review

Breeding for Enhancing Legumovirus Resistance in Mungbean: Current Understanding and Future Directions

1
Department of Genetics and Plant Breeding, Banda University of Agriculture and Technology, Banda 20001, India
2
Department of Biotechnology, Institute of Biosciences and Biotechnology, Chhatrapati Sahu Ji Maharaj University, Kanpur 208024, India
3
Crop Improvement Division, ICAR-Indian Institute of Pulses Research, Kalyanpur-Kanpur 208024, India
4
Department of Entomology, Banda University of Agriculture and Technology, Banda 210001, India
5
Department of Plant Biotechnology, Banda University of Agriculture and Technology, Banda 210001, India
6
Department of Plant Pathology, Jawaharlal Nehru Krishi Vishva Vidhyalaya, Jabalpur 482004, India
7
Agri-Science Queensland, Department of Agriculture and Fisheries, Hermitage Research Facility, 604 Yangan Road, Warwick 4370, Australia
8
Department of Biotechnology, Yeungnam University, Gyeongsan 38541, Korea
*
Authors to whom correspondence should be addressed.
Agronomy 2019, 9(10), 622; https://doi.org/10.3390/agronomy9100622
Submission received: 4 August 2019 / Revised: 2 October 2019 / Accepted: 5 October 2019 / Published: 10 October 2019

Abstract

Yellow mosaic disease (YMD) affects several types of leguminous crops, including the Vigna species, which comprises a number of commercially important pulse crops. YMD is characterized by the formation of a bright yellow mosaic pattern on the leaves; in severe forms, this pattern can also be seen on stems and pods. This disease leads to tremendous yield losses, even up to 100%, in addition to deterioration in seed quality. Symptoms of this disease are similar among affected plants; YMD is not limited to mungbean (Vigna radiata L. Wilczek) and also affects other collateral and alternate hosts. In the last decade, rapid advancements in molecular detection techniques have been made, leading to an improved understanding of YMD-causing viruses. Three distinct bipartite begomoviruses, namely, Mungbean Yellow Mosaic India Virus (MYMIV), Mungbean Yellow Mosaic Virus (MYMV), and Horsegram Yellow Mosaic Virus (HgYMV), are known to cause YMD in Vigna spp. Vigna crops serve as an excellent protein source for vegetarians worldwide; moreover, they aid in improving soil health by fixing atmospheric nitrogen through a symbiotic association with Rhizobium bacteria. The loss in the yield of these short-duration crops due to YMD, thus, needs to be checked. This review highlights the discoveries that have been made regarding various aspects of YMD affecting mungbean, including the determination of YMD-causing viruses and strategies used to develop high-yielding YMD-resistant mungbean varieties that harness the potential of related Vigna species through the use of different omics approaches.

1. Introduction

Mungbean, or green gram (Vigna radiata L. Wilczek), is one of the most important commercial Vigna species, and its production has been steadily increasing in South and Southeast Asia. It is a very popular legume due to its short life cycle, high growth rate, and its use in numerous food recipes [1]. It has wide adaptability and low input requirements; moreover, it has the ability to fix atmospheric nitrogen into the soil through a symbiotic association with Rhizobium, which improves the soil health and enhances the yield of subsequently planted crops [2]. This crop has valuable nutritional and health benefits, especially in developing countries where malnutrition is a major issue. It represents a cheap source of vegetable proteins. Aside from its nutritional value, certain characteristics of mungbean have led to its consideration as a model leguminous plant. These include its small genome size [3], short life cycle, capacity to self-pollinate, and its close genetic relationship to other legumes. After the recent release of its assembled sequence, its genomic data has been widely used [3]. Various types of biotic and abiotic stresses cause severe yield loss to this crop [4]. Among biotic stresses, more than a dozen viruses like Yellow Mosaic Virus (YMV), Urdbean Leaf Crinkle Virus (ULCV), Alfalfa Mosaic Virus (AMV), Bean Golden Yellow Mosaic Virus (BGYMV), Cowpea Yellow Mosaic Virus (CPMV), and Dolichos Yellow Mosaic Virus (DoYMV) affect the pulse crops [5]. Among these, Yellow Mosaic Disease (YMD) caused by different viruses is a major economic significance. YMD caused by Begomoviruses (family Geminiviridae, genus Begomovirus) has emerged as the major threat. This disease currently is a major hazard to the flourishing production of mungbean in India, Sri Lanka, Pakistan, Bangladesh, Papua New Guinea, Philippines, and Thailand [6,7,8,9]. YMD was first reported in lima bean (Phaseolus lunatus) in 1940 [10] and was subsequently discovered in other plants, such as Dolichos bean (Dolichos lablab) [11,12] and mungbean [13]. It creates malformations in mungbean plants, which in turn inhibit photosynthetic efficiency and plant growth, ultimately leading to significant yield losses [7,14,15]. Khattak et al. [16] reported that YMD might lead to up to 32%–78% reduction in grain yield of mungbean. However, yield loss is more severe when the disease appears at early growth stages and may even lead up to 100% yield loss [17]. Several approaches are adopted to manage YMD through the control of its vector, whitefly, such as the use of insecticide sprays and the application of different plant extracts; however, achieving 100% disease management remains very difficult. The wide host range, virus variation, and quantitative inheritance make it more challenging to breed YMD-resistant mungbean cultivars. Deploying resistant genotypes is an effective way to mitigate this disease. As such, there is a dire need to develop mungbean genotypes that are highly resistant to the specific viruses that cause YMD in them. In 2013, Panigrahi et al. [18] reviewed the recent development of molecular markers linked to YMD in Vigna species, identifying Yellow Mosaic Virus (YMV)-linked markers that are useful for urdbean (also known as black gram, Vigna mungo). Recently, Naimuddin et al. [19] reviewed the current status of YMD in both mungbean and urdbean. They summarized the information on virus history, disease transmission, Polymerase Chain Reaction (PCR)-based virus species detection, and the management of YMV through various approaches, such as cultural practices, integrated nutrient management (INM), integrated disease management (IDM), integrated pest management (IPM), and deployment of resistant genotypes.

2. Genome Organization of YMD-Causing Legumovirus

Based on their genomic organization, begomoviruses can be classified as either bipartite (having two DNA components, DNA-A and DNA-B) or monopartite (with a single-stranded DNA-A-like component) [20]. Through the molecular analysis of YMD-causing viruses, four bipartite viruses, viz., Mungbean Yellow Mosaic India Virus (MYMIV), Mungbean Yellow Mosaic Virus (MYMV), Horsegram Yellow Mosaic Virus (HgYMV), and Dolichos Yellow Mosaic Virus (DoYMV), were found as having close relationships with each other. Among them, MYMIV, MYMV, and HgYMV are known to cause YMD in mungbean and other Vigna crops in the Indian subcontinent [21,22], and they also affect the majority of legume crops [23], whereas infection of DoYMV is still limited to only Dolichos bean [19,24]. Begomoviruses multiply membrane-based barriers, including midgut epithelial cells, the apical plasmalemma of these cells, and the basal lamina of primary salivary glands [25] of whiteflies. They have geminate (twin) particles measuring 18–20 nm in diameter, apparently consisting of two incomplete icosahedra joined together in a structure consisting of 22 pentameric capsomeres and 110 identical protein subunits. These viruses are bipartite, having DNA-A and DNA-B components, and have genomes of about 2.7 Kb in size [26,27]. Both of their DNA components encode genes involved in replication, transcription activation, movement, and yellow mosaic symptom development [28,29,30,31,32]. Before 2015, it was believed that DoYMV is a monopartite virus, but recently, it was proven that it is also a bipartite virus [33]. Now, MYMIV, MYMV, HgYMV, and DoYMV are collectively termed as legume-infecting begomoviruses, i.e., “legumoviruses” [20], and can cause YMD in various pulses, including Vigna crops. However, MYMV, MYMIV, and HgYMV lead to YMD symptoms that are similar to those in mungbean; therefore, there is a need to confirm the specific virus(es) that lead to YMD development in mungbean, in order to accelerate the breeding of YMD-resistant genotypes [34]. Several DNA markers have been reported to be useful in detecting the presence of the specific virus leading to YMD development [35,36,37,38,39,40].

3. Host–Virus–Vector Interaction

YMD of mungbean is caused by different Begomovirus species (Legume Yellow Mosaic Viruses; LYMVs), transmitted by the polyphagous pest Bemisia tabaci in a persistent (circulative) manner, but not through the sap, seed, or soil. The insect vector and virus survive on different collateral and alternate hosts, including the main crop, which serves as the primary source of inoculum for yellow mosaic disease throughout the year (Figure 1).
The indigenous B. tabaci cryptic species Asia II-1 was predominantly found in Northern India, whereas Asia II-8 was predominantly found in southern India [41]. As whitefly has a latent period of less than four hours, the virus can be transmitted efficiently to the host by whitefly [13,42,43]. A single viruliferous adult can transmit the virus with an acquisition and inoculation access period of 24 h. The insect can obtain the virus after a single probe, and its transmission efficiency increases as it spends more time on the source plant of the virus as well as on the healthy mungbean plant [22]. The most efficient female and male adults in a population can retain their viruliferous nature for 10 and 3 days, respectively. Neither female nor male adults can retain infectivity throughout their life span. Nymphs of B. tabaci can acquire the virus from diseased leaves, but the virus does not pass through eggs of B. tabaci. The viral particles penetrate the gut membranes and invade the hemolymph by crossing the epithelial cells of the whitefly digestive tract, which serves as a bridge between the gut lumen and the hemolymph that circulates around the body cavity surrounding the various insect organs. Viral particles reach the salivary glands and finally enter the salivary duct, from where they are ingested together with the saliva. Translocation of Begomoviruses from the digestive tract to the hemolymph and from the hemolymph to the salivary gland is thought to be mediated by still-unidentified receptors. The findings of Wei et al. [44] demonstrated that whitefly primary salivary glands, in particular, have cells around the secretory region that control the specificity of Begomovirus transmission. Extensive studies on host–virus–vector interaction have been carried out by several groups [45,46,47]. Some of these reports suggest the seed-borne nature of MYMV in urdbean [48] and mungbean [6], but the transmission of MYMIV and HgYMV through seeds has not yet been reported. Naimuddin et al. [19] performed a study on seed transmission of MYMV using the infected seeds of a mungbean cultivar, T44; however, they did not detect any yellow mosaic symptoms and were also unable to detect the presence of virus using PCR primers. They observed that YMD couldn’t be transmitted by seeds because of the active release and high concentration of endonucleases in seeds during the germination period, which are unfavorable to the YMD-causing DNA viruses, as they cannot survive at high concentrations of endonucleases. Likewise, sap inoculation as a means of YMD transmission had been ruled out by Nair [45].

4. Host Range and Disease Symptoms

Aside from mungbean, these YMD-causing viruses have adopted a wider range of hosts and consequently are able to survive on various alternate and collateral hosts. The alternate and collateral hosts of LYMVs are listed below (Table 1).
The first visible symptom of YMD is the appearance of yellow and green irregularly shaped areas on the infected leaves of the host plants. The leaf size is gradually reduced, which is followed by complete yellowing and drying (Figure 2). The number of flowers and pods in severely infected plants also become drastically reduced. Another symptom is that infected plants produce fewer pods with small and shriveled seeds [64].

5. Host-Pathogen Resistance

Due to the involvement of whitefly in spreading YMD from plant to plant, the population load of whitefly and its feeding behavior are important. Studies on the different aspects of YMD-causing viruses, host plants, and vector behavior may aid in developing disease mitigation strategies.

5.1. Physical Basis of Resistance

Identification of plant morphology may be made to manage the whitefly population and to aid the development of non-preferable cultivars. These traits may help in managing diseases that are transmitted by insect vectors. The morphological features of these crops may inhibit the feeding and oviposition of the vector(s). Hairiness is one of these inhibitory features that may be utilized in developing insect-resistant varieties of crops [65,66]. Long and dense hairs may help to reduce the whitefly infestation, which results in the low infection of YMD. Thus, it will be very interesting to transfer the hairiness phenotype into YMD-susceptible cultivars in an attempt to develop insect-resistant varieties. Fatokun and Singh [67] reported that wild accessions of Vigna spp., including V. pubescens, confer some degree of insect resistance in cowpea. Likewise, many researchers also worked on the hairiness trait and reported the possibility of developing insect-resistant varieties in various crops, viz., urdbean [68], cowpea [66], alfalfa (Medicago sativa) [69], and soybean [70]. Singh et al. [71] studied the hair density in mungbean plant parts, but they did not test the effect of hair density toward conferring insect-resistance or on the disease. Comprehensive research on hairiness is required in order to obtain a deeper understanding of the genetics involved, and its subsequent incorporation into related wild Vigna species. Moreover, the effects of hairiness on behavior, oviposition, and the whitefly life cycle will give more comprehensive ideas on preventing YMD transmission.
Inbar and Gerling [72] studied leaf characteristics, along with certain constitutive and induced chemical profiles (i.e., defensive and nutritional elements), that are involved in the regulatory mechanism of whitefly. One of the important resistance factors is the presence of trichomes, which potentially affects adult insect oviposition and immature insect attachment. Feeding of whiteflies may vary depending on the angle of trichome to the leaf surface, as well as varying based on leaf color, length, and plant variety [73]. Leite et al. [74] reported a non-occurrence of oviposition by B. tabaci on the apical leaves of eggplant with high trichome density. A significant negative correlation between the number of leaf hairs per unit area and whitefly count has also been reported in pumpkin [75]. On the contrary, several authors have found that in cotton, the trichome density was positively correlated with the whitefly population [76,77]. Whitefly-resistant genotypes of mungbean possess thinner leaf lamina in comparison to susceptible genotypes [78]. A positive correlation between leaf trichome density and resistance to B. tabaci was also recorded in black gram [79]. Cotton Leaf Curl Virus (CLCuV)-resistant cotton cultivars were reported to have high epicuticular wax content on their leaves as compared to susceptible cultivars [80]. Young leaves of cotton have stem terminals with a high number of trichomes compared to those of older leaves; moreover, it was also reported that young leaves were infested with few silver leaf whitefly eggs, nymphs, and adults [81]. Similarly, a negative correlation between leaf trichomes and the whitefly population was reported in brinjal [82].

5.2. Biochemical Basis of Resistance

Wynd [83], Selman et al. [84], Bozarth and Diener [85], and Chhabra et al. [86,87] performed studies on peach, tomato, tobacco, mungbean, and urdbean. They recorded significant differences in reducing and non-reducing sugars, total phenols, and free amino acids between virus-infected and virus-free plants. Biochemical analysis of the contents of the resistant genotypes revealed that the percentages of reducing and non-reducing sugars and amino acids in the resistant genotypes were significantly higher compared to those of the susceptible genotypes [88].
A higher amount of total phenols was observed in black gram cultivars resistant to MYMV than in susceptible cultivars [87]. Thind et al. [89] reported an increased amount of total phenols in MYMV-infected mungbean compared to that in healthy plants. An increase of total phenols was observed in YMV-infected resistant and susceptible soybean cultivars compared to healthy cultivars [90]. Likewise, high phenolic content was also observed in yard long beans (Vigna unguiculata ssp. sesquipedalis) infected with MYMV [91]. Mali et al. [92] reported a significant increase in total phenols with an increased level of YMV infection in moth bean. Infection with YMD, in general, tends to decrease total protein content in susceptible mungbean. Total protein content was observed to be higher in the healthy leaves of YMV-resistant urdbean varieties than in the highly-susceptible and susceptible varieties [93]. Total soluble proteins increased with increasing levels of YMV infection in YMV-susceptible moth bean [92] and mungbean genotypes [94].
A significant reduction in chlorophyll and carotenoids has been reported in black gram and moth bean plants infected with MYMV, but the reduction in total chlorophyll was higher in susceptible genotypes [92,95]. Thind et al. [89] recorded a decrease in total chlorophyll content in MYMV-infected mungbean plants compared to healthy plants. A reduced amount of chlorophyll was observed in the MYMV infected mungbean cultivar ML-267 [96]. Sinha and Srivastava [94] reported low levels of total chlorophyll, chlorophyll a and b, in MYMV-infected mungbean plants than in the healthy plants. Total chlorophyll, as well as chlorophyll a and b, were higher in healthy yard long bean compared to MYMV-infected plants [91]. Hemida [97] reported a reduction of photosynthetic pigments in broad bean (Vicia faba) and common bean (P. vulgaris) infected by the Bean Yellow Mosaic Virus. Increased peroxidase (PO) and PPO activities were recorded in MYMV-infected cultivars of mungbean, H45 (susceptible), and LM 170 (resistant).
YMD-resistance in plants may be altogether attributed to obstruction of viral invasion in the plant cell wall, restriction in viral DNA replication, and early onset of antioxidant defense responses. Chakraborty and Basak [59] observed that the accumulation levels of the early as well as late expressed genes/transcripts of MYMIV were low and high in the resistant and susceptible plants, respectively; whereas an opposite response was exhibited by membrane stability index (MSI). A decrease in the malondialdehyde levels along with an increase in the activities/levels of different antioxidant enzymes, total phenol, and H2O2 was also noted during the early stages of infection in the resistant plants, which acts in various signaling pathways by activating the defense-related genes, which in turn leads to local or systemic resistance. Accumulation of ROS prevents the invading of the pathogen by cross-linking with lignin, proteins, and phenolic compounds [98], which leads to an oxidative burst of the invading pathogen [99]. It also leads to distortion of the plasma membrane and causes nucleic acid degradation. Likewise, phenols are converted to defensive substances, which restrict the invasion of pathogens [100] and lead towards enhancing host resistance. The inhibition of ac1 and ac2 genes have been observed in resistant urdbean plants indicating the defensive mechanism against virus pathogen [59].

5.3. Genetic Basis of Resistance

Before the genomic era, several conventional studies suggested the monogenic inheritance of YMD resistance [101,102,103,104,105,106], with modifiers [68,107,108]. The involvement of complementary recessive genes, as well as the effects of digenic inhibitory gene interaction in governing resistance, have also been reported [104,108,109,110,111,112]. However, the successful development of YMD-resistant varieties through conventional approaches is still difficult due to the complex mechanisms behind YMD resistance [113]. The inheritance of different LYMVs is listed in Table 2.
As YMD is a vector-transmitted disease, field screening of the breeding materials may sometimes be misleading due to the high variability in the causal viruses. In this situation, YMD-linked markers can be proven as being more useful for varietal screening and early generation selection against virus-specific YMD. Before the availability of the whole-genome sequences of the YMD-causing viruses, the disease was simply known as “yellow mosaic disease.” Several researchers used common terms, such as YMD or MYMV, to describe the disease without the proper molecular detection of virus species [117]. The genome sequences clearly distinguished between these disease-causing viruses. Therefore, the diagnosis of a specific virus that leads to YMD development, and the cross-talk that occurs among these viruses requires special attention. Several attempts have been made to tag markers needed to accelerate the marker-assisted breeding (MAB) program in Vigna. The molecular evidence suggests the involvement of quantitative trait loci (QTLs) in governing MYMIV-resistance in mungbean. To date, seven QTLs associated with four linkage groups, namely, LG2, LG4, LG6, and LG9, have been identified as being involved in MYMIV-resistance in mungbean [17,112]. The involvement of a single dominant gene in governing MYMIV-resistance in black gram [118] and soybean [119] have been reported. Likewise, the single monogenic inheritance of MYMV-resistance has also been reported by Singh and Patel [101], Sandhu et al. [120], Malik et al. [102,121], Malik [122], Saleem et al. [103], and Khattak et al. [16]. The involvement of two recessive genes in MYMV-resistance in mungbean has also been reported [123,124]. A recent report by Sai et al. [51] indicated the monogenic inheritance pattern of MYMV-resistance in mungbean. Finally, several groups have attempted to tag the resistance gene and develop linked primers to accelerate MAB in mungbean and its related Vigna species.

6. Breeding Strategies for Enhancing LYMV Resistance

6.1. Pathogen Identification

After the availability of the whole-genome sequences of LYMVs, several PCR-based diagnostic markers have been developed to diagnose the specific virus leading to YMD, which is helpful in detecting and determining the virus species that lead to YMD development (Table 3). ICAR-Indian Institute of Pulses Research, Kanpur, India has developed a specific virus detection kit, which is able to simultaneously detect the presence of all four legumoviruses, i.e., MYMIV, MYMV, HgYMV, and DoYMV [35,36].
Furthermore, these four YMD-causing LYMVs are well characterized, and their sequence information is available in the public domain. Based on sequence information, we can try to get restriction maps and use different combinations of enzymes to see the differential pattern obtained from these YMD-causing viruses to confirm the causal species. For example, XbaI is the non-cutter of the DoYMV genome, and complete digestion of DNA with XbaI will give an idea about the presence or absence of DoYMV, while subsequently confirming the presence of the other three viruses. Likewise, PmeI, a cutter of MYMIV, but non-cutter of MYMV, can confirm the absence of the MYMV genome. Similarly, another enzyme HindIII can also be used, which is a single cutter of MYMIV and a multiple cutter of HgYMV. In this case, the presence of a single linear fragment indicates a MYMIV infection, whereas the appearance of multiple fragments indicates HgYMV as the cause of YMD development. PCR-based detection and restriction digestion analysis will help in detecting the virus species that lead to YMD and, thus, help in developing virus-specific YMD-resistant cultivars (Figure 3).
In addition, many more techniques have been made available to detect the virus. Suruthi et al. [12] suggested using of DAS-ELISA for detection of the virus. Based on the results of DAS-ELISA, they reported the seed-borne nature of DoYMV. Similarly, DAS-ELISA and immunosorbent electron microscopy have been performed to detect the presence of virus particles by Kothandaraman et al. [125] in black gram.

6.2. Effective Phenotyping Procedure

There are various methods adopted by several researchers for screening germplasm for disease resistance. The infector-row technique is routinely used for screening the germplasm against diseases under natural conditions. Singh et al. [117], Bhanu et al. [126], Suman et al. [127], Deepa et al. [50], Nair et al. [41], and Khaliq et al. [128] screened mungbean genotypes for YMV-resistance under natural conditions. The infector-row technique, grafting, and sap inoculation technique has also been demonstrated in Dolichos against the DoYMV [129]. Some of the researchers focused on the force-feeding methods for YMV screening [130]. Malathi and John [22] stated that viruliferous adults are more suitable for virus transmission due to their high transmission efficiency. Moreover, female adults are more efficient than males in spreading YMD [46].
The environmental conditions such as temperature, humidity, and rainfall also affect the life cycle of the whitefly as well as its disease inoculum load [21,131,132,133], therefore, the multiplication of whitefly in controlled conditions is more effective. This method also provides the natural environment and ideal condition for host–virus interaction. Nevertheless, the major limitation of the natural condition is that the appearance of the disease is highly affected by the environment as well as the population load of the insect vector. As for the transmission of LYMVs only through whitefly, the presence of primary inoculum on the alternate and collateral hosts is required for the dispersion of disease through the insect vector. It is also challenging to maintain the purity of the virus strain under the natural condition, as we know that the viruses have very high mutability, which leads to the evolution of new plant viruses in legumes [21]. Therefore, developing an efficient artificial inoculation technique using specific virus(es) at an early stage will prove to be more useful in phenotyping plant materials against the specific virus and breeding for enhanced resistance. Ariyo et al. [134] used wedge grafting, biolistic inoculation of total DNA extracted, and biolistic inoculation of the cloned virus DNA A+B genomic components to test virus transmission in cassava. Jamsari et al. [135] described a new, promising method, i.e., an injection technique for transmission of Geminivirus in chili, but they reported a maximum of 53% disease expression. They also documented other artificial techniques such as grafting [136,137], mechanical infection via wounding [138], agro-inoculation [139,140], and particle bombardment [141] for the transmission of DNA viruses. Due to the herbaceous nature of mungbean, the inculcation of viruses through grafting is very tedious. Injection techniques may require standardization to achieve easy inoculation. For the screening of breeding lines against viruses, the agro-inoculation methods are now gaining popularity because of their ability to easily incorporate a specific virus into the plant system [142]. This method provides a means to avoid the presence of multiple viruses and assures the presence of a specific pathogen of LYMV. Several researchers developed the agro-infectious clones of specific virus(es) and successfully used these to screen various pulses (Table 4). To supplement further, the studies of Kartikeyan [143,144] and Bashir [145] suggested molecular markers that can be used for the indirect selection of resistant mungbean genotypes.

6.3. Durable Sources of LYMV Resistance

Tagging the source for resistance to any of the biotic and abiotic stresses is essential in order to get breed resistant cultivars. Several methods for identifying and characterizing resistance sources are now available. Phenotyping is the most important step in identifying donors for resistance. However, due to the vector transmission of LYMVs, it is very difficult to screen the breeding materials or genotypes under natural climatic conditions. Conditions like temperature, humidity, wind, and velocity affect whitefly multiplication and movement, which may cause uneven population load and distribution of whitefly over the crop population. The whitefly population also depends upon the alternate and collateral hosts present in the nearby the experimental field. Sometimes, the whitefly may also spread more viruses at the same time, which can affect the target virus multiplication into the plant system and affect YMD expression. Therefore, artificial screening techniques are more useful in generating the appropriate data to tag the true resistance source(s) for the specific virus(es) leading to YMD development. Previously, most of the researchers, such as Singh et al. [117], used the spreader row technique to create sufficient inoculum loads that are used to screen the mungbean genotypes for YMD resistance. Some of the researchers [153,154] have emphasized multi-environment screening of the germplasm to discover the YMD-resistant genotypes. Because of constraints in natural screening and the chances of mixed infection, implementing an artificial screening technique is strongly needed to mitigate this issue. Several groups, including Jacob et al. [147], Gupta et al. [118], Sudha et al. [15], and Sai et al. [51], have used artificial screening techniques combined with agro-inoculation for the strict screening of breeding material against the specific YMD-causing viruses. In our opinion, agro-inoculation coupled with the spreader row and force-feeding techniques will give more precise information about the true resistant genotypes by confirming all the involved parameters, like the susceptible host, natural environment, and the presence of virus and vector. The development of resistant cultivars is the most efficient and economical way to manage YMD. Some efforts have been made towards the identification of resistant donors in mungbean [43,155], black gram [156,157], soybean [95], and cowpea [158]. Some of the wild relatives of mungbean, such as some accessions of V. radiata var. sublobata [159], V. trilobata [160], V. mungo, and V. umbellata [160], have been reported as resistant to YMD.

6.4. Exploiting LYMV-Linked Markers and QTLs

Before the release of the mungbean genome, the researchers frequently identified the transferable markers from other Vigna backgrounds and used these to detect genetic variation and for the mapping of several important mungbean traits, including YMD [161,162,163]. To date, seven QTLs have been reported for MYMIV resistance in mungbean, whereas none of the QTL involvement was detected for MYMV-resistance, which indicates a possibly monogenic inheritance pattern of the MYMV resistant gene. After the genome sequence of mungbean, it has been easier to design primer pairs based on the whole genome in order to detect the novel QTLs governing MYMIV resistance. This gives a clear idea about the location of QTLs involved in YMD resistance. All the QTLs for mungbean were detected by linkage analysis using cultivated mungbean genotypes. Nevertheless, we also need to adopt other approaches, such as association mapping, to detect more QTLs for multi-virus YMD resistance over the natural mungbean population. For broadening the genetic base of mungbean and for the development of highly resistant genotypes, we also need to study the inheritance of YMD resistance using some of its interspecific and wild relatives as a donor. This will aid in detecting the novel QTLs and enhancing the level of resistance for mungbean breeding. Tagging of those genes will accelerate the marker-assisted breeding with special attention to YMD resistance.
The development and identification of tightly linked markers will help in the indirect selection of material for breeding and enable the precise introgression of resistant genes required to develop the LYMV-resistant genotypes. Several research groups have attempted to tag the resistance gene and develop linked primers to accelerate MAB in mungbean and urdbean. The CYR1 marker is reported as completely linked to MYMIV-resistance, whereas YR4 is partially linked to MYMIV-resistance in mungbean and urdbean [14]. Likewise, RGA-1 [164], CEDG180 [118], ISSR811 [165], and YMV1 [166] were reported as tightly linked to MYMIV resistance in urdbean, whereas the linkage of these markers with MYMIV-resistance gene in mungbean is not observed. Identification of more tightly linked markers for MYMIV, MYMV, and HgYMV resistance is, therefore, required. After the validation of these linked markers, they may be used in marker-assisted breeding programs for developing LYMV-resistant genotypes. The scarcity of studies on the genetics and genomics of HgYMV has led to the development of YMD research in mungbean, which opens the door for researchers to explore untapped areas. Attention should also be placed on the development of linked markers to HgYMV-resistance.

6.5. Transcriptomics Approaches

Due to the large data size obtained from genomic tools, researchers are now shifting towards a transcriptomic approach, which provides a better understanding of the mechanisms behind the biotic and abiotic stress resistance. Expression profiling has now become a well-established and high-throughput method for acquiring quantitative information on a sample’s transcriptome and for studying differential gene expression. Reports on some of the differentially expressed transcripts in Vigna spp. against YMV are available. Chakraborty and Basak [59] studied the transcriptional modifications in V. mungo during MYMIV resistance, as well as in susceptibility. They identified 145 and 109 differentially expressed transcripts in resistant and susceptible plants, respectively, through suppression subtractive hybridization. About 43% of the unique expressed sequence tags (ESTs) shared homology with G. max sequences, while 14%, 13%, and 9% of the ESTs showed homology with V. radiata, V. angularis, and P. vulgaris, respectively. They also observed major changes in the gene expression in resistant genotypes upon MYMIV infection in the jasmonic acid biosynthesis and signal transduction pathways, cell wall modifications, and metabolic pathways (Table 5). Likewise, Kundu et al. [167] found 345 candidate genes that illustrate differential expression during compatible or incompatible interactions. They categorized ESTs into nine different functional categories based on their putative functions. These ESTs involved in various metabolic pathways, such as glycolysis, showed upregulation in their expression. Since ESTs do not provide any quantitative estimation of gene expression, gene expression of selected ESTs through quantitative PCR will give more accurate information. Kundu et al. [167] studied 19 genes related to R-protein such as, the suppressor of the G2 allele of skp1 (SGT1) and heat shock protein 90 (HSP 90), systemic acquired resistance (SAR) indicator gene, pathogenesis-related (PR) genes, genes related to reactive oxygen species (ROS) homeostasis (superoxide dismutase (SOD), ascorbate peroxidase (APOX), thioredoxin (TRX), and metallothionein (MET)), signal transduction gene (such as calmodulin (CAM), and other genes like WRKY, glutathione S transferase (GST), phenylalanine ammonia lyase (PAL), ubiquitin ligase, tryptophan synthase (TS), cysteine protease (CSP), rubisco activase (RuAc), MADS box protein (MADS), auxin response factor (ARF), and oxygen-evolving complex (OEC)), at different time point intervals in both the resistant and susceptible cultivar of V. mungo against MYMIV. They also observed the coordinate action of salicylic acid-responsive pathways, Ca2+ signaling, redox imbalance, and PR genes. Chakraborty and Basak [59] functionally validated the differential expression of 12 different genes like phytohormone jasmonic acid, detoxification proteins, PR protein, ROS regulatory transcripts, and metabolic pathways for the systemic resistant response in MYMIV. In contrast, susceptible plants demonstrated a weak implementation of these pathways, differing in the induction kinetics and transcript dynamics of stress-responsive genes (Table 5). Kundu et al., [167] demonstrated about a 9-fold change in the expression of Arabidopsis thaliana mitogen-activated protein kinase (AtMAPK6) at 12 h post-inoculation in the resistant background and observed a notable difference in its abundance in the MYMIV-infected resistant VMR84 strain, which suggests its participation in SA signaling. Maiti et al. [168] characterized the Non-TIR-NBS-LRR encoding candidate gene CYR1, which is tightly associated with MYMIV-resistance in urdbean. Yadav et al. [169] also identified the LRR LIKE-PROTEIN KINASE gene as MYMIV-resistance in soybean. Likewise, Naresh et al. [170] characterized the NBS-LRR class disease resistance gene analogs leading to multi-virus resistance in chilli, indicating the need for deep analysis of NBS-LLR candidates for YMD-resistance in mungbean. These candidates will also help in developing gene-specific markers for resistance breeding.

6.6. Genome Editing Approaches

The Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) system, an adaptive immune system found in bacteria, has been successfully utilized by several researchers for the development of resistance to viruses. Prior to CRISPR, zinc finger nucleases (ZFNs) or transcription-activator-like effectors nucleases (TALENs) were traditionally used for genome editing, but these methods required a new nuclease pair for every genomic target region. CRISPR has rapidly become the most popular genome editing approach. This system contains two components: a guide RNA (gRNA) and a CRISPR-associated endonuclease (Cas protein). Thus, one can change the genomic target of the Cas protein by simply changing the target sequence present in the gRNA. CRISPR was employed to knock out target genes in various cell types, but modifications to various Cas enzymes have extended CRISPR to selectively activate/repress target genes, purify specific regions of DNA, and precisely edit DNA and RNA. Several works have successfully used genome-editing techniques against the Begomoviruses. There is a strong need to deploy this technique against the YMD-causing viruses as well.

7. Concluding Remarks and Future Prospects

It is evident that more than one virus species are involved in causing the yellow mosaic disease in Vigna crops, although, to our best knowledge, instances of mixed infections have not been reported. It may be due to the occurrence of different virus species causing YMD. However, the presence of multiple viruses causing different viral diseases in mungbean and urdbeen have been reported [172], indicating that the presence of multiple viruses causing YMD may cause more damage to mungbean. Keeping in mind the prevalence of different species of viruses in Vigna-cultivation areas and the complexity of host–vector–virus interactions, mapping these viruses is required as a top priority, aside from the continuous monitoring of YMD outbreaks in newer areas. Establishing the accurate identity of viruses at the molecular level should be a preferred approach in order to create an effective YMD management strategy. Aside from the molecular marker-based detection of the specific viruses causing YMD, the development of a set of differential hosts for the identification of different viruses will further help in the establishment of the viral identities at the field level and, consequently, aid in deploying a proper management strategy. Simultaneously, investigation on the virus evolution and co-evolution at definite time intervals are also required if any changes in symptoms and expression are observed. Once it is done, tagging and deployment of appropriate resistance genes will be the best strategy for combating YMD. For developing cultivars with a good level of resistance, we need to identify the genes/QTLs governing resistance towards specific viruses by using artificial screening procedures, and once these resistance genes/QTLs have been tagged, their pyramiding will be the best mitigation strategy (Figure 4).
Difficulties in reproducing the results of QTLs for specific resistance may pose additional challenges while breeding for YMD resistance. It may be due to the differential genetics of highly resistant donors used in the study, as well as the phenotyping procedures involved. Some researchers have been using a 0 to 5 numerical scale, whereas the others have been using a 0 to 9 scale to rate the disease. While most of the researcher’s report <5% of disease severity as highly resistant, some of the reports exhibit up to 10% disease severity as highly resistant. The use of different rating scales and disease severity percentages considered for selecting highly resistant genotypes can mislead researchers into utilizing the previously reported donors, as the currently available information seems to be unclear. The use of different plant stages (such as seedlings, flowering, and pod filling/maturity stage) for disease analysis can also be a source of confusion. Therefore, we need to develop a stage-specific universal scale for YMD screening to effectively utilize the identified HR-donors for YMD-resistance. The major role of the vector interaction causing YMD in the field also serves as a challenge to YMD-phenotyping under natural conditions. Thus, the development of an artificial screening procedure under laboratory conditions will save time and can better generate effective and authentic data for YMD. Pratap et al. [173] reviewed different platforms of high throughput phenotyping for harnessing the gains of genomics. Likewise, we need to deploy such platforms for strict phenotyping of YMD at different plant growth stages. The development of agro-infectious clones of LYMVs is a very tedious procedure due to the low concentration recovery of pure viral DNA after its cloning. Therefore, PCR-based cloning by using overlapping primers to develop dimeric agro-infectious clones for the respective virus will be an easier approach. Ferro et al. [174] have also developed the agro-infectious clones of a circular plant DNA virus by overlapping PCR-based amplification, and they have successfully validated this method on the mungbean.
Several wild Vigna accessions belonging to different species have been identified as showing a high level of resistance to the different YMD-causing virus species. Some of the researchers have successfully studied the gene flow from wild to cultivated Vigna, and they have noticed that there is enough opportunity to facilitate gene transfer. The resistant gene of YMD has been successfully incorporated into urdbean [175] and mungbean [176,177]. Likewise, Mathivatahana et al. [178] used rice bean as a donor for MYMV-resistance in mungbean. Sudha et al. [179] used the rice bean as MYMV-resistant donor for developing the cross-specific markers for resistance breeding. Sudha et al. [180] identified 24 accessions of rice bean as highly resistant donors for MYMV, which can be used in developing MYMV-resistance mungbean genotypes. Chen et al. [181] identified the QTLs for governing resistance to MYMIV in mungbean using V. radiata var. sublobata, a wild progenitor of mungbean. Pandiyan et al. [182] also studied the gene flow from several wild relatives of Vigna, i.e., V. radiata var. sublobata, V. silvestris, V. haniana, V. umbellata, V. glabrescense, V. pilosa, V. acconitifolia, V. stipulacia, V. trilobata, V. bournea, V. khandalensis, V. dalzelliana, into mungbean and noticed fertile hybrid generation, indicating the possibility of incorporating the important genes from wild species to elite cultivars. Furthermore, we need to study the gene flow and inheritance patterns and compare the data obtained between resistant and wild Vigna, including mungbean progenitor, non-progenitors, and susceptible mungbean cultivars. If any novel inheritance pattern (i.e., Oligogenic inheritance pattern) is observed between HR-wild and HS-mungbean, it will be easier to incorporate the candidate genes rather than pyramiding a large number of QTLs.
Lately, there have been impressive advancements in the development of genomic and transcriptomic resources. These resources can be effectively employed for the marker-trait association and QTL identification, as well as for contributing to the initiation of marker-assisted breeding and selection. Due to the large data size of the genome, it is very difficult to tag the specific region for resistance. Combining both genomic and transcriptomic approaches will be sounder in deploying the host plant with specific resistance, which appears to be the best strategy to manage this disease. In 2016, Liu et al. [183] successfully tagged the resistance locus and developed the tightly-linked marker for bruchid resistance in mungbean by harnessing the potential of wild relatives and combining genomic and transcriptomic approaches. Furthermore, there is also a need to explore plant innate immunity against the virus-vector to generate YMD-resistance in mungbean as an alternate way to induce resistance in mungbean plants. Characterizing NBS-LRR candidates in wild Vigna relatives will give a clue for understanding the mechanism of YMD-resistance. Harnessing the potential of wild/weedy and interspecific Vigna gene pools through genomics, transcriptomics, proteomics, and plant innate immunity approaches will be highly effective for identifying and tagging candidate genes for YMD resistance, as well as for determining their precise introgression in mungbean to develop high yielding multi-virus YMD-resistant mungbean cultivars.

Author Contributions

C.M.S. and A.P. conceived and designed the manuscript. C.M.S. and P.S. drafted the manuscript. P.S., S.P. and A.K.M. compiled the molecular aspects of the host-pathogen interaction. R.P., V. complied the disease symptomology, transmission and host-pathogen interaction aspects. All authors contributed fairly in writing the manuscript. C.A.D. and K.-H.B. edited the manuscript and modified the language of the manuscript as a final version. All authors read and approved the final version of the manuscript.

Funding

The Science and Engineering Research Board, New Delhi, India, financially supported this work to the first author under the Startup Research Grant for Young Scientist Scheme (YSS/2015/00484-LS). Further, the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (NRF-2019R1F1A1052625) also supported this work.

Acknowledgments

The authors acknowledge the contribution of and apologize to those authors whose excellent work could not be cited due to space limitations. The first author acknowledges ICAR-IIPR, Kanpur for allowing him to execute a part of this study in this Institute.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Singh, D.P.; Singh, B.B.; Pratap, A. Genetic improvement of mungbean and urdbean and their role in enhancing pulse production in India. Indian J. Genet. Plant Breed. 2016, 76, 550–567. [Google Scholar] [CrossRef] [Scilit]
  2. Jat, S.; Shivay, Y.; Parihar, C.M.; Meena, H. Evaluation of summer legumes for their economic feasibility, nutrient accumulation and soil fertility. J. Food Legum. 2012, 25, 239–242. [Google Scholar]
  3. Kang, Y.J.; Kim, S.K.; Kim, M.Y.; Lestari, P.; Kim, K.H.; Ha, B.-K.; Jun, T.H.; Hwang, W.J.; Lee, T.; Lee, J.; et al. Genome sequence of mungbean and insights into evolution within Vigna species. Nat. Commun. 2014, 5, 5443. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Ali, M.Z.; Khan, M.A.A.; Karim, M.M.; Ahmed, M.; Ahmed, F. Field performance of some mungbean varieties against Mungbean Yellow Mosaic Virus and Cercospora leaf spot diseases. J. Exp. Biosci. 2010, 1, 11–16. [Google Scholar]
  5. Ali, M.; Kumar, S. Advances in Mungbean and Urdbean; Kanpur Report; Indian Institute of Pulses Research: Kanpur, India, 2006; pp. 1–19. [Google Scholar]
  6. Honda, Y. Mechanical transmission, purification, and some properties of whitefly-borne mung bean Yellow Mosaic Virus in Thailand. Plant Dis. 1983, 67, 801–804. [Google Scholar] [CrossRef] [Scilit]
  7. Verma, A.; Dhar, A.K.; Mandal, B. MYMV transmission and control in India. In Proceedings of the Mungbean Yellow Mosaic Disease: Proceedings of an International Workshop, Taipei, Taiwan, 2–3 July 1991; pp. 8–27. [Google Scholar]
  8. Jones, D.R. Plant viruses transmitted by whiteflies. Eur. J. Plant Pathol. 2003, 109, 195–219. [Google Scholar] [CrossRef] [Scilit]
  9. Haq, Q.M.I.; Rouhibakhsh, A.; Ali, A.; Malathi, V.G. Infectivity analysis of a blackgram isolate of mungbean yellow mosaic virus and genetic assortment with MYMIV in selective hosts. Virus Genes 2011, 42, 429–439. [Google Scholar] [CrossRef] [Scilit]
  10. Capoor, S.P.; Varma, P.M. Yellow mosaic of Phaseolus lunatus L. Curr. Sci. 1948, 17, 152–153. [Google Scholar]
  11. Capoor, S.P.; Varma, P.M. A new virus disease of Dolichos lablab. Curr. Sci. 1950, 19, 248–249. [Google Scholar]
  12. Suruthi, V.; Nakkeeran, S.; Renukadevi, P.; Malathi, V.G.; Rajasree, V. Evidence of seed transmission of Dolichos Yellow Mosaic Virus, a begomovirus infecting lablab-bean in India. Virus Dis. 2018, 29, 506–512. [Google Scholar] [CrossRef] [Scilit]
  13. Nariani, T.K. Yellow mosaic of mung (Phaseolus aureus L.). Indian Phytopathol. 1960, 13, 24–29. [Google Scholar]
  14. Maiti, S.; Basak, J.; Kundagrami, S.; Kundu, A.; Pal, A. Molecular marker-assisted genotyping of Mungbean Yellow Mosaic India Virus resistant germplasms of mungbean and urdbean. Mol. Biotechnol. 2011, 47, 95–104. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Sudha, M.; Karthikeyan, A.; Nagarajan, P.; Raveendran, M.; Senthil, N.; Pandiyan, M.; Angappan, K.; Ramalingam, J.; Bharathi, M.; Rabindran, R. Screening of mungbean (Vigna radiata) germplasm for resistance to mungbean yellow mosaic virus using agroinoculation. Can. J. Plant Pathol. 2013, 35, 424–430. [Google Scholar] [CrossRef] [Scilit]
  16. Khattak, G.; Haq, M.A.; Ashraf, M.; Elahi, T. Genetics of Mungbean Yellow Mosaic Virus (MYMV) in mungbean (Vigna radiata L.) wilczek. J. Genet. Breed. 2000, 54, 237–243. [Google Scholar]
  17. Kitsanachandee, R.; Somta, P.; Chatchawankanphanich, O.; Akhtar, K.P.; Shah, T.M.; Nair, R.M.; Bains, T.S.; Sirari, A.; Kaur, L.; Srinives, P. Detection of quantitative trait loci for Mungbean Yellow Mosaic India Virus (MYMIV) resistance in mungbean (Vigna radiata (L.) Wilczek) in India and Pakistan. Breed. Sci. 2013, 63, 367–373. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Panigrahi, K.K.; Baisakh, B.; Mohanty, A. Recent developments on Yellow Mosaic Virus (YMV) and Mung bean Yellow Mosaic India Virus (MYMIV) resistance linked DNA markers in Vigna species—A review. Environ. Ecol. 2013, 32, 372–376. [Google Scholar]
  19. Naimuddin, M.A.; Singh, N.P. Yellow mosaic of mungbean and urdbean: Current status and future strategies. J. Food Legum. 2016, 29, 77–93. [Google Scholar]
  20. Briddon, R.; Patil, B.; Bagewadi, B.; Nawaz-ul-Rehman, M.; Fauquet, C. Distinct evolutionary histories of DNA-A and DNA-B components of bipartite begomoviruses. BMC Evol. Biol. 2010, 10, 97. [Google Scholar] [CrossRef] [Scilit]
  21. Qazi, J.; Ilyas, M.; Mansoor, S.; Briddon, R.O.B.W. Legume Yellow Mosaic Viruses: Genetically isolated begomoviruses. Mol. Plant Pathol. 2007, 8, 343–348. [Google Scholar] [CrossRef] [Scilit]
  22. Malathi, V.G.; John, P. Geminiviruses infecting legumes. In Characterization, Diagnosis and Management of Plant Viruses; Rao, G.P., Lava, K.P., Holguin-Pena, R.J., Eds.; Studium Press: Houston, TX, USA, 2008; pp. 97–123. [Google Scholar]
  23. Fauquet, C.M.; Stanley, J. Geminivirus classification and nomenclature: Progress and problems. Ann. Appl. Biol. 2003, 142, 165–189. [Google Scholar] [CrossRef] [Scilit]
  24. Maruthi, M.N.; Rekha, A.R.; Govindappa, M.R.; Colvin, J.; Muniyappa, V. A distinct begomovirus causes Indian Dolichos Yellow Mosaic Disease. Plant Pathol. 2006, 55, 290. [Google Scholar] [CrossRef] [Scilit]
  25. Hogenhout, S.A.; Ammar, E.-D.; Whitfield, A.E.; Redinbaugh, M.G. Insect vector interactions with persistently transmitted viruses. Annu. Rev. Phytopathol. 2008, 46, 327–359. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Pant, V.; Gupta, D.; Choudhury, N.R.; Malathi, V.G.; Varma, A.; Mukherjee, S.K. Molecular characterization of the Rep protein of the blackgram isolate of Indian Mungbean Yellow Mosaic Virus. J. Gen. Virol. 2001, 82, 2559–2567. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Borah, B.K.; Dasgupta, I. Begomovirus research in India: A critical appraisal and the way ahead. J. Biosci. 2012, 37, 791–806. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Gutierrez, C. Geminivirus DNA replication. Cell. Mol. Life Sci. 1999, 56, 313–329. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Hanley-Bowdoin, L.; Settlage, S.B.; Orozco, B.M.; Nagar, S.; Robertson, D. Geminiviruses: Models for plant DNA replication, transcription, and cell cycle regulation. CRC. Crit. Rev. Plant Sci. 1999, 18, 71–106. [Google Scholar] [CrossRef]
  30. Raghavan, V.; Malik, P.S.; Choudhury, N.R.; Mukherjee, S.K. The DNA-A component of a plant geminivirus (Indian Mung bean Yellow Mosaic Virus) replicates in budding yeast cells. J. Virol. 2004, 78, 2405–2413. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  31. Choudhury, N.R.; Malik, P.S.; Singh, D.K.; Islam, M.N.; Kaliappan, K.; Mukherjee, S.K. The oligomeric Rep protein of Mungbean Yellow Mosaic India Virus (MYMIV) is a likely replicative helicase. Nucleic Acids Res. 2006, 34, 6362–6377. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Singh, D.; Karjee, S.; Malik, P.; Islam, M.; Mukherjee, S. DNA replication and pathogenecity of MYMIV. In Communicating Current Research and Educational Topics and Trends in Applied Microbiology; Formatex: Badajoz, Spain, 2007; pp. 155–162. [Google Scholar]
  33. Akram, M.; Naimuddin; Agnihotri, A.K.; Gupta, S.; Singh, N.P. Characterisation of full genome of Dolichos Yellow Mosaic Virus based on sequence comparison, genetic recombination and phylogenetic relationship. Ann. Appl. Biol. 2015, 167, 354–363. [Google Scholar] [CrossRef] [Scilit]
  34. Brown, J.K.; Zerbini, F.M.; Navas-Castillo, J.; Moriones, E.; Ramos-Sobrinho, R.; Silva, J.C.F.; Fiallo-Olivé, E.; Briddon, R.W.; Hernández-Zepeda, C.; Idris, A.; et al. Revision of Begomovirus taxonomy based on pairwise sequence comparisons. Arch. Virol. 2015, 160, 1593–1619. [Google Scholar] [CrossRef] [Scilit]
  35. Naimuddin; Akram, M.; Sanjeev, G. Identification of Mungbean Yellow Mosaic India Virus infecting Vigna mungo var. silvestris L. Phytopathol. Mediterr. 2011, 50, 94–100. [Google Scholar]
  36. Naimuddin; Akram, M.; Pratap, A. First report of natural infection of Mungbean Yellow Mosaic India Virus in two wild species of Vigna. New Dis. Rep. 2011, 23, 21. [Google Scholar] [CrossRef] [Scilit]
  37. Naimuddin; Akram, M.; Gupta, S.; Agnihotri, A.K. Ageratum conyzoides harbours Mungbean Yellow Mosaic India Virus. Plant Pathol. J. 2014, 13, 59–64. [Google Scholar]
  38. Biswas, M.; Maqani, N.; Rai, R.; Kumaran, S.P.; Iyer, K.R.; Sendinc, E.; Smith, J.S.; Laloraya, S. Limiting the extent of the RDN1 heterochromatin domain by a silencing barrier and Sir2 protein levels in Saccharomyces cerevisiae. Mol. Cell. Biol. 2009, 29, 2889–2898. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Islam, M.; Sony, S.; Borna, R. Molecular characterization of mungbean yellow mosaic disease and coat protein gene in mungbean varieties of Bangladesh. Plant Tissue Cult. Biotechnol. 2012, 22, 73–81. [Google Scholar] [CrossRef] [Scilit]
  40. Kaur, L.; Srihari, J.M.; Natesan, S.; Bharthi, N.; Malathi, V.G.; Nagarajan, P. Molecular cloning and characterization of from mung bean from northern region of Tamil Nadu indicates association of Mungbean Yellow Mosaic India Virus DNA A with a recombinant DNA B. J. Mycol. Plant Pathol. 2015, 45, 173–181. [Google Scholar]
  41. Nair, R.M.; Götz, M.; Winter, S.; Giri, R.R.; Boddepalli, V.N.; Sirari, A.; Bains, T.S.; Taggar, G.K.; Dikshit, H.K.; Aski, M.; et al. Identification of mungbean lines with tolerance or resistance to yellow mosaic in fields in india where different begomovirus species and different Bemisia tabaci cryptic species predominate. Eur. J. Plant Pathol. 2017, 149, 349–365. [Google Scholar] [CrossRef] [Scilit]
  42. Ahmad, M.; Harwood, R.F. Studies on a whitefly-transmitted yellow mosaic of urd bean (Phaseolus mungo). Plant Dis. Rep. 1973, 57, 800–802. [Google Scholar]
  43. Bashir, M.; Zubair, M.; Malik, B.A. Disease resistance sources and utilization in breeding improved mungbean in Pakistan. In Proceedings of the Second International Symposium, Bangkok, Thailand, 16–20 November 1987; pp. 623–630. [Google Scholar]
  44. Wei, J.; Zhao, J.-J.; Zhang, T.; Li, F.-F.; Ghanim, M.; Zhou, X.-P.; Ye, G.-Y.; Liu, S.-S.; Wang, X.-W. Specific cells in the primary salivary glands of the whitefly Bemisia tabaci control retention and transmission of begomoviruses. J. Virol. 2014, 88, 13460–13468. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Nair, N.G. Studies on the Yellow Mosaic of Blackgram Caused by Mungbean Yellow Mosaic Virus. Ph.D. Thesis, G.B. Pant University of Agriculture and Technology, Pantnagar, India, 1971. [Google Scholar]
  46. Rathi, Y.P.S. Mungbean Yellow Mosaic Virus: Host Range and Relationship with the Vector, Bemisia Tabaci Genn. Ph.D. Thesis, Pant University of Agriculture & Technology, Pantnagar, India, 1972. [Google Scholar]
  47. Murugesan, S.; Chelliah, S. Influence of sowing time on the incidence of the vector Bemisia tabaci (Genn.) and the Yellow Mosaic Disease of greengram. Madras Agric. J. 1977, 64, 128–130. [Google Scholar]
  48. Stanley, J.; Markham, P.G.; Callis, R.J.; Pinner, M.S. The nucleotide sequence of an infectious clone of the geminivirus Beet Curly Top Virus. EMBO J. 1986, 5, 1761–1767. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Ramappa, H.K.; Devamani Jayappa, B.D. Host range of Yellow Mosaic Virus and influence of age of seedlings on transmission of MYMV in mungbean. Res. J. Agric. Sci. 2017, 8, 1235–1237. [Google Scholar]
  50. Deepa, H.; Govindappa, M.R.; Kenganal, M.; Kulkarni, S.A.; Biradar, S.A. Screening of greengram genotypes against Mungbean Yellow Mosaic Virus diseases under field condition. Int. J. Pure Appl. Biosci. 2017, 5, 1049–1056. [Google Scholar]
  51. Sai, C.B.; Nagarajan, P.; Raveendran, M.; Rabindran, R.; Senthil, N. Understanding the inheritance of Mungbean Yellow Mosaic Virus (MYMV) resistance in mungbean (Vigna radiata L. Wilczek). Mol. Breed. 2017, 37, 63. [Google Scholar] [CrossRef] [Scilit]
  52. Usharani, K.S.; Surendranath, B.; Haq, Q.M.R.; Malathi, V.G. Yellow Mosaic Virus infecting soybean in northern India is distinct from the species infecting soybean in southern and western India. Curr. Sci. 2004, 86, 845–850. [Google Scholar]
  53. Shahid, M.S.; Pudashini, B.J.; Khatri-Chhetri, G.B.; Ikegami, M.; Natsuaki, K.T. First report of Mungbean Yellow Mosaic India Virus on kidney bean in Nepal. New Dis. Rep. 2012, 25, 30. [Google Scholar] [CrossRef] [Scilit]
  54. Biswas, K.K.; Malathi, V.G.; Varma, A. Diagnosis of symptomless yellow mosaic begomovirus infection in pigeonpea by using cloned Mungbean Yellow Mosaic India Virus as probe. J. Plant Biochem. Biotechnol. 2008, 17, 9–14. [Google Scholar] [CrossRef] [Scilit]
  55. Rani, A.; Kumar, V.; Rathi, P.; Shukla, S. Linkage mapping of Mungbean Yellow Mosaic India Virus (MYMIV) resistance gene in soybean. Breed. Sci. 2017, 67, 95–100. [Google Scholar] [CrossRef] [Scilit]
  56. Marabi, R.; Sagare, D.; Sagare, S.; Das, S.B.; Bhowmick, A.K.; Noda, H. Molecular detection of Mungbean Yellow Mosaic India Virus (MYMIV) infecting soybean in Madhya Pradesh. Biosci. Biotechnol. Res. Asia 2017, 14, 315–318. [Google Scholar] [CrossRef] [Scilit]
  57. Marabi, R.; Das, S.B.; Tripathi, N.; Bhowmick, A.K.; Pachori, R.; Vibha, V. Molecular identification of Mungbean Yellow Mosaic India Virus (MYMIV) from whitefly and soybean in Jabalpur district of Madhya Pradesh, Central India. Int. J. Chem. Stud. 2018, 6, 894–896. [Google Scholar]
  58. Bhaskara Reddy, B.V.; Obaiah, S.; Prasanthi, L.; Sivaprasad, Y.; Sujitha, A.; Giridhara Krishna, T. Mungbean Yellow Mosaic India Virus is associated with yellow mosaic disease of blackgram (Vigna mungo L.) in Andhra Pradesh, India. Arch. Phytopathol. Plant Prot. 2015, 48, 345–353. [Google Scholar] [CrossRef] [Scilit]
  59. Chakraborty, N.; Basak, J. Comparative transcriptome profiling of a resistant vs. susceptible Vigna mungo cultivar in response to Mungbean Yellow Mosaic India Virus infection reveals new insight into MYMIV resistance. Curr. Plant Biol. 2018, 15, 8–24. [Google Scholar] [CrossRef] [Scilit]
  60. Marabi, R.; Sagare, D. Molecular identification of Mungbean Yellow Mosaic India Virus (MYMIV) from alternate weed and crop hosts. Ann. Plant Prot. Sci. 2017, 25, 152–155. [Google Scholar]
  61. Shahid, M.; Al-Mahmooli, I.; Al-Sadi, A.; Briddon, R. Identification of Mungbean Yellow Mosaic India Virus infecting cucumber in Oman. Plant Dis. 2018, 102, 465. [Google Scholar] [CrossRef] [Scilit]
  62. Fauquet, C.M.; Briddon, R.W.; Brown, J.K.; Moriones, E.; Stanley, J.; Zerbini, M.; Zhou, X. Geminivirus strain demarcation and nomenclature. Arch. Virol. 2008, 153, 783–821. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  63. Prema, G.U.; Rangaswamy, K.T. Field evaluation of horse gram germplasm/genotypes against Horse gram Yellow Mosaic Virus (HgYMV) disease and biological transmission of Horse gram Yellow Mosaic Virus to different leguminous hosts through white flies. Int. J. Agric. Sci. 2017, 9, 4934–4939. [Google Scholar]
  64. Poehlman, J.M. The Mungbean; Oxford & IBH Pub.: New Delhi, India, 1991; pp. 169–274. ISBN 0813313783. [Google Scholar]
  65. Aliyu, B.; Ng, N.Q.; Fawole, I. Inheritance of pubescences in crosses between Cowpea (Vigna unquiculata (L)) WAIP) and V. Rhomboidea Burtt. Davy. Niger. J. Genet. 2000, 15, 9–14. [Google Scholar] [CrossRef] [Scilit]
  66. Mohammed, M.S.; Russom, Z.; Abdul, S.D. Inheritance of hairiness and pod shattering, heritability and correlation studies in crosses between cultivated cowpea (Vigna unguiculata (L.) Walp.) and its wild (var. pubescens) relative. Euphytica 2010, 171, 397–407. [Google Scholar] [CrossRef] [Scilit]
  67. Fatokun, C.A.; Singh, B.B. Improving Cowpea-Cereals Systems in the Dry Savannas; Annual Report; International Institute of Tropical Agriculture: Ibadan, Nigeria, 2001; p. 79. [Google Scholar]
  68. Dwivedi, S.; Singh, D.P. Inheritance of pod pubscence and seed coat colour in urdbean. Crop Improv. 1986, 13, 54–57. [Google Scholar]
  69. Elden, T.C.; Elgin, J.H., Jr.; Soper, J.F. Inheritance of pubescence in selected clones from two alfalfa populations and relationship to potato leafhopper resistance. Crop Sci. 1986, 26, 1143–1146. [Google Scholar] [CrossRef] [Scilit]
  70. Gunasinghe, U.B.; Irwin, M.E.; Kampmeier, G.E. Soybean leaf pubescence affects aphid vector transmission and field spread of Soybean Mosaic Virus. Ann. Appl. Biol. 1988, 112, 259–272. [Google Scholar] [CrossRef] [Scilit]
  71. Singh, C.M.; Mishra, S.B.; Pandey, A.; Arya, M. Multivariate analysis in mungbean [Vigna radiata (L.) Wilczek] to identify the genetic donors for pubescence and agro-morphological traits. Legum. Res. 2015, 38, 767–771. [Google Scholar] [CrossRef] [Scilit]
  72. Inbar, M.; Gerling, D. Plant-mediated interactions between whiteflies, herbivores, and natural enemies. Annu. Rev. Entomol. 2007, 53, 431–448. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  73. Sánchez-Campos, S.; Martínez-Ayala, A.; Márquez-Martín, B.; Aragón-Caballero, L.; Navas-Castillo, J.; Moriones, E. Fulfilling Koch’s postulates confirms the monopartite nature of tomato leaf deformation virus: A begomovirus native to the new world. Virus Res. 2013, 173, 286–293. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  74. Leite, G.L.D.; Picanço, M.; Guedes, R.N.C.; Moreira, M.D. Factors affecting attack rate of whitefly on the eggplant. Pesqui. Agropecuária Bras. 2003, 38, 545–549. [Google Scholar] [CrossRef] [Scilit]
  75. Pramanik, P.; Singha, S.; Chatterjee, M.L. Varietal preference of whitefly, Bemisia tabaci (Gennadius) among pumpkin cultivars. Pest Manag. Econ. Zool. 2004, 12, 105–107. [Google Scholar]
  76. Navon, A.; Melamed-Madjar, V.; Zur, M.; Ben-Moshe, E. Effects of cotton cultivars on feeding of Heliothis armigera and Spodoptera littoralis larvae and on oviposition of Bemisia tabaci. Agric. Ecosyst. Environ. 1991, 35, 73–80. [Google Scholar] [CrossRef] [Scilit]
  77. Ozgur, A.F.; Sekeroglu, E. Population development of Bemisia tabaci (Homoptera: Aleurodidae) on various cotton cultivars in Cukurova, Turkey. Agric. Ecosyst. Environ. 1986, 17, 83–88. [Google Scholar] [CrossRef] [Scilit]
  78. Lakshminarayan, S.; Singh, P.S.; Mishra, D.S. Relationship between whitefly population, YMV disease and morphological parameters of green gram germplasm. Environ. Ecol. 2008, 26, 978–982. [Google Scholar]
  79. Taggar, G.K.; Gill, R.S. Preference of whitefly, Bemisia tabaci, towards black gram genotypes: Role of morphological leaf characteristics. Phytoparasitica 2012, 40, 461–474. [Google Scholar] [CrossRef] [Scilit]
  80. Ashraf, M.; Zafar, Z.U. Some physiological characteristics in resistant and susceptible cotton cultivars infected with Cotton Leaf Curl Virus. Biol. Plant. 1999, 42, 615–620. [Google Scholar] [CrossRef] [Scilit]
  81. Chu, C.-C.; Freeman, T.P.; Buckner, J.S.; Henneberry, T.J.; Nelson, D.R.; Natwick, E.T. Susceptibility of upland cotton cultivars to Bemisia tabaci biotype B (Homoptera: Aleyrodidae) in relation to leaf age and trichome density. Ann. Entomol. Soc. Am. 2001, 94, 743–749. [Google Scholar] [CrossRef] [Scilit]
  82. Hasanuzzaman, A.T.M.; Islam, M.N.; Zhang, Y.; Zhang, C.-Y.; Liu, T.-X. Leaf morphological characters can be a factor for intra-varietal preference of whitefly Bemisia tabaci (Hemiptera: Aleyrodidae) among eggplant varieties. PLoS ONE 2016, 11, e0153880. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  83. Wynd, F.L. Metabolic phenomena associated with virus infection in plants. Bot. Rev. 1943, 9, 395. [Google Scholar] [CrossRef] [Scilit]
  84. Selman, I.W.; Brierley, M.R.; Pegg, G.F.; Hill, T.A. Changes in the free amino acids and amides in tomato plants inoculated with Tomato Spotted Wilt Virus. Ann. Appl. Biol. 1961, 49, 601–615. [Google Scholar] [CrossRef] [Scilit]
  85. Bozarth, R.F.; Diener, T.O. Changes in concentration of free amino acids and amides induced in tobacco plants by potato virus X and potato virus Y. Virology 1963, 21, 188–193. [Google Scholar] [CrossRef] [Scilit]
  86. Chhabra, K.S.; Kooner, B.S.; Saxena, A.K.; Sharma, A.K. Effect of biochemical components on the incidence of insect pest complex and Yellow Mosaic Virus in mungbean. Crop Improv. 1981, 8, 56–59. [Google Scholar]
  87. Chhabra, K.S.; Kooner, B.S.; Saxena, A.K.; Sharma, A.K. Influence of biochemical components on the incidence of insect pests and Yellow Mosaic Virus in blackgram. Indian J. Entomol. 1984, 46, 148–156. [Google Scholar]
  88. Chhabra, K.S.; Kooner, B.S. Sources of resistance in mungbean against major insectpests and Yellow Mosaic Virus. Legum. Res. 1992, 14, 175–184. [Google Scholar]
  89. Thind, S.K.; Monga, P.K.; Kaur, N.; Cheema, S.S. Analysis of some biochemical and micro-nutrient constituents of Yellow Mosaic Virus infected moong. Indian J. Virol. 1996, 12, 157–159. [Google Scholar]
  90. Dantre, R.K.; Keshwal, R.L.; Khare, M.N. Biochemical changes induced by yellow mosaic virus in the resistant and susceptible cultivar of soybean. Indian J. Virol. 1996, 12, 47–49. [Google Scholar]
  91. Sultana, N.; Kasem, M.A.; Hossain, M.D.; Alam, M.S. Biochemical changes of some promising lines of yard long bean due to the infection of Yellow Mosaic Virus. Thai J. Agric. Sci. 1998, 31, 322–327. [Google Scholar]
  92. Mali, P.C.; Uday, B.; Satish, L. Effect of planting dates and development of Yellow Mosaic Virus on biochemical constituents of moth bean genotypes. Indian Phytopathol. 2000, 53, 379–383. [Google Scholar]
  93. Chand, P.; Varma, J.P. Some characteristics of mungbean and urdbean varieties resistant and susceptible to Yellow Mosaic Virus. Indian Phytopathol. 1980, 33, 48–53. [Google Scholar]
  94. Sinha, A.; Srivastava, M. Biochemical changes in mungbean plants infected by Mungbean Yellow Mosaic Virus. Int. J. Virol. 2010, 6, 150–157. [Google Scholar] [CrossRef] [Scilit]
  95. Ram, H.H.; Singh, K.; Verma, V.D. Breeding for resistance to Yellow Mosaic Virus through interspecific hybridization in soybean [Glycine formosana]. Soybean Genet. Newsl. 1984, 11, 46–48. [Google Scholar]
  96. Gill, C.K.; Labh, S. Biochemical changes in mungbean cultivar, ML-267 infected with Yellow Mosaic Virus. Insect Environ. 2000, 6, 86–87. [Google Scholar]
  97. Hemida, S.K. Effect of Bean Yellow Mosaic Virus on physiological parameters of Vicia faba and Phaseolus vulgaris. Int. J. Agric. Biol. 2005, 7, 154–157. [Google Scholar]
  98. Gunnar Fossdal, C.; Sharma, P.; Lönneborg, A. Isolation of the first putative peroxidase cDNA from a conifer and the local and systemic accumulation of related proteins upon pathogen infection. Plant Mol. Biol. 2001, 47, 423–435. [Google Scholar] [CrossRef] [Scilit]
  99. Torres, M.A. ROS in biotic interactions. Physiol. Plant. 2010, 138, 414–429. [Google Scholar] [CrossRef] [Scilit]
  100. Perveen, S.S.; Qaisrani, T.M.; Bhutta, S.; Perveen, R.; Naqvi, S.H.M. HPLC analysis of cotton phenols and their contribution in bollworm resistance. Online J. Biol. Sci. 2001, 1, 587–590. [Google Scholar]
  101. Singh, D.; Patel, P.N. Studies on resistance in crops to bacterial diseases in India. III. Investigations on inheritance of reactions to bacterial leaf spot and yellow mosaic diseases and linkage, if any, with other characters in mungbean. Indian Phytopathol. 1977, 30, 202–206. [Google Scholar]
  102. Malik, I.A.; Ali, Y.; Saleem, M. Incorporation of tolerance to Mungbean Yellow Mosaic Virus from local germplasm into exotic large-seeded mungbean. In Mungbean. Proceedings of the Second International Symposium in Mungbean; Shanmugasundaram, S., Ed.; AVRDC: Tainan, Taiwan, 1988; pp. 297–307. [Google Scholar]
  103. Saleem, M.; Haris, W.A.A.; Malik, I.A. Inheritance of Yellow Mosaic Virus in mungbean (Vigna radiata L. Wilczek). Pak. J. Phytopathol. 1998, 10, 30–32. [Google Scholar]
  104. Reddy, K.R.; Singh, D.P. Inheritance of resistance to Mungbean Yellow Mosaic Virus. Madras Agric. J. 1995, 88, 199–201. [Google Scholar]
  105. Dhole, V.J.; Reddy, K.S. Development of a SCAR marker linked with a MYMV resistance gene in mungbean (Vigna radiata L. Wilczek). Plant Breed. 2013, 132, 127–132. [Google Scholar] [CrossRef] [Scilit]
  106. Pal, S.S.; Dhaliwal, H.S.; Bains, S.S. Inheritance of resistance to Yellow Mosaic Virus in some Vigna species. Plant Breed. 1991, 106, 168–171. [Google Scholar] [CrossRef] [Scilit]
  107. Singh, D.P. Inheritance of resistance to Yellow Mosaic Virus in blackgram (Vigna mungo (L.) Hepper). Theor. Appl. Genet. 1980, 57, 233–235. [Google Scholar] [CrossRef] [Scilit]
  108. Verma, R.P.S.; Singh, D.P. The allelic relationship of genes giving resistance to Mungbean Yellow Mosaic Virus in blackgram. Theor. Appl. Genet. 1986, 72, 737–738. [Google Scholar] [CrossRef] [Scilit]
  109. Shukla, G.P.; Pandya, B.P. Resistance to yellow mosaic in greengram. SABRAO J. Breed. Genet. 1985, 17, 165–171. [Google Scholar]
  110. Solanki, I.S.; Dahiya, B.S.; Waldia, R.S. Resistance to Mungbean Yellow Mosaic Virus in blackgram. Indian J. Genet. Plant Breed. 1982, 42, 240–242. [Google Scholar]
  111. Murugan, E.; Nadarajan, N. Genetic studies on differential expression of Mungbean Yellow Mosaic Virus resistance related to trichome density in urd bean (Vigna mungo (L.) Hepper). Indian J. Plant Genet. Resour. 2012, 25, 135–138. [Google Scholar]
  112. Alam, A.K.M.M.; Somta, P.; Srinives, P.; Mahbubul Alam, A.K.M.; Somta, P.; Srinives, P. Identification and confirmation of quantitative trait loci controlling resistance to mungbean yellow mosaic disease in mungbean [Vigna radiata (L.) Wilczek]. Mol. Breed. 2014, 34, 1497–1506. [Google Scholar] [CrossRef] [Scilit]
  113. Selvi, R.; Muthiah, A.R.; Manivannan, N.; Raveendran, T.S.; Manickam, A.; Samiyappan, R. Tagging of RAPD marker for MYMV resistance in mungbean (Vigna radiata (L.) Wilczek). Asian J. Plant Sci. 2006, 5, 277–280. [Google Scholar]
  114. Akbar, W.; Aslam, M.; Maqbool, M.A.; Ali, M.; Arshad, M. Inheritance pattern of mungbean yellow mosaic disease resistance and gene action for different traits in mungbean (Vigna radiata (L.) Wilczek) under protected and unprotected field conditions. Plant Breed. 2018, 137, 763–772. [Google Scholar] [CrossRef] [Scilit]
  115. Khan, M.G.; Ahmad, W.; Khattak, G.S.S.; Siraj-ud-Din; Ahmad, A. Mode of inheritance of resistance to Mungbean Yellow Mosaic Virus (MYMV) in mungbean (Vigna radiata (l.) Wilczek). Sarhad J. Agric. 2007, 23, 1071–1074. [Google Scholar]
  116. Khattak, G.S.S.; Saeed, I.; Shah, S.A. Breeding high yielding and disease resistant mungbean (Vigna radiata (L.) Wilczek) genotypes. Pak. J. Bot. 2008, 40, 1411–1417. [Google Scholar]
  117. Singh, A.; Dikshit, H.K.; Jain, N.; Singh, D.; Yadav, R.N. Efficiency of SSR, ISSR and RAPD markers in molecular characterization of mungbean and other Vigna species. Indian J. Biotechnol. 2014, 13, 81–88. [Google Scholar]
  118. Gupta, S.; Gupta, D.S.; Anjum, T.K.; Pratap, A.; Kumar, J. Inheritance and molecular tagging of MYMIV resistance gene in blackgram (Vigna mungo L. Hepper). Euphytica 2013, 193, 27–37. [Google Scholar] [CrossRef] [Scilit]
  119. Kumar, B.; Talukdar, A.; Verma, K.; Bala, I.; Harish, G.D.; Gowda, S.; Lal, S.K.; Sapra, R.L.; Singh, K.P. Mapping of Yellow Mosaic Virus (YMV) resistance in soybean (Glycine max L. Merr.) through association mapping approach. Genetica 2015, 143, 1–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  120. Sandhu, T.S.; Brar, J.S.; Sandhu, S.S.; Verma, M.M. Inheritance of resistance to Mungbean Yellow Mosaic Virus in green gram. J. Res. Punjab Agric. Univ. 1985, 22, 607–611. [Google Scholar]
  121. Malik, I.A.; Sarwar, G.; Ali, Y. Inheritance of tolerance to Mungbean Yellow Mosaic Virus and some morphological characters. Pakistan J. Bot. 1986, 18, 189–198. [Google Scholar]
  122. Malik, I.A. Breeding for resistance to MYMV and its vector in Pakistan. In Proceedings of the International Workshop on Mungbean Yellow Mosaic Disease, Tainan, Taiwan, 2–3 July 1991; p. 79. [Google Scholar]
  123. Ammavasai, S.; Phogat, D.S.; Solanki, I.S. Inheritance of resistance to mungbean yellow mosaic virus (MYMV) in green gram [Vigna radiata (L.) Wilczek]. Indian J. Genet. Plant Breed. 2004, 64, 146. [Google Scholar]
  124. Dhole, V.J.; Reddy, K.S. Genetic analysis of resistance to Mungbean Yellow Mosaic Virus in mungbean (Vigna radiata). Plant Breed. 2012, 131, 414–417. [Google Scholar] [CrossRef] [Scilit]
  125. Kothandaraman, S.V.; Devadason, A.; Ganesan, M.V. Seed-borne nature of a begomovirus, Mung bean Yellow Mosaic Virus in black gram. Appl. Microbiol. Biotechnol. 2016, 100, 1925–1933. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  126. Bhanu, S.H.; Jayalakshmidevi, R.S.; Reddy, B.V.B.; Prasanthi, L. Host range studies for Yellow Mosaic Virus (YMV) infecting pulses. Int. J. Trop. Agric. 2015, 33, 1173–1185. [Google Scholar]
  127. Suman, S.; Sharma, V.; Kumar, H.; Shahi, V.K. Screening of mungbean [Vigna radiata (L.) Wilczek] genotypes for resistance to Mungbean Yellow Mosaic Virus (MYMV). Environ. Ecol. 2015, 33, 855–859. [Google Scholar]
  128. Khaliq, N.; Kaul, V.; Shankar, U.; Ganai, S.; Sharma, S.; Norboo, T. Screening of mungbean (Vigna radiata (L.) Wilczek) varieties against whitefly (Bemisia tabaci Genn.) and Mungbean Yellow Mosaic Virus (MYMV). Int. J. Curr. Microbiol. Appl. Sci. 2017, 6, 129–132. [Google Scholar] [CrossRef] [Scilit]
  129. Singh, P.K.; Rai, N.; Singh, D.V.; Singh, A.P. Incidence of Dolichos Yellow Mosaic Virus (DYMV) and yield potential in indian bean (Lablal purpureus) F1’S. J. Agric. Technol. 2012, 8, 1469–1474. [Google Scholar]
  130. Taggar, G.; Gill, R.S.; Sandhu, J.S. Evaluation of black gram [Vigna mungo (L.) Hepper] genotypes against whitefly, Bemisia tabaci (Gennadius) under screen-house conditions. Acta Phytopathol. Entomol. Hungarica 2013, 48, 53–62. [Google Scholar] [CrossRef] [Scilit]
  131. Karthikeyan, A.; Shobhana, V.G.; Sudha, M.; Raveendran, M.; Senthil, N.; Pandiyan, M.; Nagarajan, P. Mungbean Yellow Mosaic Virus (MYMV): A threat to green gram (Vigna radiata) production in Asia. Int. J. Pest Manag. 2014, 60, 314–324. [Google Scholar] [CrossRef] [Scilit]
  132. Nath, P. Effect of sowing time on the incidence of Yellow Mosaic Virus disease and whitefly population on greengram. Ann. Agric. Res. 1994, 15, 174–177. [Google Scholar]
  133. Ilyas, M.; Qazi, J.; Mansoor, S.; Briddon, R.W. Genetic diversity and phylogeography of begomoviruses infecting legumes in Pakistan. J. Gen. Virol. 2010, 91, 2091–2101. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  134. Ariyo, O.; Koerbler, M.; Dixon, A.; Atiri, G.; Winter, S. Development of an efficient virus transmission technique to screen cassava genotypes for resistance to cassava mosaic disease. In Proceedings of the Conference on International Agricultural Research for Development, Göttingen, Germany, 8–10 October 2003; pp. 1–11. [Google Scholar]
  135. Jamsari, L.S.; Utami, H.P.; Herberg, F.; Nellen, W.; Ferita, I. Injection technique could as a new promising method for artificial infection of geminivirus particles in chili pepper (Capsicum annuum L.). Asian J. Agric. Res. 2015, 9, 23–32. [Google Scholar]
  136. Palauqui, J.C.; Elmayan, T.; Pollien, J.M.; Vaucheret, H. Systemic acquired silencing: Transgene-specific post-transcriptional silencing is transmitted by grafting from silenced stocks to non-silenced scions. EMBO J. 1997, 16, 4738–4745. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  137. Ali, E.M.; Kobayashi, K.; Yamaoka, N.; Ishikawa, M.; Nishiguchi, M. Graft transmission of RNA silencing to non-transgenic scions for conferring virus resistance in tobacco. PLoS ONE 2013, 8, e63257. [Google Scholar]
  138. Mayo, M.; Ryabov, E.; Fraser, G.; Taliansky, M. Mechanical transmission of Potato leafroll virus. J. Gen. Virol. 2000, 81, 2791–2795. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  139. Leiser, R.M.; Ziegler-Graff, V.; Reutenauer, A.; Herrbach, E.; Lemaire, O.; Guilley, H.; Richards, K.; Jonard, G. Agroinfection as an alternative to insects for infecting plants with Beet Western Yellows Luteovirus. Proc. Natl. Acad. Sci. USA 1992, 89, 9136–9140. [Google Scholar] [CrossRef] [Scilit]
  140. Mutterer, J.D.; Ziegler-Graff, V.; Richards, K.E. Agro-infection as a means of transmitting luteoviruses to host plants for study of gene expression. In The Luteoviridae; Smith, H.G., Barker, H., Eds.; CABI Publishing: New York, NY, USA, 1999; pp. 43–67. [Google Scholar]
  141. Lapidot, M.; Polston, J.E. Biology and epidemiology of Bemisia-vectored viruses. In Bionomics and Management of a Global Pest; Springer: Dordrecht, The Netherlands, 2010; pp. 227–231. [Google Scholar]
  142. Mandal, B.; Varma, A.; Malathi, V.G. Systemic infection of Vigna mungo using the cloned DNAs of the blackgram isolate of Mungbean Yellow Mosaic Geminivirus through agroinoculation and transmission of the progeny virus by whiteflies. J. Phytopathol. 1997, 145, 505–510. [Google Scholar] [CrossRef] [Scilit]
  143. Karthikeyan, A.; Sudha, M.; Nagarajan, P.; Pandiyan, M.; Muthurajan, R.; Natesan, S.; Kathithachalam, A. Using SSR marker to identify the MYMV resistance gene in mungbean [Vigna radiata (L.) Wilczek]. Rom. J. Biol.—Plant Biol. 2012, 57, 105–113. [Google Scholar]
  144. Karthikeyan, A.; Sudha, M.; Natesan, S.; Pandiyan, M.; Muthurajan, R.; Nagrajan, P. Screening and identification of random amplified polymorphic DNA (RAPD) markers linked to Mungbean Yellow Mosaic Virus (MYMV) resistance in mungbean (Vigna radiata (L.) Wilczek). Arch. Phytopathol. Plant Prot. 2012, 45, 712–716. [Google Scholar] [CrossRef] [Scilit]
  145. Bashir, M.; Zubair, M. Studies on Viral Disease of Major Pulse Crops and Identification of Resistant Sources; Technical Annual Report (April 2004 to June 2005) of APL Project; Crop Sciences Institute, National Agricultural Research Centre: Islamabad, Pakistan, 2005; p. 169. [Google Scholar]
  146. Rogers, S.G.; Bisaro, D.M.; Horsch, R.B.; Fraley, R.T.; Hoffmann, N.L.; Brand, L.; Elmer, J.S.; Lloyd, A.M. Tomato golden mosaic virus A component DNA replicates autonomously in transgenic plants. Cell 1986, 45, 593–600. [Google Scholar] [CrossRef] [Scilit]
  147. Jacob, S.S.; Vanitharani, R.; Karthikeyan, A.S.; Chinchore, Y.; Thillaichidambaram, P.; Veluthambi, K. Mungbean Yellow Mosaic Virus-Vi agroinfection by codelivery of DNA A and DNA B from one agrobacterium strain. Plant Dis. 2003, 87, 247–251. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  148. Karthikeyan, A.; Sudha, M.; Pandiyan, M.; Natesan, S.; Shobhana, V.; Nagarajan, P. Screening of MYMV resistant mungbean (Vigna radiata L. Wilczek) progenies through agroinoculation. Int. J. Plant Pathol. 2011, 2, 115–125. [Google Scholar] [CrossRef] [Scilit]
  149. Malathi, V.G.; Surendranath, B.; Naghma, A.; Roy, A. Adaptation to new hosts shown by the cloned components of Mungbean Yellow Mosaic India Virus causing cowpea golden mosaic in northern India. Can. J. Plant Pathol. 2010, 27, 439–447. [Google Scholar] [CrossRef] [Scilit]
  150. Kumar, J.; Gupta, D.S.; Gupta, S.; Dubey, S.; Gupta, P.; Kumar, S. Quantitative trait loci from identification to exploitation for crop improvement. Plant Cell Rep. 2017, 36, 1187–1213. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  151. Yadav, R.K.; Chattopadhyay, D. Differential soybean gene expression during early phase of infection with Mungbean Yellow Mosaic India Virus. Mol. Biol. Rep. 2014, 41, 5123–5134. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  152. Rouhibakhsh, A.; Malathi, V.G. Infectivity of blackgram isolate of Mungbean Yellow Mosaic India Virus on cowpea. Indian J. Virol. 2008, 19, 191–195. [Google Scholar]
  153. Singh, C.M.; Kumar, R.; Mishra, S.B.; Pandey, A.; Arya, M. Characterization of mungbean genotypes against Mungbean Yellow Mosaic Virus and cercospora leaf spot diseases under north east plain zone. Int. J. Agric. Environ. Biotechnol. 2015, 8, 119–125. [Google Scholar] [CrossRef] [Scilit]
  154. Parihar, A.K.; Basandrai, A.K.; Sirari, A.; Dinakaran, D.; Singh, D.; Kannan, K.; Kushawaha, K.P.S.; Adinarayan, M.; Akram, M.; Latha, T.K.S.; et al. Assessment of mungbean genotypes for durable resistance to yellow mosaic disease: Genotype × environment interactions. Plant Breed. 2017, 136, 94–100. [Google Scholar] [CrossRef] [Scilit]
  155. Ghafoor, A.; Zubair, M.; Malik, B.A.; Iqbal, S.M. Evaluation of selected germplasm of mungbean (Vigna radiata (L.) Wilczek). Pakistan J. Bot. 1992, 24, 112–118. [Google Scholar]
  156. Anjum, N.A.; Umar, S.; Chan, M.-T.; Reumann, S.; Corpas, F.J. Ascorbate-Glutathione Pathway and Stress Tolerance in Plants; Springer: Berlin/Heidelberg, Germany, 2010; pp. 1–53. ISBN 978-90-481-9404-9. [Google Scholar]
  157. Dikshit, H.K.; Sharma, T.R.; Singh, B.B.; Kumari, J. Molecular and morphological characterization of fixed lines from diverse cross in mung bean (Vigna radiata (L.) Wilczek). J. Genet. 2009, 88, 341–344. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  158. Singh, B.B.; Ajeigbe, H.A.; Tarawali, S.A.; Fernandez-Rivera, S.; Abubakar, M. Improving the production and utilization of cowpea as food and fodder. Field Crops Res. 2003, 84, 169–177. [Google Scholar] [CrossRef] [Scilit]
  159. Singh, B.V.; Ahuja, M.R. Phaseolus sublobatus Roxb.: A source of resistance to Yellow Mosaic Virus for cultivated mung. Indian J. Genet. Plant Breed. 1977, 37, 130–132. [Google Scholar]
  160. Pandiyan, M.; Ramamoorthi, N.; Ganesh, S.K.; Jebaraj, S.; Pagarajan, P.; Ponnuswami, B. Broadening the genetic base and introgression of MYMV resistance and yield improvement through unexplored genes from wild relatives in mungbean. Plant Mutat. Rep. 2008, 2, 33–38. [Google Scholar]
  161. Isemura, T.; Kaga, A.; Tabata, S.; Somta, P.; Srinives, P.; Shimizu, T.; Jo, U.; Vaughan, D.A.; Tomooka, N. Construction of a Genetic Linkage Map and Genetic Analysis of Domestication Related Traits in Mungbean (Vigna radiata). PLoS ONE 2012, 7, e41304. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  162. Chandra, A. Use of EST database markers from M. truncatula in the transferability to other forage legumes. J. Environ. Biol. 2011, 32, 347–354. [Google Scholar] [PubMed]
  163. Pratap, A.; Gupta, S.; Tomar, R.; Malviya, N.; Maurya, R.; Pandey, V.R.; Mehandi, S.; Singh, N.P. Cross-genera amplification of informative microsatellite markers from common bean and scarlet runner bean for assessment of genetic diversity in mungbean (Vigna radiata). Plant Breed. 2016, 135, 499–505. [Google Scholar] [CrossRef] [Scilit]
  164. Basak, J.; Kundagrami, S.; Ghose, T.K.; Pal, A. Development of Yellow Mosaic Virus (YMV) resistance linked DNA marker in Vigna mungo from populations segregating for YMV-reaction. Mol. Breed. 2005, 14, 375–383. [Google Scholar] [CrossRef] [Scilit]
  165. Souframanien, J.; Gopalakrishna, T. ISSR and SCAR markers linked to the Mungbean Yellow Mosaic Virus (MYMV) resistance gene in blackgram [Vigna mungo (L.) Hepper]. Plant Breed. 2006, 125, 619–622. [Google Scholar] [CrossRef] [Scilit]
  166. Binyamin, R.; Khan, M.A.; Khan, N.A.; Khan, A.I. Application of SCAR markers linked with Mungbean Yellow Mosaic Virus disease-resistance gene in Pakistan mungbean germplasm. Genet. Mol. Res. 2015, 14, 2825–2830. [Google Scholar] [CrossRef] [Scilit]
  167. Kundu, A.; Patel, A.; Paul, S.; Pal, A. Transcript dynamics at early stages of molecular interactions of MYMIV with resistant and susceptible genotypes of the leguminous host, Vigna mungo. PLoS ONE 2015, 10, e0124687. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  168. Maiti, S.; Paul, S.; Pal, A. Isolation, characterization, and structure analysis of a Non-TIR-NBS-LRR encoding candidate gene from MYMIV-resistant Vigna mungo. Mol. Biotechnol. 2012, 52, 217–233. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  169. Yadav, C.B.; Bhareti, P.; Muthamilarasan, M.; Mukherjee, M.; Khan, Y.; Rathi, P.; Prasad, M. Genome-wide SNP identification and characterization in two soybean cultivars with contrasting Mungbean Yellow Mosaic India Virus disease resistance traits. PLoS ONE 2015, 10, e0123897. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  170. Naresh, P.; Krishna Reddy, M.; Reddy, A.C.; Lavanya, B.; Lakshmana Reddy, D.C.; Madhavi Reddy, K. Isolation, characterization and genetic diversity of NBS-LRR class disease-resistant gene analogs in multiple virus resistant line of chilli (Capsicum annuum L.). 3 Biotech 2017, 7, 114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  171. Patel, A.; Dey, N.; Chaudhuri, S.; Pal, A. Molecular and biochemical characterization of a Vigna mungo MAP kinase associated with Mungbean Yellow Mosaic India Virus infection and deciphering its role in restricting the virus multiplication. Plant Sci. 2017, 262, 127–140. [Google Scholar] [CrossRef] [Scilit]
  172. Biswas, K.; Biswas, K.; Tarafdar, A. Multiple and mixed infections with yellow mosaic, leaf crinkle and bud necrosis disease complex in mungbean: A threat to cultivation of mungbean in India. Legum. Res. 2015, 38, 382–388. [Google Scholar] [CrossRef] [Scilit]
  173. Pratap, A.; Gupta, S.; Nair, M.R.; Gupta, K.S.; Schafleitner, R.; Basu, S.P.; Singh, M.C.; Prajapati, U.; Gupta, K.A.; Nayyar, H.; et al. Using plant phenomics to exploit the gains of genomics. Agronomy 2019, 9, 126. [Google Scholar] [CrossRef] [Scilit]
  174. Ferro, M.M.M.; Ramos-Sobrinho, R.; Xavier, C.A.D.; Zerbini, F.M.; Lima, G.S.A.; Nagata, T.; Assunção, I.P. New approach for the construction of infectious clones of a circular DNA plant virus using Gibson Assembly. J. Virol. Methods 2019, 263, 20–23. [Google Scholar] [CrossRef] [Scilit]
  175. Sehrawat, N.; Yadav, M.; Bhat, K.V.; Sairam, R.K.; Jaiwal, P.K. Introgression of Mungbean Yellow Mosaic Virus resistance in Vigna mungo (L.) Hepper and purity testing of F1 hybrids using SSRs. Turkish J. Agric. For. 2016, 40, 95–100. [Google Scholar] [CrossRef] [Scilit]
  176. Chaisan, T.; Somta, P.; Srinives, P.; Chanprame, S.; Kaveeta, R.; Dumrongkittikule, S. Development of tetraploid plants from an interspecific hybrid between mungbean (Vigna radiata) and rice bean (Vigna umbellata). J. Crop Sci. Biotechnol. 2013, 16, 45–51. [Google Scholar] [CrossRef] [Scilit]
  177. Bhanu, A.N.; Kumar, P.; Singh, M.N.; Srivastava, K.; Hemantaranjan, A. Assessment of genetic purity of inter-specific F1 hybrids involving Vigna radiata and Vigna umbellata. J. Exp. Biol. 2017, 5, 636–643. [Google Scholar] [CrossRef] [Scilit]
  178. Mathivathana, M.K.; Murukarthick, J.; Karthikeyan, A.; Jang, W.; Dhasarathan, M.; Jagadeeshselvam, N.; Sudha, M.; Vanniarajan, C.; Karthikeyan, G.; Yang, T.-J.; et al. Detection of QTLs associated with Mungbean Yellow Mosaic Virus (MYMV) resistance using the interspecific cross of Vigna radiata × Vigna umbellata. J. Appl. Genet. 2019. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  179. Sudha, M.; Anusuya, P.; Mahadev, N.G.; Karthikeyan, A.; Nagarajan, P.; Raveendran, M.; Senthil, N.; Pandiyan, M.; Angappan, K.; Balasubramanian, P. Molecular studies on mungbean (Vigna radiata (L.) Wilczek) and ricebean (Vigna umbellata (Thunb.)) interspecific hybridisation for Mungbean Yellow Mosaic Virus resistance and development of species-specific SCAR marker for ricebean. Arch. Phytopathol. Plant Prot. 2013, 46, 503–517. [Google Scholar] [CrossRef] [Scilit]
  180. Sudha, M.; Karthikeyan, A.; Shobhana, V.G.; Nagarajan, P.; Raveendran, M.; Senthil, N.; Pandiyan, M.; Angappan, K.; Balasubramanian, P.; Rabindran, R. Search for Vigna species conferring resistance to Mungbean Yellow Mosaic Virus in mungbean. Plant Genet. Resour. 2015, 13, 162–167. [Google Scholar] [CrossRef] [Scilit]
  181. Chen, H.-M.; Ku, H.-M.; Schafleitner, R.; Bains, T.S.; George Kuo, C.; Liu, C.-A.; Nair, R.M. The major quantitative trait locus for Mungbean Yellow Mosaic Indian Virus resistance is tightly linked in repulsion phase to the major bruchid resistance locus in a cross between mungbean [Vigna radiata (L.) Wilczek] and its wild relative Vigna radiata ssp. sublobata. Euphytica 2013, 192, 205–216. [Google Scholar] [CrossRef] [Scilit]
  182. Pandiyan, M.; Natesan, S.; Ramamoorthi, N.; Muthiah, A.; Tomooka, N. Interspecific hybridization of Vigna radiata x 13 wild Vigna species for developing MYMV donar. Electron. J. Plant Breed. 2010, 1, 600–610. [Google Scholar]
  183. Liu, M.-S.; Kuo, T.C.-Y.; Ko, C.-Y.; Wu, D.-C.; Li, K.-Y.; Lin, W.-J.; Lin, C.-P.; Wang, Y.-W.; Schafleitner, R.; Lo, H.-F.; et al. Genomic and transcriptomic comparison of nucleotide variations for insights into bruchid resistance of mungbean (Vigna radiata [L.] R. Wilczek). BMC Plant Biol. 2016, 16, 46. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Presence of vector-virus at collateral and alternate hosts over the year.
Figure 1. Presence of vector-virus at collateral and alternate hosts over the year.
Agronomy 09 00622 g001
Figure 2. Various stages of mungbean plants; (A) seedling, (B) vegetative, (C) pod filling stage infected by Mungbean Yellow Mosaic India Virus.
Figure 2. Various stages of mungbean plants; (A) seedling, (B) vegetative, (C) pod filling stage infected by Mungbean Yellow Mosaic India Virus.
Agronomy 09 00622 g002
Figure 3. Detection of virus species in the development of yellow mosaic disease.
Figure 3. Detection of virus species in the development of yellow mosaic disease.
Agronomy 09 00622 g003
Figure 4. Marker-assisted breeding/gene introgression through transcriptomic and genomics approaches.
Figure 4. Marker-assisted breeding/gene introgression through transcriptomic and genomics approaches.
Agronomy 09 00622 g004
Table 1. Collateral and alternate hosts of Legume Yellow Mosaic Viruses (LYMVs).
Table 1. Collateral and alternate hosts of Legume Yellow Mosaic Viruses (LYMVs).
VirusesHostsReferences
MYMVPigeon pea (Cajanus cajan)[49,50,51]
Urdbean (V. mungo)[49,51]
Soybean (Glycine max)[49,51,52]
Common bean (Phaseolus vulgaris)[49,51]
Horse gram (Macrotyloma uniflorum)[49,50]
Cowpea (Vigna unguiculata)[50]
Nicotiana benthamiana[50]
Croton bonplandianum[50]
Euphorbia geniculata[50]
Parthenium hysterophorus[50]
Malvestrum cormandelianum[50]
Acalypha indica[50]
Alternanthera sessilis[50]
MYMIVCommon bean (P. vulgaris)[53]
Lima bean (P. lunatus)[53]
Pigeon pea (C. cajan)[54]
Soybean (G. max)[55,56,57]
Urdbean (V. mungo)[58,59,60]
Wild mungbean (V. radiata var. sublobata)[36]
Wild urdbean (V. mungo var. silvestris)[35]
Cucumber (Cucumis sativus)[61]
Ageratum conizoides[37,60,62]
Corchorus olitorius[37,60,62]
A. sessilis[37,60,62]
HgYMVCommon bean (P. vulgaris)[63]
Pole bean (Phaseolus coccineus)[63]
Soybean (G. max)[63]
Lima bean (P. lunatus)[63]
Rice bean (Vigna umbellata)[63]
Moth bean (Vigna aconitifolia)[21,63]
Table 2. The inheritance pattern of different LYMVs.
Table 2. The inheritance pattern of different LYMVs.
DiseaseCross CombinationsPopulation TypePopulation SizeInheritance PatternReferences
Yellow Mosaic Disease (YMD)NM 1-32-1 × NM 6-68-2F2150Two major genes with additive effects[114]
MYMIV DiseaseKPS2 × NM10-12-1RILs122QTL[17]
BM1 × BM6F2QTL[112]
MYMV DiseaseNM92 × VC2272F2300Single recessive gene[115]
6601 × VC2272F2240Single recessive gene[115]
6601 × Pusa BaisakhiF2240Single recessive gene[115]
VC3902A × NM92F2340Single recessive gene[115]
VC3902A × ML-5F2360Single recessive gene[115]
NM92 × Pusa BaisakiF2220Single recessive gene[115]
VC 1560D × 6601F2400Single recessive gene[115]
VC 1560D × NM92F2400Single recessive gene[115]
NM 92 × NM 98F2Single recessive gene[116]
VBN(Gg)2 × KMG189F2/RILsSingle recessive gene[51]
Table 3. PCR based molecular diagnostics of viruses causing LYMVs.
Table 3. PCR based molecular diagnostics of viruses causing LYMVs.
Primer NameAccession NumberForward-SequenceReverse-SequenceProduct Size (bps)Detected DNAReferences
NM 1 (AV1P) F/NM 2 (AV1P) RFJ821189GTA TTT GCA KCA WGT TCA AGAAGG DGT CAT TAG CTT AGC1000MYMIV/DNA A[35,37]
AC1PFJ663015AGT TGA TAT GGA TGT AATAGC3ACA AAA ACG ACT TCA AATATG CCA A1100MYMIV/DNA A[35,37]
MYMIV-MPFJ663015ATG GAA AAT TAT TCA GGT GCACTA CAA CGC TTT GTT CAC ATT900MYMIV/DNA B[35,37]
AC2PFJ663015AGC TAA TGA CCC CTA AAT TATGAG TAC TTG GAT GAA GAG AAC480MYMIV/DNA A[35,37]
AC3PFJ663015TTA TGA TTC GAT ATT GAA TTA ATACTG AAG TGTGGG TGT AGC TAT450MYMIV/DNA A[35,37]
AC4PFJ663015CAA ATT ACAATT TAA GTT ATGACT TCT AGCCTT GTC AAC ACC AG390MYMIV/DNA A[35,37]
MYMV-Coat protein (CP)AY271896ATG GG (T/G) TCC GTT GTA TGC TTGGGC GTC ATT AGC ATA GGC AAT1000MYMV/DNA A[35,37]
MYMV-MPAY271896ATG GAG AAT TAT TCA GGC GCATTA CAA CGC TTT GTT CAC ATT900MYMV/DNA B[35,37]
HYMV-CPNC_005635ATG CTT GCA ATT AAG TAC TTG CATAG GCG TCA TTA GCA TAG GCA1050HgYMV/DNA A[35,37]
HYMV-MPNC_005635ATG GAG CAT TAT TCC GGT GCATTA CA(G/A) GGT TTT GTT TAC AGT900HgYMV/DNA B[35,37]
DoYMV-CPAY309241CTG TGA AAT TTG TGC AGGTAC GCG GTT GCG AAT ATG TAT900DoYMV/DNA A[35,37]
Rep VIAF361431.1AATGTAAAAGGCGACTCATAGAGAATTCACCGGTCGCGGGGCA566MYMIV[38]
CPAY271896ACACGAGCTCCTCTACCCCGATATCGAATGACACGGATCCGTTGCATACACAGGATTTG750MYMV/DNA-A[39]
Deng-F/RTAATATTACC(GT)G(AT)(GT)G(AGC)CC(GC)CTAATATTACC(GT)G(AT)(GT)G(AGC)CC(GC)CCCTTCACA530MYMIV/partial DNA A[40]
PAL1v1978/PAR 1c496GCATCTGCAGGCCCACATYGTCTTYCCNGTAATACTGCAGGGCTTYCTRTACATRGG1.5 kbpMYMIV/partial DNA A[40]
AV 494/AC 1048FJ821189GCC(C/T)AT(G/A)TA(T/C)AG(A/G)AAGCC(A/C)AGGG(A/G)TT(A/G/T)GA(G/A)GCATG(T/A/C)GTACATG500–600 bpMYMIV/partial DNA A[40]
AC-abut/AV-abutMF818048.1GTAAAGCTTTACGCATAATGAAAGCTTACATCCTCCAC2.7 kbpMYMIV Full length DNA A[40]
BV-abut/BC-abutMF818046.1CCAGGATCCAATGATGCCTATTGGATCCTGGAGATTCA2.7 kbpMYMIV Full length DNA B[40]
RHA-F/AC-abutTCAAGCTCCCGGTGCATGTTGCAGTAAAGCTTTACGCATAATG920 bpMYMIV Right half of DNA-A[40]
PAR1v772/1c1960GGNAARATHTGGATGGAACNGGNAARACNATGTGGGC1.1 kbMYMIV/DNA A[40]
Table 4. Agro-inoculation technique of artificial disease phenotyping against LYMVs.
Table 4. Agro-inoculation technique of artificial disease phenotyping against LYMVs.
VirusesLegume CropReferences
MYMVMungbean[15,51,131,146,147,148]
Urdbean[142]
MYMIVMungbean[9,149,150,151]
Urdbean[9,58,149]
Cowpea[9,149,150,152]
Pigeon pea[54]
HgYMVMoth bean[21]
Table 5. Candidate genes associated with LYMVs.
Table 5. Candidate genes associated with LYMVs.
Sl. No.Candidate Genes Associated with LYMVsFunction of GeneExpression in MYMIV Resistant Genotypes at Different Time IntervalsExpression in MYMIV Susceptible Genotypes at Different Time IntervalsReferences
1Allene oxide cyclase (AOC: XM_014661012.1), Allene oxide synthase (AOS: XM_017565246.1), Acyl activating enzyme 1 (AAE1: XM_014663780.1)Jasmonic acid biosynthesis pathwayUpregulatedDownregulated[59,167]
2Glycine-rich protein (GRP: XM_017558252.1), Proline-rich protein encoding gene (PRP: PRP-U72769.1), Hydroxy-proline-rich glycoprotein encoding gene (HRGP: XM_017559232.1)Cell wall synthesisUpregulatedDownregulated[59,167]
3Lipid transfer protein (LTPs: XM_014636461.1), PR proteins such as PR1 (JZ168313), PR2, PR3, PR4, PR5 (JZ168398)Pathogenesis-related proteinsUpregulatedDownregulated[59,167]
4Pyridoxin (PDX1: XM_014661423.1), Glutathione-S-transferases (GST: XM_014648972.2), Peroxiredoxins (JK086508.1), Cu/Zn superoxide dismutase (JZ168376.1), and Ferredoxin-like protein such as PRX (JZ168355.1), SOD, and TRXReactive oxygen scavengersPDX1 up and early expression of ROS genePDX1 Down but in the late expression of ROS genes[59,167]
5RUBISCO (XM_014661061.1), PEPC, ribose-5-phosphate isomerase and aldehyde dehydrogenase (JZ168331.1)Metabolic pathways genesUpregulatedDownregulated[59,167]
6WRKY transcription factorTranscription factorUpregulatedDownregulated[59,167]
7MAP kinase (JZ168283.1)Protein kinasesUpregulatedDownregulated[59,167,171]
8Drought responsive ESTs (CPRD2 and CPRD14: JZ168282.1)Drought responsiveUpregulatedDownregulated[59,167]
9Ubiquitin ligaseUbiquitin proteasome systemUpregulatedDownregulated[59,167]
10Ca2+ responsive calreticulins (CRTs) and calmodulins (CAM) (JZ168377)Ca2+ responseUpregulatedDownregulated[59,167]
11Phenylpropanoid pathway (PAL: JZ168300.1)Biosynthesis of ligninUpregulatedDownregulated[59,167]
12R gene NBS-LRR (JZ168271.1), HSP90 (JZ168383)Plant disease resistance against pathogensUpregulatedDownregulated[59,167]

Share and Cite

MDPI and ACS Style

Singh, C.M.; Singh, P.; Pratap, A.; Pandey, R.; Purwar, S.; Vibha; Douglas, C.A.; Baek, K.-H.; Mishra, A.K. Breeding for Enhancing Legumovirus Resistance in Mungbean: Current Understanding and Future Directions. Agronomy 2019, 9, 622. https://doi.org/10.3390/agronomy9100622

AMA Style

Singh CM, Singh P, Pratap A, Pandey R, Purwar S, Vibha, Douglas CA, Baek K-H, Mishra AK. Breeding for Enhancing Legumovirus Resistance in Mungbean: Current Understanding and Future Directions. Agronomy. 2019; 9(10):622. https://doi.org/10.3390/agronomy9100622

Chicago/Turabian Style

Singh, Chandra Mohan, Poornima Singh, Aditya Pratap, Rakesh Pandey, Shalini Purwar, Vibha, Colin Andrew Douglas, Kwang-Hyun Baek, and Awdhesh Kumar Mishra. 2019. "Breeding for Enhancing Legumovirus Resistance in Mungbean: Current Understanding and Future Directions" Agronomy 9, no. 10: 622. https://doi.org/10.3390/agronomy9100622

APA Style

Singh, C. M., Singh, P., Pratap, A., Pandey, R., Purwar, S., Vibha, Douglas, C. A., Baek, K.-H., & Mishra, A. K. (2019). Breeding for Enhancing Legumovirus Resistance in Mungbean: Current Understanding and Future Directions. Agronomy, 9(10), 622. https://doi.org/10.3390/agronomy9100622

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop