Next Article in Journal
Energy Saving Technologies and Practices in Facility Agriculture in Cold Regions
Next Article in Special Issue
Integrative Transcriptomic and Metabolomic Analysis Reveals Regulatory Networks and Metabolite Dynamics in Gastrodia elata Flower Development
Previous Article in Journal
Effects of Elevated CO2 on Maize Physiological and Biochemical Processes
Previous Article in Special Issue
Analysis of Transcriptional and Metabolic Differences in the Petal Color Change Response to High-Temperature Stress in Various Chrysanthemum Genotypes
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 15
Issue 1
10.3390/agronomy15010203
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification and Analysis of Melon (Cucumis melo L.) SHMT Gene Family Members and Their Functional Studies on Tolerance to Low-Temperature Stress

by
Yanmin Liu
†,
Dandan He
†,
Yizhou Wu
,
Kangqi Zhao
,
Changyi Yang
,
Yulu Zhong
,
Liuyang Yang
,
Haiyue Niu
and
Sushuang Liu
*
Department of Life Sciences and Health, Huzhou College, Huzhou 313000, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Agronomy 2025, 15(1), 203; https://doi.org/10.3390/agronomy15010203
Submission received: 12 December 2024 / Revised: 11 January 2025 / Accepted: 14 January 2025 / Published: 15 January 2025
(This article belongs to the Special Issue Progress in Horticultural Crops—from Genotype to Phenotype—2nd Edition)
Browse Figures
Versions Notes

Abstract

:
Melon (Cucumis melo L.) is a significant cash crop globally and is cherished for its sweet and flavorful fruits, as well as its high nutritional values. However, its yield and quality are limited by various factors, including drought, salinity, and low temperatures. Low temperatures are one of the primary factors influencing the growth and development of melons, diminishing the viability, germination, and growth rate of melon seeds. Concurrently, low temperatures also reduce light absorption efficiency and fruit yields, thereby affecting melon growth and development. Serine hydroxymethyltransferase (SHMT), a conserved phosphopyridoxal-dependent enzyme, plays a crucial role in plant resistance to abiotic stressors. In this study, eight CmSHMT family genes were identified from the melon genome. We predicted their chromosomal locations, physicochemical properties, gene structures, evolutionary relationships, conserved motifs, cis-acting elements of promoters, and tissue-specific expression patterns. The expression levels of CmSHMT family genes in response to low-temperature stress was then analyzd using qRT-PCR. The phylogenetic results indicated that these CmSHMT genes were classified into four subfamilies and were unevenly distributed across five chromosomes, with relatively high conservation among them. Furthermore, our investigation revealed that the promoter regions of the CmSHMT family genes contain many cis-acting elements related to phytohormones, growth, and various stress responses. The relative expression levels of CmSHMT3, CmSHMT4, CmSHMT6, and CmSHMT7 were higher under low-temperature stress compared to the control group. Notably, the promoter region of CmSHMT3 contains cis-acting elements associated with low-temperature response (LTR) and abscisic acid response (ABRE). It is suggested that the mechanism through which CmSHMT3 responds to low-temperature stress treatments may be associated with hormonal regulation. These findings provide a foundation for the further exploration of CmSHMT family genes in melon and their functional roles in response to low-temperature stress, and they provide a theoretical basis for the targeted breeding of superior melon varieties with enhanced tolerance to low temperatures.

1. Introduction

Serine hydroxymethyltransferase (SHMT) is a highly conserved enzyme that depends on phosphopyridoxal for its catalytic activity. It serves as a catalyst for the interconversion between serine and glycine. In nature, the functional form of SHMT is usually found as a dimer in prokaryotes and as a tetramer in eukaryotes [1,2]. Numerous studies involving humans and animals have revealed SHMT’s role in folate metabolism with a range of diseases, including tumors [3], ischemic stroke [4], and neurodegeneration [5]. Specifically, SHMT facilitates the conversion of L-serine and tetrahydrosphenoylglutamate (H4PteGlu) into glycine and 5,10-methylene-tetrahydrosphenoylglutamate (5,10-CH2-H 4PteGlu), thereby playing a critical role in one-carbon unit metabolism. SHMT is also considered a potential therapeutic target for cancer [6]. Furthermore, the SHMT gene in bacteria may contribute to mitigating damage from salt and oxidative stress in bacteria thus enhancing their tolerance to salinity [7,8]. In contrast, research on SHMT in plant systems remains relatively scarce.
SHMT is a key enzyme involved in plant photorespiration. Within leaf tissues, SHMT facilitates the interconversion of glycine and serine to generate carbon units; it is essential for methyl biosynthesis, nucleotide synthesis, and folate and amino acid metabolism [9,10]. The interaction between mitochondrial SHMT protein and chaperonins 60α1 (SlCPN60α1) in tomatoes has been shown to participate in regulating both photorespiration and photosynthesis processes within tomatoes [11]. Additionally, poplar PtSHMT2 exhibits high expression levels within xylem tissue. In transgenic poplar overexpressing PdSHMT2, a significant increase in biomass and sugar content was observed, which may be attributed to the growth-promoting effect of PdSHMT2 on poplar [1]. Arabidopsis SHMT5 has been observed to interact with specific endogenous compounds such as 5-Methyltetrahydrofolate and 5-formyltetrahydrofolate involved in one-carbon metabolic pathways, suggesting that SHMT5 may also be involved in fruit development and ripening [12]. All these findings demonstrate that SHMT has essential functions in regulating growth, development, and metabolic activities across a wide range of plant species. The existing literature on SHMT is primarily focused on poplar [1], Arabidopsis thaliana [12], soybeans [13], rice [14], wheat [15], alfalfa [16], and cucumbers [17]. Most previously published papers on SHMT in plants have been conducted in response to various forms of biological and abiotic stress. In studies of biological stress, the GmSHMT08 gene in soybeans was found to be closely related to resistance to soybean cyst nematodes (SCN) [13]. In rice, OsSHMT1 interacts with OsRSR1-CC through an antioxidant system (glutathione (GSH)–-ascorbic acid (AsA)) [14], and it may be important in enhancing rice resistance to rice sheath blight (RSB). The shmt1-1 mutant of Arabidopsis has been observed to exhibit increased susceptibility to infection by diverse pathogens such as Pseudomonas syringae pv, Alternaria brassicicola, and Botrytis cinerea, accompanied by conspicuous yellowing relative to the necrosis of leaves [18]. In addition, studies in Arabidopsis [18], tomatoes [10], cucumbers [17], wheat [15], and rice [19] have demonstrated that SHMT promotes abiotic stress responses in plants. Wheat TaSHMT genes have been shown to exhibit active responses to abiotic stresses, including PEG, NaCl, ABA, and low temperatures [15]. Arabidopsis AtSHMT1 plays a critical role in mitigating cellular damage resulting from bright light and salt [18]. Mutations in SHMT1 result in damage to chlorophyll, increasing the sensitivity of Arabidopsis leaves to salt and also causing the accumulation of hydrogen peroxide (H2O2) in leaves [20]. The tomato SHMT gene has been shown to exhibit a robust response to various abiotic stressors, including ultraviolet (UV) radiation, temperature extremes, and abscisic acid (ABA). The differential expression of SlSHMT genes under various stress conditions suggests their potential roles in the regulation of plant stress responses [10]. Furthermore, OsSHMT1 has been demonstrated to improve the tolerance to low temperatures in rice by facilitating the removal of H2O2 [21]. Arabidopsis transgenics overexpressing OsSHMT3 have been observed to enhance salt tolerance [19]. CsSHMT3 expression levels in cucumbers stressed by both drought and salt stress were significantly increased. Among these, CsSHMT3 in chloroplasts was able to positively regulate cucumber tolerance to salt stress by modulating osmotic balance, photosynthetic efficiency, reactive oxygen species metabolism, and the expression of stress-related genes [17]. In conclusion, SHMT serves as a pivotal regulator in the orchestration of plant growth and metabolic processes. Investigating the mechanisms that confer resistance to biotic and abiotic stresses is of significant importance.
Melon fruit (Cucumis melo L.) is sweet and nutritious, which is why it is very popular among people worldwide. Due to its high demand, melon is widely cultivated and serves as an important cash crop globally [22,23,24]. The optimal growing temperature for melon is 25–35 °C [25,26]. When temperatures are as low as 15 °C, melon growth is significantly reduced [27]. Low temperatures can inhibit melon growth and development to a certain extent, leading to leaf wilting, and the root system of melon may become dormant when temperatures drop below 8 °C [28,29]. Furthermore, low temperatures also impact plant height, stem thickness, leaf area, and root growth. Low temperatures reduce photosynthetic and growth rates and thus lower fruit quality and yield [30,31]. In many plants, such as Arabidopsis, tomatoes, cucumbers, wheat, and rice, as mentioned earlier, SHMT is crucial for their response to abiotic stress. However, the expression mechanisms of melon SHMT when stressed by low temperatures remain unclear. Therefore, identifying the CmSHMT genes and studying their expression patterns are of theoretical and practical significance in revealing the mechanism by which melon resists low-temperature stress. It also is helpful to cultivate low-temperature-tolerant melons. In this study, the SHMT family members in melon were identified, and their physicochemical properties, gene structures, evolutionary relationships, cis-acting elements, tissue-specific expression, and relative expression levels stressed by low temperatures were systematically analyzed. In summary, this study can be a solid reference for elucidating the molecular mechanism of CmSHMTs against low-temperature stress.

2. Preparation of Materials and Analytical Methods

2.1. Plant Materials and Treatments

The melon seed variety used was “Tongtian 4”, sourced from the Jiangsu Academy of Agricultural Sciences (Nanjing, China). The seeds were disinfected in a 3% sodium hypochlorite (NaClO) solution and then washed 5 times with sterile water. The seeds were then spread on moist filter paper. Subsequently, each germinated seed was transplanted into a pot containing a mixture of nutrient soil and vermiculite in a 5:1 ratio and cultivated at 25 °C with a 16 h/8 h (light/dark) cycle for approximately 30 days [32,33]. The low-temperature stress test was initiated when the seedlings had developed 3 to 5 euphyllas [34]. The melon seedlings were divided into a normal-temperature control group and a low-temperature treatment group. The normal control group was maintained at 25 °C with a 16 h/8 h (light/dark) cycle, while the treatment group was subjected to 4 °C under the same photoperiod during the study. Before starting treatment, various leaves were collected and designated as initial leaf samples. Subsequently, leaves from both the control and treatment groups were collected at 24 and 48 h after the treatment as additional samples. Immediately following collection, all samples were flash-frozen using liquid nitrogen and then stored at −80°C for further analysis.

2.2. Identifying and Analyzing the Physicochemical Properties of CmSHMT Members in Melon

The CuGenDBv2 genome database (http://www.cucurbitgenomics.org/, accessed on 10 July 2024) was used to download the melon genome file and protein sequences [35]. The Pfam protein family database (http://pfam.xfam.org/, accessed on 19 July 2024) was consulted to obtain a Hidden Markov Model (HMM) of SHMT (PF00464). Subsequently, the predicted CmSHMT gene was identified from the melon genome using HMMER 3.0 (E-value < 1 × 10−3). All duplicate and redundant sequences were then eliminated, and it was ascertained whether these candidate sequences contained the SHMT domain (PF00011) using Pfam, NCBI (https://www.ncbi.nlm.nih.gov/, visited on 19 July 2024), and SMART (http://smart.embl-heidelberg.de/, visited on 19 July 2024). The chromosomal location of CmSHMT served as the basis for naming the identified CmSHMT genes, for which their protein sequence information was submitted to Expasy (http://www.expasy.org/, accessed on 24 July 2024) to analyze parameters such as molecular mass, theoretical isoelectric point, instability coefficient, hydrophilicity index, and the amino acid sequence length of the CmSHMT protein. Finally, the subcellular localizations of CmSHMT proteins were predicted using WoLF PSORT (http://wolfpsort.hgc.jp/, visited on 24 July 2024).

2.3. Chromosome Distribution, Gene Structure, Conserved Motifs, Gene Repetition Events, and Interspecific Homology Analysis of CmSHMT Genes

The CuGenDBv2 database (http://www.cucurbitgenomics.org/, accessed on 1 August 2024) was used to obtain chromosomal information for melon, and TBtools (v.1.120) was employed to visualize the chromosomal localization of CmSHMT [36]. The Gene Structure Display Server website (GSDS 2.0, https://gsds.gao-lab.org/, assessed on 1 August 2024) was then used to explore and visualize the structural features of the CmSHMT genes. Subsequently, MEME (https://meme-suite.org/meme/, accessed on 1 August 2024) was used to predict conserved motifs within CmSHMTs, with the results visualized using TBtools (v.1.120). BLASTN results were used to identify gene duplications, which were further analyzed using MCScanX. The duplication events of these genes were visualized using the Circos of TBtools (v.1.120). Collinear blocks between melon and other plant genomes, such as soybean and cucumber, were detected and displayed via MCScanX (cscore ≥ 0.7) and finally visualized using TBtools (v.1.120).

2.4. The CmSHMT Protein–Protein Interaction Network

The protein sequences of the eight identified CmSHMT genes were searched for complete and representative transcriptional protein sequences in the STRING database (https://cn.string-db.org/, accessed on 5 August 2024). The CmSHMT protein–protein interaction (PPI) network was then analyzed and visualized.

2.5. The CmSHMT Gene Phylogenetic

The neighbor-joining method of MEGA11 was applied to integrate the downloaded SHMT protein sequences from soybeans [13], Arabidopsis [37], tomatoes [10], rice [38], and the identified melon in this study. A bootstrap validation parameter of 1000 replicates was utilized to construct a phylogenetic tree, and then, based on the results of the evolutionary tree’s clustering, length, and the relevant literature [10,13,37,38], the CmSHMT protein sequences were classified into different families. Finally, the Evol View online platform (https://www.evolgenius.info/, accessed on 16 August 2024) was used to edit and beautify phylogenetic trees.

2.6. Prediction of Promoter Cis-Acting Elements of CmSHMTs

The sequences 2000 bp upstream of the CmSHMT promoters in the melon genome were extracted using TBtools (v.1.120). Subsequently, these sequences were submitted to the PlantCARE database (http://bioinformatics.psb.ugent.be/, accessed on 17 August 2024) for the prediction of CmSHMT cis-acting elements. Further analysis and the screening of relevant hormones and stress-responsive elements were conducted. Finally, the analysis diagram of CmSHMT cis-acting elements was constructed using TBtools (v.1.120).

2.7. The Analysis of Tissue-Specific Expression of CmSHMT Genes

The CuGenDBv2 database (http://www.cucurbitgenomics.org/rnaseq/home, accessed on 20 August 2024) was used to download RNA-seq data (series accession number PRJNA383830) for CmSHMT in various tissues, including female flowers, fruits, male flowers, seeds, leaves, and roots. Subsequently, these data were submitted to the local TBtools software (v.1.120) for the generation of heatmaps.

2.8. The Melon RNA Isolation and Analysis via qRT-PCR

When melons reached the 3–5 euphyllas stage, low-temperature stress was applied, and control groups were established. Leaf samples were snap-frozen in liquid nitrogen at 0 h, 24 h, and 48 h post-treatment and stored at −80 °C, with three biological replicates for each time point (Section 2.1). Subsequently, the leaves of the samples were ground in liquid nitrogen, and total RNA was extracted using the RNAprep Pure Plant Kit (Kaitai Biotech, Hangzhou, China). We utilized the NanoDrop microvolume spectrophotometer from “Themo Fisher Scientific” to assess the quality and quantity of RNA. The ratio of A260/A280 between 1.8 and 2.0 (Supplementary file S1) was indicative of high-quality RNA suitable for subsequent experiments. CmEFla (accession number: XM_008459007.2) was used as the internal reference gene, and primer sequences were designed as shown in Table 1. cDNA was synthesized using M-MLV (Takara 2641U) PrimeScript™ reverse transcriptase (Kaitai Biotech, Hangzhou, China) with the reaction system outlined in Supplementary file S2. The quantitative PCR of the target genes was performed on a CFX96 Real-Time PCR Detection System (BioRad, Hercules, CA, USA). The reaction system was 10.0 μL, including 5 µL of 2 × SYBR Green pro TaqHS Premix (Kaitai Biotech, Hangzhou, China), 0.4 µL each of forward and reverse primers (10 µmol/L), 0.1 µL of 50 × ROX, 3.0 µL of ddH2O, and 1.0 µL of cDNA. The reaction protocol involved an initial denaturation step at 95 °C for 1 min, followed by 40 cycles of denaturation at 95 °C for 10 s and annealing at 60 °C for 60 s. Three technical replicates were set for each sample, with the mean Ct value calculated for each sample. The results were expressed as mean ± standard deviations (SDs). The 2−ΔΔCt method was utilized to determine the relative expression levels of SHMT in melon leaves under low-temperature conditions. Student’s t-test was used to compare the relative expression levels of genes between the control and treated groups, with a p-value < 0.05 indicating statistical significance. The data were visualized using GraphPad Prism 8 (accessed on 1 September 2024).

3. Results

3.1. Identification and Physicochemical Property Analysis of SHMT Gene in Melon

In this study, we screened and identified eight SHMT members from the melon genome database, all of which harbor the SHMT domain (PF00464). These were renamed from CmSHMT1 to CmSHMT8 based on their chromosomal sequence locations (Table 2). We further analyzed their physical–chemical properties and found that their amino acid residues ranged from 167aa (CmSHMT3) to 585aa (CmSHMT4), and their molecular weight, isoelectric point, and instability coefficient ranged from 19.06 kD (CmSHMT3) to 64.98 kD (CmSHMT4), 6.21 (CmSHMT2) to 9.44 (CmSHMT3), and 34.96 (CmSHMT7) to 51.91 (CmSHMT4). In addition, the protein encoded by CmSHMT2 is the only acidic protein in the group (pI < 7), while the others are basic proteins. Among the eight CmSHMT proteins analyzed, CmSHMT1, CmSHMT6, CmSHMT7, and CmSHMT8 were found to be stable, with instability coefficients below 40. In contrast, the remaining CmSHMT proteins were classified as unstable, with their instability coefficients above 40. The average hydrophilicity (GRAVY) index varied from −0.397 (CmSHMT4) to 0.061 (CmSHMT6). CmSHMT6 is considered a hydrophobic protein (GRAVY > 0), while the other CmSHMT proteins are hydrophilic (GRAVY < 0). Based on subcellular localization predictions, CmSHMT1, CmSHMT2, CmSHMT3, and CmSHMT7 are likely to play significant roles in photosynthesis, as they are all localized within chloroplasts. CmSHMT4 and CmSHMT5 appear in the nucleus of plants, while CmSHMT6 and CmSHMT8 are found in the cytoplasm and mitochondria, respectively.

3.2. Chromosome Distribution, Gene Structure, Conserved Motifs, Gene Repetition Events, and Interspecific Homology Analysis of CmSHMTs Gene

The CmSHMT genes are unevenly distributed across five chromosomes (Figure 1). Chromosome 6 contains two CmSHMT genes, CmSHMT3 and CmSHMT4. Chromosome 7 contains three CmSHMT genes, CmSHMT5, CmSHMT6 and CmSHMT7. The remaining chromosomes, 3, 5, and 8, each possess one CmSHMT gene. In addition, to analyze the structural characteristics of these genes, we searched for 12 motifs within the CmSHMTs and observed that partially clustered CmSHMTs had similar conserved motifs, while different conserved motifs existed between different CmSHMTs (Figure 2A). CmSHMT2, CmSHMT4, CmSHMT5, and CmSHMT7 all contain 11 conserved motifs, including motif8, motif1, motif10, motif4, motif5, motif11, motif3, motif2, motif7, motif6, and motif9. Besides these 11 motifs, CmSHMT8 also possesses an additional motif12. CmSHMT1, which also has motif 12, lacks motif 11. Most CmSHMT genes share 10 conserved motifs (motif8, motif1, motif10, motif4, motif5, motif3, motif2, motif7, motif6, and motif9), indicating that they are relatively conserved and evolutionarily closely related. The conserved motifs in different CmSHMTs exhibit individual differences, suggesting that the biological functions of CmSHMTs may also differ during evolution. CmSHMT3 and CmSHMT6 have a more unique structure than most CmSHMTs. CmSHMT3 contains only four conserved motifs: motif8, motif1, motif11, and motif3. CmSHMT6 only has four conserved motifs: motif2, motif6, motif12, and motif9. According to the gene structure’s graphical results, these CmSHMT genes have introns ranging from 2 to 14 (Figure 2B). Among them, CmSHMT1 and CmSHMT8 have similar structures, with both not only having relatively complete upstream regions at both ends but also containing the most introns, with 14 introns each. CmSHMT4 and CmSHMT5 also have complete upstream structures and three introns each. CmSHMT7 has 10 introns, CmSHMT6 has 5 introns, and CmSHMT3 only has 2 introns. Gene replication drives the generation of new functional genes and facilitates the expansion of gene families. As shown in Figure 3, CmSHMT1 and CmSHMT8 were detected to be a pair of fragment-repeating genes, yet no tandem repeating genes were found. This indicates that fragment repetition may be a major factor driving the expansion of CmSHMT genes. The ratio of Ka to Ks is less than 1, suggesting that purifying selection was the dominant selective pressure in the evolution of these two CmSHMT genes (Table 3). Following evolutionary relationships among various species, the homology of SHMT genes in soybeans, melons, and cucumbers was examined (Figure 4). The findings indicated that 11 homologous pairs were identified in the genomes of the melon and soybean, while 8 homologous pairs were observed between melon and cucumber. This suggests that soybean, cucumber, and melon are related in terms of SHMT genes.

3.3. Network Analysis of Protein–Protein Interactions Involving CmSHMT

A protein–protein interaction (PPI) network was constructed using STRING to explore the interactions among various CmSHMT proteins. All eight members, except CmSHMT4, were found to participate in the construction of the PPI network (Figure 5). From the network, CmSHMT1, CmSHMT2, CmSHMT5, CmSHMT7, and CmSHMT8 have the closest interactions with each other, indicating that they may play a crucial role in the response to low-temperature stress and the maintenance of cellular homeostasis. In contrast, the interactions between CmSHMT3 and CmSHMT6 are not as strong and appear more independent from other proteins. These interacting proteins are essential for elucidating the impact of CmSHMTs under diverse stress conditions in melons.

3.4. The Phylogenetic Analysis of CmSHMT Genes

The 45 proteins from various species; 7 Arabidopsis proteins, 12 soybean proteins, 5 rice proteins, 6 cucumber proteins, 8 melon proteins, and 7 tomato proteins were utilized to construct phylogenetic trees. The purpose was to investigate the evolutionary relationships of SHMT genes across different species. As shown in Figure 6, the CmSHMT protein sequence is divided into four groups, including A, B, C, and D. There are three protein members in group A: CmSHMT3, CmSHMT4, and CmSHMT5. Group B contains only CmSHMT2. CmSHMT6 and 7 and CmSHMT1 and 8 are distributed in group C and group D, respectively. This classification confirms that CmSHMT1 and CmSHMT8, as well as CmSHMT4 and CmSHMT5, contain the same number of introns and exhibit similar conserved motifs. These results suggest that CmSHMTs from the same subgroup may exhibit similar functions. However, CmSHMTs belonging to various subgroups may have diversified functions. Additionally, we also found that cucumbers in Cucurbitaceae are most closely related to the melon’s SHMT genes.

3.5. Prediction and Analysis of Cis-Acting Elements in the Promoter Region of CmSHMTs

The 12 kinds of cis-acting elements were identified and visualized, which facilitated the investigation of the biological functions of CmSHMT genes (Figure 7). These elements include the auxin response element (AuxRE); the element (Table 4) associated with defense and stress repeats (TC-rich); the gibberellin element (GARE); the element associated with low-temperature response (LTR); the element associated with salicylic acid response (TCARE); the element associated with abscisic acid response (ABRE); the element required for anaerobic induction (ARE); the element associated with photoreactivity (G-box); the regulatory element of MeJA responsiveness (MeJARE); MYB binding sites involved in drought and photoresponse induction (MBS and MRE); and part of the conserved DNA module involved in photoreactivity (Box 4). All CmSHMT genes contain anaerobically induced regulatory elements (AREs). In addition, most CmSHMTs contain the gibberellin response element (GARE) and the salicylic acid response element (TCARE). A few contain AuxRE elements. CmSHMT1, CmSHMT3, CmSHMT4, CmSHMT7, and CmSHMT8 also contain the LTR element, which is associated with low-temperature responses. These findings suggest that CmSHMTs may be involved in hormone signaling pathways, stress responses, and adaptation to environmental stimuli.

3.6. Analysis of Tissue-Specific Expression of CmSHMT Genes

The CmSHMT expressions in different organs were investigated by analyzing melon RNA-seq data (Supplementary file S4). The results indicated that the expression levels of CmSHMT varied across different organs (Figure 8). Notably, the expression levels of all CmSHMTs in female flowers were significantly elevated. In contrast, the expression level of CmSHMTs in the fruit was observed to be relatively low. CmSHMT5 and CmSHMT4 exhibited high expression levels in female flowers but low levels in male flowers, fruits, leaves, and roots. In contrast, CmSHMT1, CmSHMT8, CmSHMT3, and CmSHMT6 were highly expressed in female flowers and also showed some expression in male flowers, but to a much lower level than in female flowers.

3.7. RNA Extraction and qRT-PCR Analysis

The expression of CmSHMT in melons under low temperatures was analyzed via qRT-PCR, providing valuable insights into the function and expression patterns of CmSHMT under low-temperature stress. We observed that the morphology of seedlings subjected to low temperatures (4 °C) for 24 h and 48 h did not exhibit significant changes compared to the control group (Figure 9A). Furthermore, the analysis results indicated that eight CmSHMTs exhibited high sensitivity to low-temperature stress. As the temperature decreased from 25 °C to 4 °C, the relative expression of some CmSHMT genes gradually increased. The expression levels of CmSHMT3, CmSHMT4, and CmSHMT7 increased within a short period, while the expression levels of CmSHMT1, CmSHMT2, CmSHMT5, CmSHMT6, and CmSHMT8 decreased (Figure 9B). Compared with the 0 h treatment, the relative expression levels of CmSHMT1, CmSHMT2, CmSHMT5, and CmSHMT8 genes were significantly decreased following a 24 h and 48 h treatment period at 4°C. In particular, although CmSHMT6 was significantly decreased after 24 h of low-temperature treatment compared to the control group, its relative expression increased significantly after 48 h of continuous low-temperature treatment. This may indicate that CmSHMT6 has a slow response rate to low temperatures in the early stage. Different from CmSHMT6, CmSHMT3, CmSHMT4, and CmSHMT7 showed a more sensitive and rapid response to low-temperature stress. After 24 h of treatment, the relative expression level was significantly higher compared to the control groups. When the low-temperature treatment time reached 48 h, the relative levels of CmSHMT3, CmSHMT4, and CmSHMT7 continued to upregulate significantly. According to the previous phylogenetic analysis, CmSHMT3, CmSHMT4, CmSHMT7, and CmSHMT6, which can respond positively to low-temperature stress, belong to different subgroups (CmSHMT3 and 4 belong to group A, and CmSHMT6 and 7 belong to group C). This shows that these two subgroups are important in low-temperature responsiveness. Overall, our results suggest that CmSHMT3, CmSHMT4, CmSHMT6, and CmSHMT7 genes can actively respond to low-temperature stress, indicating their potential importance in melons’ cold tolerance.

4. Discussion

SHMT catalyzes the reversible conversion of serine and tetrahydrofolate (THF) to glycine and 5, 10-methylene THF, and it is a folate pathway enzyme involved in photorespiration and the synthesis of thymidylate, purine, and methionine in plants. SHMT holds significant research importance in addressing both biotic and abiotic stresses [13,15,39]. At present, SHMT gene families have been identified to exist in quite a few plant species, and their gene structures and functions have been analyzed to some extent, including Arabidopsis [37], tomatoes [10], cucumbers [17], alfalfas [16], wheat [15], rice [38], soybeans [13], and others. In this study, eight CmSHMTs were identified in melon and were classified into four subfamilies according to their protein amino acid sequences and phylogenetic relationships (Figure 6). SHMT is generally considered a neutral and basic protein, and most of them are hydrophilic. For instance, in this study, only CmSHMT2 is an acidic protein, and CmSHMT6 is a hydrophobic protein (GRAVY > 0). The CsSHMT proteins in cucumber are all basic proteins and hydrophilic [17]. In tomatoes, only SlSHMT4 is an acidic protein [10], most MsSHMT proteins in alfalfas are hydrophilic [16], and all five SHMT proteins in rice are hydrophilic proteins [38]. In addition, CmSHMT genes are distributed in chloroplasts, nuclei, cytoplasm, and mitochondria, similarly to rice [38], tomatoes [10], and Arabidopsis [40]. SHMT in different locations plays different roles in metabolic pathways, e.g., SHMT in mitochondria is involved in photorespiration, and SHMT in chloroplasts plays an important role in light reactions and in the biosynthesis of purines, pyrimidines, and N-formylmethionine.
Similar motifs and gene structures in CmSHMT genes support their classification to some extent. There are similarities between CmSHMT members of different subgroups. As shown in Figure 2, CmSHMT2 has a similar motif structure to those of CmSHMT4 and CmSHMT5. Most members of a group share similar motifs and exon–intron structures (Figure 2), but they also differ. Studies have shown that differences in exon–intron structure may significantly contribute to the evolution of repetitive genes, and the number and composition of motifs play significant roles in gene function diversity [15,41,42]. CmSHMT1 and CmSHMT8 are both in group D and have similar motifs and gene structures. However, CmSHMT3, 4, and 5 are in group A, and although they have a similar gene structure (with 2–3 introns), the motifs of CmSHMT3, CmSHMT4, and CmSHMT5 are quite different. In addition, the motifs and gene structure of CmSHMT6 and CmSHMT7 are also different. The intron structure is still similar, although genes of the same group have different structures in the course of evolution. This may indicate that CmSHMT members have different functions [43]. Transcription factors (TFs) are critical in promoting plant growth, development, and tolerance to stress [44]. To investigate the regulatory mechanisms of CmSHMTs, we conducted a search and analysis of cis-acting elements and identified numerous elements associated with plant hormones and stress responses, including AuxRE, TC-rich repeats, GARE, LTR, TCARE, ABRE, ARE, G-box, Box 4, MeJARE, MRE, and MBS. This suggests that CmSHMTs may be associated with various hormone and stress responses in plants, potentially fulfilling distinct biological functions (Figure 7). Among the CmSHMT genes, five cis-acting elements, AuxRE, GARE, MeJARE, TCARE, and ABRE, are related to hormones such as auxin, gibberellin, and abscisic acid in the CmSHMT gene. Among the CmSHMT genes, MeJARE (24), ARE (20), and ABRE (14) were particularly abundant. MeJA, a crucial signaling molecule, participates in plant defense mechanisms by regulating growth and development and inducing the production of defense substances [45,46,47]. Abscisic acid is recognized as an essential stress hormone in plant growth, characterization, and response to stress processes [48,49]. In this study, CmSHMT genes mostly contained ABRE abscisic acid cis-acting elements, and CmSHMT3 contained four ABRE elements. In addition, CmSHMT2, CmSHMT3, CmSHMT4, CmSHMT7, and CmSHMT8 also contain LTR elements related to the stress response at low temperatures, indicating that CmSHMT genes may play an active role in plants’ response to -low-temperature stress induction.
A pair of fragment-repeating genes (CmSHMT1 and CmSHMT8) were identified in this study, suggesting that fragment repetition may be a dominant factor in the expansion of CmSHMTs. During their evolution, selective pressure was mainly due to purifying selection (Ka/Ks < 1), which is similar to the findings in cucumbers [17] and wheat [15].
SHMT genes have been detected and analyzed in different plant tissues. The Arabidopsis AtSHMT genes are distributed in organs such as roots, leaves, flowers, and seeds [9,37,50,51]. It was observed that the expression levels of SiSHMT in millets are elevated in the root, spike, and stem tissues, with variations noted across different growth stages [52]. The expression levels of the CmSHMT gene in roots, fruits, leaves, female flowers, and male flowers were determined using RNA-seq data. According to the findings, CmSHMTs were mainly expressed in both female and male flowers. Some CmSHMTs (CmSHMT2 and CmSHMT7) have certain expression levels in leaves and roots. This suggests that CmSHMTs are tissue-specific and may have specific functions in flowers, leaves, and roots. Furthermore, they may be related to the development of different plant organs (Figure 8). This finding is consistent with that of cucumber CsSHMT [17]. SHMT in leaves plays a crucial role in the formation of one-carbon units linked to folate and amino acid metabolism [6]. Additionally, Arabidopsis SHMT5 is capable of participating in fruit development and ripening processes [12]. These findings suggest that SHMT serves as a key regulator during various stages of plant growth and development [1].
A few studies have demonstrated that SHMT has an important role in quite a few plant species in their response to biotic and abiotic stresses. Under salt treatment, BvSHMTa is transiently expressed in the roots and leaves of sugar beet [53]. The mutation of AtSHMT1 in Arabidopsis is associated with increased susceptibility to pathogen infection and heightened salt stress [18]. The expression levels of wheat TaSHMT6 and TaSHMT9 are upregulated under abiotic stresses, including low temperatures and NaCl [54]. Rice OsSHMT has a significant role in H2O2 scavenging, and its increased expression can enhance cold tolerance in rice [21]. We treated melon seedlings at 4 °C and found that some CmSHMTs (CmSHMT3, CmSHMT4, CmSHMT6, and CmSHMT7) could be actively expressed under low-temperature stress, especially CmSHMT3, CmSHMT4, and CmSHMT7. CmSHMT3, CmSHMT4, and CmSHMT7 exhibited greater tolerance and more rapid expression at lower temperatures. The relative expression levels of CmSHMT3, CmSHMT4, and CmSHMT7 increased rapidly after 24 h of low-temperature treatment and were more significant than those in the control groups. When treatment time reached 48 h, their relative expression levels continued to be significantly upregulated. CmSHMT4 and 7 contain LTRs involved in the low-temperature response. CmSHMT3 contains elements associated with abscisic acid (ABRE) and LTR, suggesting that its expression in response to low temperatures may be linked to hormonal regulation. This result is also observed in lucerne and tomato. Alfalfa MsSHMT4 and MsSHMT11 contain ABRE elements and are sensitive to low temperatures [16]. The expression levels of tomato SlSHMT3, SlSHMT5, and SlSHMT6 are upregulated under low temperatures and abscisic acid treatment, and both SlSHMT3 and SlSHMT5 contain ABRE elements [10]. Furthermore, the relative expression level of CmSHMT6 decreased significantly within 24 h of low-temperature treatment but increased significantly when the treatment time reached 48 h. It also has abscisic acid-associated elements (ABRE) but does not contain LTR elements, which does not seem to affect the positive expression of CmSHMT6 at low temperatures. However, it was undeniable that the relative expression of CmSHMT6 declined markedly within a short time (24 h). The delayed response of CmSHMT6 to low temperatures may be attributed to the complex regulation involving multiple transcription factors, which is consistent with findings in cucumbers [17] and tomatoes [10].
In this study, the expression patterns of CmSHMTs in response to low temperatures identified possible candidate genes (CmSHMT3, CmSHMT4, CmSHMT6, and CmSHMT7), which are mainly implicated in the low-temperature stress response pathway in melon. These genes showed significantly upregulated and elevated expression levels under low-temperature stress treatment at 4 °C when compared to control at 25 °C. These findings suggest that the four CmSHMTs may play a key role in the melon’s response to low-temperature stress in melon. In addition, our results on the analyses of promoter cis-acting elements related to abscisic acid, hormones, and low-temperature response elements may contribute toward building a strong theoretical foundation for the further investigation of the regulatory mechanisms of additional factors influencing CmSHMTs. Our results suggest that the mechanisms of CmSHMT’s elevated expression levels in response to low temperatures may be closely related to the hormone’s cis-acting elements such as ABRE. However, this speculation needs further verification.

5. Conclusions

In this study, the CmSHMT genes of melon were identified and their physico–chemical properties at the whole-genome level were analyzed. In total, eight CmSHMT genes were identified. Based on evolutionary relationships, these genes exhibit an uneven distribution across five chromosomes and are categorized into four distinct subfamilies. To further examine the evolutionary relationships among CmSHMT members, we analyzed their conserved motifs, gene structures, promoter cis-acting elements, protein interaction networks, and gene homology. Additionally, we studied the organ expression specificity of CmSHMTs utilizing RNA-seq data. Subsequently, the expression characteristics of CmSHMTs in leaves under low-temperature stress were analyzed using qRT-PCR. Our results provided a rationale for the further investigation of the biological function of SHMT in other higher plants. In conclusion, this study provides a theoretical basis for further exploring the molecular regulatory mechanisms of melons under low-temperature stress and also identifies SHMT candidate genes that respond to low temperatures in melons.

Supplementary Materials

The following supporting information can be downloaded at www.mdpi.com/article/10.3390/agronomy15010203/s1. Supplementary file S1: Information on the quality testing of leaf samples. Supplementary file S2: Reverse transcription reaction system. Supplementary file S3: SHMT protein sequences from Arabidopsis, cucumbers, tomatoes, soybeans, and rice. Supplementary file S4: RNA-seq data for CmSHMT.

Author Contributions

All authors were involved in the conception and design of this study. In addition, Y.W., K.Z., C.Y., Y.Z., L.Y., H.N. and S.L. were responsible for study preparation, data collection, and data analysis. S.L. and L.Y. supervised the experiments. The initial draft was written and reviewed by Y.L. and D.H., and all authors provided feedback on the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was financially supported by the Huzhou public welfare application research project (Grant No. 2021GZ26), the 2024 Higher Education Research Program by the Zhejiang Province Association of Higher Education (Grant No. KT2024035), the Scientific Research Fund of the Zhejiang Provincial Education Department (Grant No. Y202248468), and Zhejiang students’ technology and innovation program (Xin Miao talents program) (Grant No. 2024R438A003).

Data Availability Statement

The original contributions presented in the study are included in the article/Supplementary Materials; further inquiries can be directed to the corresponding author.

Acknowledgments

The authors would like to thank the experimental materials provided by the Bread of Life Farm.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Zhang, J.; Li, M.; Bryan, A.C.; Yoo, C.G.; Rottmann, W.; Winkeler, K.A.; Chen, J.G. Overexpression of a serine hydroxymethyltransferase increases biomass production and reduces recalcitrance in the bioenergy crop Populus. Sustain. Energ. Fuels 2019, 3, 195–207. [Google Scholar] [CrossRef]
  2. Scaletti, E.; Jemth, A.S.; Helleday, T.; Stenmark, P. Structural basis of inhibition of the human serine hydroxymethyltransferase SHMT 2 by antifolate drugs. FEBS Lett. 2019, 593, 1863–1873. [Google Scholar] [CrossRef] [PubMed]
  3. Pieroth, R.; Paver, S.; Day, S.; Lammersfeld, C. Folate and its impact on cancer risk. Curr. Nutr. Rep. 2018, 7, 70–84. [Google Scholar] [CrossRef] [PubMed]
  4. García-Cañaveras, J.C.; Lancho, O.; Ducker, G.S.; Ghergurovich, J.M.; Xu, X.; da Silva-Diz, V.; Rabinowitz, J.D. SHMT inhibition is effective and synergizes with methotrexate in T-cell acute lymphoblastic leukemia. Leukemia 2021, 35, 377–388. [Google Scholar] [CrossRef]
  5. Troesch, B.; Weber, P.; Mohajeri, M.H. Potential Links between Impaired One-Carbon Metabolism Due to Polymorphisms, Inadequate B-Vitamin Status, and the Development of Alzheimer’s Disease. Nutrients 2016, 8, 803. [Google Scholar] [CrossRef]
  6. Florio, R.; di Salvo, M.L.; Vivoli, M.; Contestabile, R. Serine hydroxymethyltransferase: A model enzyme for mechanistic, structural, and evolutionary studies. Biochim. Biophys. Acta (BBA)-Proteins Proteom. 2011, 1814, 1489–1496. [Google Scholar] [CrossRef]
  7. Waditee-Sirisattha, R.; Sittipol, D.; Tanaka, Y.; Takabe, T. Overexpression of serine hydroxymethyltransferase from halotolerant cyanobacterium in Escherichia coliresults in increased accumulation of choline precursors and enhanced salinity tolerance. FEMS Microbiol. Lett. 2012, 333, 46–53. [Google Scholar] [CrossRef]
  8. Shen, T.; Rui, B.; Zhou, H.; Zhang, X.; Yi, Y.; Wen, H.; Shi, Y. Metabolic flux ratio analysis and multi-objective optimization revealed a globally conserved and coordinated metabolic response of E. coli to paraquat-induced oxidative stress. Mol. BioSyst. 2013, 9, 121–132. [Google Scholar] [CrossRef]
  9. Zhang, Y.; Sun, K.; Sandoval, F.J.; Santiago, K.; Roje, S. One-carbon metabolism in plants: Characterization of a plastid serine hydroxymethyltransferase. Biochem. J. 2010, 430, 97–105. [Google Scholar] [CrossRef]
  10. Liu, Z.; Pan, X.; Wang, C.; Yun, F.; Huang, D.; Yao, Y.; Gao, R.; Ye, F.; Liu, X.; Liao, W. Genome-wide identification and expression analysis of serine hydroxymethyltransferase (SHMT) gene family in tomato (Solanum lycopersicum). PeerJ 2022, 10, e12943. [Google Scholar] [CrossRef]
  11. Ye, J.; Chen, W.; Feng, L.; Liu, G.; Wang, Y.; Li, H.; Zhang, Y. The chaperonin 60 protein SlCpn60α1 modulates photosynthesis and photorespiration in tomato. J. Exp. Bot. 2020, 71, 7224–7240. [Google Scholar] [CrossRef] [PubMed]
  12. Zhang, Y.; Dai, L.; Liu, Y.; Zhang, Y.; Wang, S. Identifying novel fruit-related genes in Arabidopsis thaliana based on the random walk with restart algorithm. PLoS ONE 2017, 12, e0177017. [Google Scholar] [CrossRef] [PubMed]
  13. Lakhssassi, N.; Knizia, D.; El Baze, A.; Lakhssassi, A.; Meksem, J.; Meksem, K. Proteomic, Transcriptomic, Mutational, and Functional Assays Reveal the Involvement of Both THF and PLP Sites at the GmSHMT08 in Resistance to Soybean Cyst Nematode. Int. J. Mol. Sci. 2022, 23, 11278. [Google Scholar] [CrossRef] [PubMed]
  14. Wang, A.; Shu, X.; Jing, X.; Jiao, C.; Chen, L.; Zhang, J.; Zheng, A. Identification of rice (Oryza sativa L.) genes involved in sheath blight resistance via a genome-wide association study. Plant Biotechnol. J. 2021, 19, 1553–1566. [Google Scholar] [CrossRef]
  15. Hu, P.; Song, P.; Xu, J.; Wei, Q.; Tao, Y.; Ren, Y.; Li, C. Genome-wide analysis of serine hydroxymethyltransferase genes in triticeae species reveals that TaSHMT3A-1 regulates fusarium head blight resistance in wheat. Front. Plant Sci. 2022, 13, 847087. [Google Scholar] [CrossRef]
  16. Gao, R.; Chen, L.; Chen, F.; Ma, H. Genome-wide identification of SHMT family genes in alfalfa (Medicago sativa) and its functional analyses under various abiotic stresses. BMC Genom. 2024, 25, 781. [Google Scholar] [CrossRef]
  17. Gao, R.; Luo, Y.; Pan, X.; Wang, C.; Liao, W. Genome-wide identification of SHMT family genes in cucumber (Cucumis sativus L.) and functional analyses of CsSHMTs in response to hormones and abiotic stresses. 3 Biotech 2022, 12, 305. [Google Scholar] [CrossRef]
  18. Moreno, J.I.; Martín, R.; Castresana, C. Arabidopsis SHMT1, a serine hydroxymethyltransferase that functions in the photorespiratory pathway influences resistance to biotic and abiotic stress. Plant J. 2005, 41, 451–463. [Google Scholar] [CrossRef]
  19. Mishra, P.; Jain, A.; Takabe, T.; Tanaka, Y.; Negi, M.; Singh, N.; Rai, V. Heterologous Expression of Serine Hydroxymethyltransferase-3 from Rice Confers Tolerance to Salinity Stress in E. coli and Arabidopsis. Front. Plant Sci. 2019, 10, 217. [Google Scholar] [CrossRef]
  20. Zhou, H.; Zhao, J.; Yang, Y.; Chen, C.; Liu, Y.; Jin, X.; Guo, Y. Ubiquitin-specific protease16 modulates salt tolerance in Arabidopsis by regulating Na(+)/H(+) antiport activity and serine hydroxymethyltransferase stability. Plant Cell 2012, 24, 5106–5122. [Google Scholar] [CrossRef]
  21. Fang, C.; Zhang, P.; Li, L.; Yang, L.; Mu, D.; Yan, X.; Li, Z.; Lin, W. Serine Hydroxymethyltransferase Localised in the Endoplasmic Reticulum Plays a Role in Scavenging H2O2 to Enhance Rice Chilling Tolerance. BMC Plant Biol. 2020, 20, 236. [Google Scholar] [CrossRef] [PubMed]
  22. Lija, M.; Beevy, S.S. A Review on the diversity of Melon. Plant Sci. Today 2021, 8, 995–1003. [Google Scholar] [CrossRef]
  23. Duan, X.; Yuan, Y.; Real, N.; Tang, M.; Ren, J.; Wei, J.; Zhang, X. Fine mapping and identification of candidate genes associated with powdery mildew resistance in melon (Cucumis melo L.). Hortic. Res. 2024, 11, uhae222. [Google Scholar] [CrossRef] [PubMed]
  24. Chikh-Rouhou, H.; Tlili, I.; Ilahy, R.; R’him, T.; Sta-Baba, R. Fruit quality assessment and characterization of melon genotypes. Int. J. Veg. Sci. 2021, 27, 3–19. [Google Scholar] [CrossRef]
  25. Li, L.; Li, Q.; Chen, B.; Wang, J.; Ding, F.; Wang, P.; Zhang, X.; Hou, J.; Luo, R.; Li, X.; et al. Identification of candidate genes that regulate the trade-off between seedling cold tolerance and fruit quality in melon (Cucumis melo L.). Hortic. Res. 2023, 10, uhad093. [Google Scholar] [CrossRef]
  26. Weng, J.; Rehman, A.; Li, P.; Chang, L.; Zhang, Y.; Niu, Q. Physiological and Transcriptomic analysis reveals the responses and difference to high temperature and humidity stress in two melon genotypes. Int. J. Mol. Sci. 2022, 23, 734. [Google Scholar] [CrossRef]
  27. Lang, X.; Zhao, X.; Zhao, J.; Ren, T.; Nie, L.; Zhao, W. MicroRNA Profiling Revealed the Mechanism of Enhanced Cold Resistance by Grafting in Melon (Cucumis melo L.). Plants 2024, 13, 1016. [Google Scholar] [CrossRef]
  28. Wang, H.; Xie, Y.; Yang, L.; Yan, W.; He, Z. Study on cold tolerance of different rootstocks of melon seedlings. IOP Conf. Ser. Earth Environ. Sci. 2019, 310, 052032. [Google Scholar] [CrossRef]
  29. Li, M.; Duan, X.; Wang, Q.; Chen, W.; Qi, H. A new morphological method to identify cold tolerance of melon at seedling stage. Funct. Plant Biol. 2019, 47, 80–90. [Google Scholar] [CrossRef]
  30. Liu, T.; Shi, J.; Li, M.; Ye, X.; Qi, H. Trehalose triggers hydrogen peroxide and nitric oxide to participate in melon seedlings oxidative stress tolerance under cold stress. Environ. Exp. Bot. 2021, 184, 104379. [Google Scholar] [CrossRef]
  31. Liu, T.; Han, Y.; Shi, J.; Liang, A.; Xu, D.; Ye, X.; Qi, H. Abscisic acid involved in trehalose improved melon photosynthesis via regulating oxidative stress tolerance and cell morphology structure under cold stress. Environ. Exp. Bot. 2022, 202, 105042. [Google Scholar] [CrossRef]
  32. Li, L.; Zhang, X.; Ding, F.; Hou, J.; Wang, J.; Luo, R.; Hu, J. Genome-wide identification of the melon (Cucumis melo L.) response regulator gene family and functional analysis of CmRR6 and CmPRR3 in response to cold stress. J. Plant Physiol. 2024, 292, 154160. [Google Scholar] [CrossRef] [PubMed]
  33. Zhang, Y.; Diao, Q.; Cao, Y.; Shi, M.; Zhang, H.; Jin, H.; Jiang, S.; Shen, H. Effect of sodium nitroprusside on the growth and enzymes related to nitrogen metabolism of melon seedlings under low temperature stress. Mol. Plant Breed. 2023, 14, 1–8. [Google Scholar] [CrossRef]
  34. Ma, M.; Liu, S.; Wang, Z.; Shao, R.; Ye, J.; Yan, W.; Che, G. Genome-wide identification of the SUN gene family in melon (Cucumis melo) and functional characterization of Two CmSUN genes in regulating fruit shape variation. Int. J. Mol. Sci. 2022, 23, 16047. [Google Scholar] [CrossRef]
  35. Yu, J.; Wu, S.; Sun, H.; Wang, X.; Tang, X.; Guo, S.; Fei, Z. CuGenDBv2: An updated database for cucurbit genomics. Nucleic Acids Res. 2023, 51, D1457–D1464. [Google Scholar] [CrossRef]
  36. Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef]
  37. Nogués, I.; Sekula, B.; Angelaccio, S.; Grzechowiak, M.; Tramonti, A.; Contestabile, R.; Ruszkowski, M. Arabidopsis thaliana serine hydroxymethyltransferases: Functions, structures, and perspectives. Plant Physiol. Biochem. 2022, 187, 37–49. [Google Scholar] [CrossRef]
  38. Pan, T.; Jin, H.; Zhou, C.; Yan, M. Rice Serine Hydroxymethyltransferases: Evolution, Subcellular Localization, Function and Perspectives. Plants 2024, 13, 1116. [Google Scholar] [CrossRef]
  39. Santatiwongchai, J.; Gleeson, D.; Gleeson, M.P. Theoretical Evaluation of the Reaction Mechanism of Serine Hydroxymethyltransferase. J. Phys. Chem. B 2018, 123, 407–418. [Google Scholar] [CrossRef]
  40. Wei, Z.; Sun, K.; Sandoval, F.J.; Cross, J.M.; Gordon, C.; Kang, C.; Roje, S. Folate polyglutamylation eliminates dependence of activity on enzyme concentration in mitochondrial serine hydroxymethyltransferases from Arabidopsis thaliana. Arch. Biochem. Biophys. 2013, 536, 87–96. [Google Scholar] [CrossRef]
  41. Yu, J.; Xie, Q.; Li, C.; Dong, Y.; Zhu, S.; Chen, J. Comprehensive characterization and gene expression patterns of LBD gene family in Gossypium. Planta 2020, 251, 81. [Google Scholar] [CrossRef] [PubMed]
  42. Xu, J.; Hu, P.; Tao, Y.; Song, P.; Gao, H.; Guan, Y. Genome-wide identification and characterization of the Lateral Organ Boundaries Domain (LBD) gene family in polyploid wheat and related species. PeerJ 2021, 9, e11811. [Google Scholar] [CrossRef] [PubMed]
  43. Jin, C.; Xue, H.; Xing, Z.; Xin, W.; Guo, L.; Bo, L.; Yan, C.; Chun, Y.; Jian, Z.; Hui, W. Identification and Expression Analysis of GASA Gene Family in Crape Myrtle. Mol. Plant Breed. 2024, 1–19. Available online: https://link.cnki.net/urlid/46.1068.S.20241111.1605.015 (accessed on 11 November 2024). (In Chinese).
  44. Su, L.; Wan, S.; Zhou, J.; Shao, Q.S.; Xing, B. Transcriptional regulation of plant seed development. Physiol. Plant. 2021, 173, 2013–2025. [Google Scholar] [CrossRef]
  45. Riemann, M.; Dhakarey, R.; Hazman, M.; Miro, B.; Kohli, A.; Nick, P. Exploring Jasmonates in the Hormonal Network of Drought and Salinity Responses. Front. Plant Sci. 2015, 6, 1077. [Google Scholar] [CrossRef]
  46. Wasternack, C. Jasmonates: An update on Biosynthesis, Signal Transduction and Action in Plant Stress Response, Growth and Development. Ann. Bot. 2007, 100, 681–697. [Google Scholar] [CrossRef]
  47. Balbi, V.; Devoto, A. Jasmonate Signalling Network in Arabidopsis thaliana: Crucial regulatory nodes and new physiological scenarios. New Phytol. 2008, 177, 301–318. [Google Scholar] [CrossRef]
  48. Gusta, L.V.; Trischuk, R.; Weiser, C.J. Plant cold acclimation: The role of abscisic acid. J. Plant Growth Regul. 2005, 24, 308–318. [Google Scholar] [CrossRef]
  49. Sharma, R.; Sharma, P. Role of Abscisic Acid in Plant Stress. In New Insights into Phytohormones; IntechOpen: London, UK, 2023. [Google Scholar]
  50. McClung, C.R.; Hsu, M.; Painter, J.E.; Gagne, J.M.; Karlsberg, S.D.; Salomé, P.A. Integrated temporal regulation of the photorespiratory pathway. Circadian regulation of two Arabidopsis genes encoding serine hydroxymethyltransferase. Plant Physiol. 2000, 123, 381–392. [Google Scholar] [CrossRef]
  51. Voll, L.M.; Jamai, A.; Renné, P.; Voll, H.; McClung, C.R.; Weber, A.P. The photorespiratory Arabidopsis shm1 mutant is deficient in SHM1. Plant Physiol. 2006, 140, 59–66. [Google Scholar] [CrossRef]
  52. Bing, G.; Jia, Q.; Na, L.; Meng, S.; Li, W.; Jun, L.; Xiao, M. Genome-wide identification and expression analysis of SHMT gene family in foxtail millet (Setaria italica L.). Acta Agron. Sin. 2024, 1–14. Available online: https://link.cnki.net/urlid/11.1809.s.20241030.0852.002 (accessed on 11 November 2024). (In Chinese).
  53. Kito, K.; Tsutsumi, K.; Rai, V.; Theerawitaya, C.; Cha-Um, S.; Yamada-Kato, N.; Takabe, T. Isolation and functional characterization of 3-phosphoglycerate dehydrogenase involved in salt responses in sugar beet. Protoplasma 2017, 254, 2305–2313. [Google Scholar] [CrossRef]
  54. Liu, H.; Li, N.; Zhao, Y.; Kang, G.Z.; Zhao, Y.H.; Xu, H.W. Serine Hydroxymethyltransferase (SHMT) Gene Family in Wheat (Triticum aestivum L.): Identification, Evolution, and Expression Analysis. Agronomy 2022, 12, 1346. [Google Scholar] [CrossRef]
Agronomy 15 00203 g001
Figure 1. Chromosomal position of the CmSHMT genes. The chromosomal position of the CmSHMT genes is illustrated in the graph, with the size of the chromosomes represented on the left in megabase (Mb). The chromosome number is indicated at the top of each bar, with red characters denoting the genes.
Figure 1. Chromosomal position of the CmSHMT genes. The chromosomal position of the CmSHMT genes is illustrated in the graph, with the size of the chromosomes represented on the left in megabase (Mb). The chromosome number is indicated at the top of each bar, with red characters denoting the genes.
Agronomy 15 00203 g001
Agronomy 15 00203 g002
Figure 2. Conserved motifs and gene structure of CmSHMTs. (A): Conserved motifs of CmSHMT genes. The evolutionary relationships of the CmSHMTs are illustrated on the left. Different colored blocks represent distinct conserved motifs. (B): Gene structure map of the CmSHMT gene. The yellow and dark blue color blocks denote the coding sequences (CDSs) and upstream/downstream regions, respectively. The pink lines indicate the intron.
Figure 2. Conserved motifs and gene structure of CmSHMTs. (A): Conserved motifs of CmSHMT genes. The evolutionary relationships of the CmSHMTs are illustrated on the left. Different colored blocks represent distinct conserved motifs. (B): Gene structure map of the CmSHMT gene. The yellow and dark blue color blocks denote the coding sequences (CDSs) and upstream/downstream regions, respectively. The pink lines indicate the intron.
Agronomy 15 00203 g002
Agronomy 15 00203 g003
Figure 3. Collinearity analysis plot of the CmSHMT gene. Black lines represent the duplicated blocks of the CmSHMT gene within the melon genome, whereas grey lines denote all duplicated blocks.
Figure 3. Collinearity analysis plot of the CmSHMT gene. Black lines represent the duplicated blocks of the CmSHMT gene within the melon genome, whereas grey lines denote all duplicated blocks.
Agronomy 15 00203 g003
Agronomy 15 00203 g004
Figure 4. Homology analysis of SHMT genes in soybeans, melons, and cucumbers. Purple represents soybeans, orange represents melons, and blue represents cucumbers. Chromosome numbers are labeled above each chromosome. Gray lines represent all homologous pairs between the genomes of various species. The homologous pairs of SHMT genes are highlighted by red lines.
Figure 4. Homology analysis of SHMT genes in soybeans, melons, and cucumbers. Purple represents soybeans, orange represents melons, and blue represents cucumbers. Chromosome numbers are labeled above each chromosome. Gray lines represent all homologous pairs between the genomes of various species. The homologous pairs of SHMT genes are highlighted by red lines.
Agronomy 15 00203 g004
Agronomy 15 00203 g005
Figure 5. Graph of the protein–protein interaction network of CmSHMTs. Each node in the network represents a protein, and the interaction between proteins is shown by every edge. The purple lines indicate protein interactions that have been confirmed experimentally, while the green lines represent protein interactions predicted from gene neighborhood analysis. The red lines show protein interactions predicted from gene fusion predictions, and the blue lines show protein interactions predicted from gene co-occurrence predictions.
Figure 5. Graph of the protein–protein interaction network of CmSHMTs. Each node in the network represents a protein, and the interaction between proteins is shown by every edge. The purple lines indicate protein interactions that have been confirmed experimentally, while the green lines represent protein interactions predicted from gene neighborhood analysis. The red lines show protein interactions predicted from gene fusion predictions, and the blue lines show protein interactions predicted from gene co-occurrence predictions.
Agronomy 15 00203 g005
Agronomy 15 00203 g006
Figure 6. Phylogenetic analysis of the SHMT proteins from melons, Arabidopsis, cucumbers, soybeans, tomatoes, and rice. These sequences of 8 CmSHMTs, 6 CsSHMTs, 12 GmSHMTs, 7 AtSHMTs, 5 OsSHMTs, and 7 SlSHMTs protein (Supplementary file S3) were aligned and analyzed using MEGA11.0.
Figure 6. Phylogenetic analysis of the SHMT proteins from melons, Arabidopsis, cucumbers, soybeans, tomatoes, and rice. These sequences of 8 CmSHMTs, 6 CsSHMTs, 12 GmSHMTs, 7 AtSHMTs, 5 OsSHMTs, and 7 SlSHMTs protein (Supplementary file S3) were aligned and analyzed using MEGA11.0.
Agronomy 15 00203 g006
Agronomy 15 00203 g007
Figure 7. Predictions of cis-acting elements in the CmSHMTs promoter sequence. These elements are derived from 2000 bp upstream of the CmSHMT promoter sequence. The left side of the figure displays the evolutionary relationships among the genes, while the lower horizontal axis denotes the length (bp). Each differently colored square represents a distinct element.
Figure 7. Predictions of cis-acting elements in the CmSHMTs promoter sequence. These elements are derived from 2000 bp upstream of the CmSHMT promoter sequence. The left side of the figure displays the evolutionary relationships among the genes, while the lower horizontal axis denotes the length (bp). Each differently colored square represents a distinct element.
Agronomy 15 00203 g007
Agronomy 15 00203 g008
Figure 8. Expression profiles of the CmSHMT gene in female flowers, fruits, male flowers, leaves, and roots of melon. Transcriptome data (Supplementary file S4) were acquired from the CuGenDBv2 genome database (http://www.cucurbitgenomics.org/, viewed on 20 August 2024) under accession number PRJNA383830. The legend is located on the right side of the figure. The green color marks low expression, while the red color marks high expression.
Figure 8. Expression profiles of the CmSHMT gene in female flowers, fruits, male flowers, leaves, and roots of melon. Transcriptome data (Supplementary file S4) were acquired from the CuGenDBv2 genome database (http://www.cucurbitgenomics.org/, viewed on 20 August 2024) under accession number PRJNA383830. The legend is located on the right side of the figure. The green color marks low expression, while the red color marks high expression.
Agronomy 15 00203 g008
Agronomy 15 00203 g009
Figure 9. The phenogram of melon seedlings after treatment and relative expression analysis via quantitative real-time fluorescence detection. (A): Phenograms of melon seedlings taken at 25 °C and 4 °C treatment for 0 h, 24 h, and 48 h, respectively. (B): Refined expression levels of CmSHMTs after treatment. The blue color represents the control group (25 °C), while the red color represents the low-temperature treatment group (4 °C). Three technical replicates were set for each sample, with the mean Ct value calculated for each sample. The results were expressed as mean ± standard deviations (SDs). The 2−ΔΔCt method was utilized to determine the relative expression levels of SHMT in melon leaves under low-temperature conditions. An asterisk (*) denotes a significant difference at the p < 0.05 level, while a double asterisk (**) indicates a highly significant difference at the p < 0.01 level.
Figure 9. The phenogram of melon seedlings after treatment and relative expression analysis via quantitative real-time fluorescence detection. (A): Phenograms of melon seedlings taken at 25 °C and 4 °C treatment for 0 h, 24 h, and 48 h, respectively. (B): Refined expression levels of CmSHMTs after treatment. The blue color represents the control group (25 °C), while the red color represents the low-temperature treatment group (4 °C). Three technical replicates were set for each sample, with the mean Ct value calculated for each sample. The results were expressed as mean ± standard deviations (SDs). The 2−ΔΔCt method was utilized to determine the relative expression levels of SHMT in melon leaves under low-temperature conditions. An asterisk (*) denotes a significant difference at the p < 0.05 level, while a double asterisk (**) indicates a highly significant difference at the p < 0.01 level.
Agronomy 15 00203 g009
Table 1. The qRT-PCR primer design.
Table 1. The qRT-PCR primer design.
Target GenesPrimerSequencesAmplicon Size (bp)
CmSHMT1MELO3C011107.1-FACATAAGTGGTTTAGTTGCCGC110
MELO3C011107.1-RAATCATTGCCCCCCGTG
CmSHMT2MELO3C020429.1-FCATTAGTGGACTCGTTGCTGCT752
MELO3C020429.1-RGCTCTTCGATTTCCTTGTTGTT
CmSHMT3MELO3C019443.1-FCTTGCCTTTTGCCCTAAACTAC116
MELO3C019443.1-RATATCACACATCAGAACTGCTCCA
CmSHMT4MELO3C019450.1-FTGTCTGTGTTATGGGTGGTGTG513
MELO3C019450.1-RGATTTGCCTCTGTTTCTCTTTCTC
CmSHMT5MELO3C010431.1-FATCTTTCCTTCCGCTTAAGTTCT179
MELO3C010431.1-RGTCGTCGCTATCATCGTCCA
CmSHMT6MELO3C016197.1-FGTGAGAGAGAGTTTGCTGCGG196
MELO3C016197.1-RGGTATTGGGAATTGAGTGGTAAGAG
CmSHMT7MELO3C016200.1-FTGTGACAACTTCTGATTTCCCTTTA181
MELO3C016200.1-RATTTTCTCTGACCTTATCCCCC
CmSHMT8MELO3C007698.1-FCCTGAGTGGAGTGGATAAAACG501
MELO3C007698.1-RGGATGGAGAGCCAGATAAAGATT
CmEFIaEFIa-FACTGTGCTGTCCTCATTATTG98
EFIa-RAGGGTGAAAGCAAGAAGAGC
Table 2. Physicochemical properties and their subcellular localizations of CmSHMTs.
Table 2. Physicochemical properties and their subcellular localizations of CmSHMTs.
Gene
Name		Gene
ID		Amino Acid Sequence (aa)Molecular Mass (kD)Theoretical Isoelectric Point (pI)Coefficient of InstabilityGrand Average of Hydropathicity (GRAVY)Prediction of Subcellular Localization
CmSHMT1MELO3C011107.151657.168.1435.46−0.276Chloroplast
CmSHMT2MELO3C020429.152758.276.2149.26−0.267Chloroplast
CmSHMT3MELO3C019443.116719.069.4443.49−0.334Chloroplast
CmSHMT4MELO3C019450.158564.987.551.91−0.397Nucleus
CmSHMT5MELO3C010431.158264.638.3442.21−0.359Nucleus
CmSHMT6MELO3C016197.122023.798.5535.420.061Cytosol
CmSHMT7MELO3C016200.152857.158.4734.96−0.097Chloroplast
CmSHMT8MELO3C007698.154961.208.3939.99−0.287Mitochondrion
Table 3. Gene amplification relationships and Ka/Ks ratios of CmSHMTs.
Table 3. Gene amplification relationships and Ka/Ks ratios of CmSHMTs.
Gene PairsRates of Non-Synonymous
Substitution (Ka)		Rates of Synonymous Substitution
(Ks)		Ka/Ks
CmSHMT1/CmSHMT80.1040691.947260.05344364
Table 4. Predicted outcomes for cis-acting elements of CmSHMTs.
Table 4. Predicted outcomes for cis-acting elements of CmSHMTs.
ElementSequenceDescription
AuxREAACGACAuxin-responsive elements
TC-rich repeatsGTTTTCTTACCis-acting elements associated with defense mechanisms and stress responsiveness
GARETCTGTTGGibberellin-responsive elements
LTRCCGAAACis-acting elements associated with low-temperature responsiveness
TCARECCATCTTTTTCis-acting elements associated with salicylic acid responsiveness
ABREACGTG/CACGTGCis-acting elements associated with the abscisic acid responsiveness
AREAAACCACis-acting regulatory elements essential for the anaerobic induction
G-boxCACGTC/CACGACCis-acting regulatory elements associated with light responsiveness
Box 4 ATTAATPart of a conserved DNA module associated with light responsiveness
MeJARETGACG/CGTCACis-acting regulatory elements associated with the MeJA-responsiveness
MREAACCTAAMYB binding site associated with light responsiveness
MBSCAACTGMYB binding site associated with drought-inducibility
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, Y.; He, D.; Wu, Y.; Zhao, K.; Yang, C.; Zhong, Y.; Yang, L.; Niu, H.; Liu, S. Identification and Analysis of Melon (Cucumis melo L.) SHMT Gene Family Members and Their Functional Studies on Tolerance to Low-Temperature Stress. Agronomy 2025, 15, 203. https://doi.org/10.3390/agronomy15010203

AMA Style

Liu Y, He D, Wu Y, Zhao K, Yang C, Zhong Y, Yang L, Niu H, Liu S. Identification and Analysis of Melon (Cucumis melo L.) SHMT Gene Family Members and Their Functional Studies on Tolerance to Low-Temperature Stress. Agronomy. 2025; 15(1):203. https://doi.org/10.3390/agronomy15010203

Chicago/Turabian Style

Liu, Yanmin, Dandan He, Yizhou Wu, Kangqi Zhao, Changyi Yang, Yulu Zhong, Liuyang Yang, Haiyue Niu, and Sushuang Liu. 2025. "Identification and Analysis of Melon (Cucumis melo L.) SHMT Gene Family Members and Their Functional Studies on Tolerance to Low-Temperature Stress" Agronomy 15, no. 1: 203. https://doi.org/10.3390/agronomy15010203

APA Style

Liu, Y., He, D., Wu, Y., Zhao, K., Yang, C., Zhong, Y., Yang, L., Niu, H., & Liu, S. (2025). Identification and Analysis of Melon (Cucumis melo L.) SHMT Gene Family Members and Their Functional Studies on Tolerance to Low-Temperature Stress. Agronomy, 15(1), 203. https://doi.org/10.3390/agronomy15010203

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop