Effects of Soil Disinfection Using Chlorine Dioxide on Soil Fungal Communities in Apple Replant Fields and the Growth of Malus hupehensis Rehd. Seedlings
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Materials
2.2. Pot Experiment
2.3. Field Experiment
2.4. Determination of Indices and Methods
2.4.1. Determination of the Inhibitory Effect of Chlorine Dioxide on Pathogenic Fungi
2.4.2. Determination of Biomass
2.4.3. Determination of Root System Architecture Parameters
2.4.4. Determination of Antioxidant Enzyme Activity in Roots
2.4.5. Determination of Soil Microorganisms
2.4.6. Determination of Soil Phenolic Acid Content
2.4.7. Determination of Chloride Ion Content in Soil
2.4.8. Real-Time Quantitative Analysis (RT-qPCR)
2.4.9. Analysis of Soil Microbial Community Structure
2.5. Data Analysis
3. Results
3.1. Effects of Chlorine Dioxide on Mycelial Growth and Spore Germination of Pathogenic Fungi
3.2. Effect of Chlorine Dioxide on the Growth of Grafted Seedlings in the Field Experiment
3.3. Effects of Different Treatments on the Root Architecture of M. hupehensis Rehd. Seedlings
3.4. Effects of Different Treatments on Antioxidant Enzyme Activity and MDA Content in Roots of M. hupehensis Rehd. Seedlings
3.5. Effects of Different Treatments on the Number of Soil Microorganisms
3.6. Effects of Different Treatments on the Number of Pathogenic Fungi in Soil
3.7. Effects of Different Treatments on Soil Chloride Content
3.8. Effects of Different Treatments on Soil Phenolic Acid Content
3.9. Effects of Chlorine Dioxide Application on Soil Microbial Community Structure
3.10. Effects of Chlorine Dioxide Treatment on Apple Sapling Biomass
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Mao, Z.; Wang, Y. Apple replant disease: Causes and management. In Integrated management of Diseases and Insect Pests of Tree Fruit; Burleigh Dodds Science Publishing: Cambridge, UK, 2019; pp. 39–58. [Google Scholar]
- Traud, W.; Felix, M.-D. Apple replant disease—new insights into an old problem. In XXXI International Horticultural Congress (IHC2022): International Symposium on Innovative Perennial Crops Management 1366; International Society for Horticultural Science (ISHS): Korbeek-Lo, Belgium, 2023; pp. 369–376. [Google Scholar]
- Wang, H.; Tang, W.; Mao, Y.; Ma, S.; Chen, X.; Shen, X.; Yin, C.; Mao, Z. Isolation of Trichoderma virens 6PS-2 and its effects on Fusarium proliferatum f. sp. Malus domestica MR5 related to apple replant disease (ARD) in China. Hortic. Plant J. 2022, 10, 1291–1308. [Google Scholar] [CrossRef]
- Annmarie-Deetja, R.; Jannika, S.; Katharina, C.; Annabel, F.; Michaela, S.; Traud, W. Split-root approach reveals localized root responses towards apple replant disease (ARD) in terms of ARD biomarker gene expression and content of phenolic compounds. Sci. Hortic. 2021, 286, 110117. [Google Scholar]
- Tang, W.; Wang, G.; Chen, R.; Liu, X.; Chen, X.; Shen, X.; Yin, C.; Mao, Z. Allium fistulosum L. Alleviates Apple Replant Disease by Suppressing Fusarium solani. J. Fungi 2022, 8, 1071. [Google Scholar] [CrossRef]
- Wang, G.; Yin, C.; Pan, F.; Wang, X.; Xiang, L.; Wang, Y.; Wang, J.; Tian, C.; Chen, J.; Mao, Z. Analysis of the Fungal Community in Apple Replanted Soil Around Bohai Gulf. Hortic. Plant J. 2018, 4, 175–181. [Google Scholar] [CrossRef]
- Duan, Y.N.; Jiang, W.T.; Zhang, R.; Chen, R.; Chen, X.S.; Yin, C.M.; Mao, Z.Q. Discovery of Fusarium proliferatumf. sp.malus domestica Causing Apple Replant Disease in China. Plant Dis. 2022, 106, 2958–2966. [Google Scholar] [CrossRef] [PubMed]
- Jiang, W.; Chen, R.; Zhao, L.; Qin, L.; Fan, H.; Chen, X.; Wang, Y.; Yin, C.; Mao, Z. Chemical fumigants control apple replant disease: Microbial community structure-mediated inhibition of Fusarium and degradation of phenolic acids. J. Hazard. Mater. 2022, 440, 129786. [Google Scholar] [CrossRef] [PubMed]
- Jiang, W.; Chen, R.; Zhao, L.; Duan, Y.; Wang, H.; Yan, Z.; Shen, X.; Chen, X.; Yin, C.; Mao, Z. Isolation of phloridzin-degrading, IAA-producing bacterium Ochrobactrum haematophilum and its effects on the apple replant soil environment. Hortic. Plant J. 2023, 9, 199–208. [Google Scholar] [CrossRef]
- Geng, W.; Lv, Y.; Duan, Y.; Wang, H.; Jiang, W.; Zhang, R.; Chen, R.; Chen, X.; Shen, X.; Yin, C.; et al. Preparation of composite microbial culture and its biocontrol effect on apple replant disease. Sci. Hortic. 2022, 303, 111236. [Google Scholar] [CrossRef]
- Larry, R.B.; Charles, A.P.; Mario, E.T.; Brian, J.R.; Alan, J.S. Lethality of chlorine, chlorine dioxide, and a commercial fruit and vegetable sanitizer to vegetative cells and spores of Bacillus cereus and spores of Bacillus thuringiensis. J. Ind. Microbiol. Biotechnol. 2005, 67, 1702–1708. [Google Scholar]
- Vipin, K.R.; Shawn, R.; Lalena, W.; Lisa, S.S.; Saumil, S.S.; Gérard, B.M. Systematic Evaluation of the Efficacy of Chlorine Dioxide in Decontamination of Building Interior Surfaces Contaminated with Anthrax Spores. Appl. Environ. Microbiol. 2010, 76, 3343–3351. [Google Scholar]
- Sun, W.; Hu, K.; Wang, H.; Wang, J.; Yang, G.; Wang, K.; Guo, L.; Zhang, F.; Lin, G.; Yi, H.; et al. Advances in Research on Sustained-Release Chlorine Dioxide Solid Preparations. In Advances in Graphic Communication, Printing and Packaging Technology and Materials: Proceedings of 2020 11th China Academic Conference on Printing and Packaging; Springer: Singapore, 2021; pp. 822–829. [Google Scholar]
- Zhang, Y.X.; Xiang, J.L.; Wang, J.J.; Du, H.S.; Wang, T.T.; Huo, Z.Y.; Wang, W.L.; Liu, M.; Du, Y. Ultraviolet-based synergistic processes for wastewater disinfection: A review. J. Hazard. Mater. 2023, 453, 131393. [Google Scholar] [CrossRef]
- Qu, W.; Zheng, W.; Wang, S.; Wang, Y. China’s new national standard for drinking water takes effect. Lancet 2012, 380, e8. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Zhang, R.; Mao, Y.; Jiang, W.; Chen, X.; Shen, X.; Yin, C.; Mao, Z. Effects of Trichoderma asperellum 6S-2 on Apple Tree Growth and Replanted Soil Microbial Environment. J. Fungi 2022, 8, 63. [Google Scholar] [CrossRef]
- Xiong, W.; Li, R.; Guo, S.; Karlsson, I.; Jiao, Z.; Xun, W.; Kowalchuk, G.A.; Shen, Q.; Geisen, S. Microbial amendments alter protist communities within the soil microbiome. Soil Biol. Biochem. 2019, 135, 379–382. [Google Scholar] [CrossRef]
- Norio, O. Denaturation of Protein by Chlorine Dioxide: Oxidative Modification of Tryptophan and Tyrosine Residues. Biochemistry 2007, 46, 4898–4911. [Google Scholar]
- Kacper, K.; Grzegorz, B.; Izabela, S.-B. Denaturation and Digestion Increase the Antioxidant Capacity of Proteins. Processes 2023, 11, 1362. [Google Scholar] [CrossRef]
- Isaac Kwesi, O.; Suresh, M.; Jianping, L.; Sreekantha, B.J. Chlorine dioxide oxidation of Escherichia coli in water—A study of the disinfection kinetics and mechanism. J. Environ. Sci. Health 2017, 52, 598–606. [Google Scholar]
- Xia, Q.; Jiang, W.; Liu, S.; Qin, L.; Zhao, G.; Li, Z.; Yin, C.; Mao, Z.; Wang, Y. Effects of Crystal Lime Sulfur Fumigation and Application of Root-Growth-Promoting Agents on the Control of Apple Replant Disease. Horticulturae 2023, 9, 901. [Google Scholar] [CrossRef]
- Tang, W.; Zhang, R.; Wang, M.; Wang, H.; Ding, F.; Chen, X.; Shen, X.; Yin, C.; Mao, Z. Effects of two apple rootstocks on the soil microecology of replanted apple orchard soil. Sci. Hortic. 2024, 324, 112640. [Google Scholar] [CrossRef]
- Yu, L.; Chu, H.; Zhu, Z.; Jiang, L.; Dong, H. Determination of the chloride ion content in concrete under simultaneous chloride and sulphate ion attack. J. Build. Eng. 2023, 72, 106579. [Google Scholar] [CrossRef]
- Amanda, J.B.; Gary, D.B.; David, C.; Sally, H.; Peter, R.M. Meeting the demand for crop production: The challenge of yield decline in crops grown in short rotations. Biol. Rev. 2011, 87, 52–71. [Google Scholar]
- Wang, X.; Yao, Y.; Wang, G.; Lu, H.; Ma, J.; Zhang, M.; Chen, X.; Yin, C.; Mao, Z. Controlled-Release Diammonium Phosphate Alleviates Apple Replant Disease: An Integrated Analysis of Soil Properties, Plant Growth, and the Soil Microbiome. J. Agric. Food Chem. 2022, 70, 8942–8954. [Google Scholar] [CrossRef] [PubMed]
- Chen, R.; Jiang, W.; Wang, H.; Pan, F.; Fan, H.; Chen, X.; Shen, X.; Yin, C.; Mao, Z. Effects of Different Fumigants on the Replanted Soil Environment and Growth of Malus hupehensis Rehd. Seedlings. Hortscience 2021, 56, 491–499. [Google Scholar] [CrossRef]
- Pan, L.; Zhao, L.; Jiang, W.; Wang, M.; Chen, X.; Shen, X.; Yin, C.; Mao, Z. Effect of Zinc Oxide Nanoparticles on the Growth of Malus hupehensis Rehd. Seedlings. Front. Environ. Sci. 2022, 10, 835–994. [Google Scholar] [CrossRef]
- Wang, Y.; Pan, F.; Wang, G.; Zhang, G.; Wang, Y.; Chen, X.; Mao, Z. Effects of biochar on photosynthesis and antioxidative system of Malus hupehensis Rehd. seedlings under replant conditions. Sci. Hortic. 2014, 175, 9–15. [Google Scholar] [CrossRef]
- Liu, L.; Li, J.; Wu, G.; Shen, H.; Fu, G.; Wang, Y. Combined effects of biochar and chicken manure on maize (Zea mays L.) growth, lead uptake and soil enzyme activities under lead stress. PeerJ 2021, 9, e11754. [Google Scholar] [CrossRef]
- Colmenero-Flores, J.M.; Franco-Navarro, J.D.; Cubero-Font, P.; Peinado-Torrubia, P.; Rosales, M.A. Chloride as a Beneficial Macronutrient in Higher Plants: New Roles and Regulation. Int. J. Mol. Sci. 2019, 20, 4686. [Google Scholar] [CrossRef] [PubMed]
- Christoph-Martin, G. Chloride in soil: From nutrient to soil pollutant. Environ. Exp. Bot. 2019, 157, 299–309. [Google Scholar]
- Tavakkoli, E.; Rengasamy, P.; McDonald, G.K. High concentrations of Na+ and Cl– ions in soil solution have simultaneous detrimental effects on growth of faba bean under salinity stress. J. Exp. Bot. 2010, 61, 4449–4459. [Google Scholar] [CrossRef] [PubMed]
- Christoph-Martin, G. Chloride: From Nutrient to Toxicant. Plant Cell Physiol. 2018, 59, 877–886. [Google Scholar]
- Duan, Y.; Zhao, L.; Jiang, W.; Chen, R.; Zhang, R.; Chen, X.; Yin, C.; Mao, Z. The Phlorizin-Degrading Bacillus licheniformis XNRB-3 Mediates Soil Microorganisms to Alleviate Apple Replant Disease. Front. Microbiol. 2022, 13, 839484. [Google Scholar] [CrossRef] [PubMed]
- Chen, R.; Jiang, W.; Liu, Y.; Wang, Y.; Fan, H.; Chen, X.; Shen, X.; Yin, C.; Mao, Z. Amygdalin and Benzoic Acid on the Influences of the Soil Environment and Growth of Malus hupehensis Rehd. Seedlings. ACS Omega 2021, 6, 12522–12529. [Google Scholar] [CrossRef]
- Zibo, L.; Junfan, F.; Rujun, Z.; Dan, W. Effects of phenolic acids from ginseng rhizosphere on soil fungi structure, richness and diversity in consecutive monoculturing of ginseng. Saudi J. Biol. Sci. 2018, 25, 1788–1794. [Google Scholar]
- Gniazdowska, A.; Krasuska, U.; Andrzejczak, O.; Soltys, D. Allelopathic compounds as oxidative stress agents: YES or NO. React. Oxyg. Nitrogen Species Signal. Commun. Plants 2015, 155–176. [Google Scholar]
- Liu, Y.; Wang, C.; Chen, R.; Jiang, W.; Li, Y.; Yin, C.; Wang, Y.; Mao, Z. Biochar alleviates apple replant disease by reducing the growth of Fusarium oxysporum and regulating microbial communities. Hortic. Plant J. 2023, 10, 657–671. [Google Scholar] [CrossRef]
- Zhu, Y.; Shin, S.; Mazzola, M. Genotype responses of two apple rootstocks to infection by Pythium ultimum causing apple replant disease. Can. J. Plant Pathol. 2016, 38, 483–491. [Google Scholar] [CrossRef]
- Tilston, E.L.; Deakin, G.; Bennett, J.; Passey, T.; Harrison, N.; O’Brien, F.; Fernández-Fernández, F.; Xu, X. Candidate Causal Organisms for Apple Replant Disease in the United Kingdom. Phytobiomes J. 2018, 2, 261–274. [Google Scholar] [CrossRef]
Species | Primer | F (5′-3′) |
---|---|---|
F. oxysporum | JF | CATACCACTTGTTGTCTCGGC |
JR | CGCCGCGTACCAGTTGCGAGGGT | |
F. solani | FF | CGAGTTATACAACTCATCAACC |
FR | GGCCTGAGGGTTGTAATG | |
F. proliferatum | CHF | GATCGGCGAGCCCTTGCGGCAAG |
CHR | GGGGTTTAACGGCGTGGCC | |
F. moniliforme | CF | GACTCGCGAGTCAAATCGCGT |
CR | GAACGCGAATTAACGCGAGTC |
Chlorine Dioxide Concentration (ClO2, mg·L−1) | F. oxysporum | F. solani | F. proliferatum | F. moniliforme | ||||
---|---|---|---|---|---|---|---|---|
Colony Diameter (cm) | Inhibitory Rate (%) | Colony Diameter (cm) | Inhibitory Rate (%) | Colony Diameter (cm) | Inhibitory Rate (%) | Colony Diameter (cm) | Inhibitory Rate (%) | |
0 | 8.17 ± 0.09 a | —— | 7.77 ± 0.03 a | —— | 8.20 ± 0.10 a | —— | 8.27 ± 0.03 a | —— |
50 | 7.23 ± 0.03 b | 11.46 | 6.60 ± 0.10 b | 15.06 | 7.23 ± 0.12 b | 11.79 | 7.50 ± 0.20 b | 9.20 |
100 | 6.63 ± 0.13 c | 18.81 | 6.17 ± 0.19 c | 20.63 | 6.80 ± 0.06 c | 17.07 | 6.87 ± 0.23 c | 16.87 |
150 | 6.17 ± 0.18 d | 24.52 | 5.70 ± 0.06 d | 26.64 | 6.53 ± 0.07 cd | 20.33 | 6.23 ± 0.15 d | 24.54 |
200 | 5.20 ± 0.12 e | 36.35 | 5.13 ± 0.07 e | 33.93 | 6.27 ± 0.13 d | 23.58 | 5.60 ± 0.10 e | 32.20 |
400 | 3.73 ± 0.12 f | 54.30 | 4.07 ± 0.26 f | 47.66 | 5.67 ± 0.07 e | 30.89 | 4.67 ± 0.09 f | 43.50 |
600 | 2.83 ± 0.09 g | 65.32 | 3.30 ± 0.12 g | 57.53 | 4.53 ± 0.15 f | 44.72 | 3.63 ± 0.32 g | 56.01 |
Chlorine Dioxide Concentration (ClO2, mg·L−1) | F. oxysporum | F. solani | F. proliferatum | F. moniliforme | ||||
---|---|---|---|---|---|---|---|---|
Germination Rate (%) | Inhibitory Rate (%) | Germination Rate (%) | Inhibitory Rate (%) | Germination Rate (%) | Inhibitory Rate (%) | Germination Rate (%) | Inhibitory Rate (%) | |
0 | 93.50 ± 1.04 a | —— | 96.00 ± 0.58 a | —— | 95.33 ± 1.17 a | —— | 93.83 ± 0.73 a | —— |
50 | 66.33 ± 1.86 b | 29.06 | 66.17 ± 1.45 b | 31.08 | 51.83 ± 1.01 b | 45.63 | 74.67 ± 1.74 b | 20.42 |
100 | 52.00 ± 2.00 c | 44.39 | 51.67 ± 0.88 c | 46.18 | 38.17 ± 1.92 c | 59.96 | 56.00 ± 2.65 c | 40.32 |
150 | 34.00 ± 2.36 d | 63.64 | 30.83 ± 2.32 d | 67.88 | 22.33 ± 0.60 d | 76.57 | 43.00 ± 1.04 d | 54.17 |
200 | 8.00 ± 1.15 e | 91.44 | 1.50 ± 0.29 e | 98.44 | 1.67 ± 0.17 e | 98.25 | 26.17 ± 1.64 e | 72.11 |
400 | 0.00 ± 0.00 f | 100.00 | 0.00 ± 0.00 e | 100.00 | 0.00 ± 0.00 e | 100.00 | 2.00 ± 0.50 f | 97.87 |
600 | 0.00 ± 0.00 f | 100.00 | 0.00 ± 0.00 e | 100.00 | 0.00 ± 0.00 e | 100.00 | 0.00 ± 0.00 f | 100.00 |
Sampling Time | Treatments | Plant Height | Stem Diameter |
---|---|---|---|
(cm) | (mm) | ||
2022.07 | CK | 39.23 ± 0.87 c | 5.08 ± 0.11 c |
R1 | 49.53 ± 1.41 b | 6.41 ± 0.17 b | |
CK1 | 55.47 ± 0.84 a | 7.40 ± 0.06 a | |
2022.08 | CK | 52.20 ± 1.65 c | 7.65 ± 0.38 c |
R1 | 66.40 ± 1.89 b | 8.87 ± 0.16 b | |
CK1 | 78.73 ± 1.13 a | 9.79 ± 0.12 a |
Types of Phenolic Acid (mg·kg−1) | CK | R1 | CK1 |
---|---|---|---|
Vanillic acid | 18.80 ± 1.50 a | 17.73 ± 1.56 a | 11.46 ± 0.79 b |
Syringic acid | 7.25 ± 0.30 a | 5.27 ± 0.12 b | 1.45 ± 0.28 c |
Vanillin | 1.54 ± 0.03 a | 1.39 ± 0.04 b | 0.87 ± 0.02 c |
Ferulic acid | 7.59 ± 0.25 a | 4.30 ± 0.33 b | 3.24 ± 0.47 b |
Benzoic acid | 13.64 ± 0.12 a | 4.22 ± 0.67 c | 10.55 ± 1.35 b |
Coumarin | 0.27 ± 0.03 a | 0.23 ± 0.02 a | 0.15 ± 0.01 b |
Phloretin | 3.17 ± 0.45 a | 1.26 ± 0.11 b | 1.42 ± 0.01 b |
Phlorizin | 3.28 ± 0.08 a | 1.65 ± 0.06 b | 1.31 ± 0.27 b |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, G.; Xie, Y.; Lv, J.; Zhang, S.; Yin, C.; Liu, Y.; Mao, Z. Effects of Soil Disinfection Using Chlorine Dioxide on Soil Fungal Communities in Apple Replant Fields and the Growth of Malus hupehensis Rehd. Seedlings. Agronomy 2025, 15, 59. https://doi.org/10.3390/agronomy15010059
Wang G, Xie Y, Lv J, Zhang S, Yin C, Liu Y, Mao Z. Effects of Soil Disinfection Using Chlorine Dioxide on Soil Fungal Communities in Apple Replant Fields and the Growth of Malus hupehensis Rehd. Seedlings. Agronomy. 2025; 15(1):59. https://doi.org/10.3390/agronomy15010059
Chicago/Turabian StyleWang, Gongshuai, Yuxin Xie, Jinhui Lv, Susu Zhang, Chengmiao Yin, Yusong Liu, and Zhiquan Mao. 2025. "Effects of Soil Disinfection Using Chlorine Dioxide on Soil Fungal Communities in Apple Replant Fields and the Growth of Malus hupehensis Rehd. Seedlings" Agronomy 15, no. 1: 59. https://doi.org/10.3390/agronomy15010059
APA StyleWang, G., Xie, Y., Lv, J., Zhang, S., Yin, C., Liu, Y., & Mao, Z. (2025). Effects of Soil Disinfection Using Chlorine Dioxide on Soil Fungal Communities in Apple Replant Fields and the Growth of Malus hupehensis Rehd. Seedlings. Agronomy, 15(1), 59. https://doi.org/10.3390/agronomy15010059