Next Article in Journal
Simulation and Test of Key Decorticating Components of Spiral Ramie Decorticator
Previous Article in Journal
Stem and Leaf Segmentation and Phenotypic Parameter Extraction of Tomato Seedlings Based on 3D Point
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 15
Issue 1
10.3390/agronomy15010121
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Verification of the Introgression of Narenga porphyrocoma Germplasm into Saccharum officinarum Using Molecular Markers and GISH Analysis

by
Gang Wang
,
Wei Zhang
,
Yuanxia Qin
,
Qingdan Wu
,
Qinggan Liang
,
Jiantao Wu
,
Shengren Sun
,
Zhuqing Wang
,
Yuxing An
,
Jianqiang Wang
,
Qinnan Wang
* and
Hailong Chang
*
Institute of Nanfan and Seed Industry, Guangdong Academy of Sciences, Guangzhou 510316, China
*
Authors to whom correspondence should be addressed.
Agronomy 2025, 15(1), 121; https://doi.org/10.3390/agronomy15010121
Submission received: 14 December 2024 / Revised: 30 December 2024 / Accepted: 4 January 2025 / Published: 6 January 2025
(This article belongs to the Section Crop Breeding and Genetics)
Browse Figures
Versions Notes

Abstract

:
Sugarcane (Saccharum spp.), a critical crop for sugar and bioenergy production, faces challenges in genetic improvement due to limited genetic diversity from selective breeding. Expanding genetic resources through intergeneric hybridization, particularly with Narenga porphyrocoma, offers a promising avenue to introduce traits like stress resistance and high biomass productivity. However, verifying true hybrids remains challenging with traditional morphological methods. This study employed tetra-primer ARMS-PCR and genomic in situ hybridization (GISH) to accurately identify intergeneric hybrids between S. officinarum and N. porphyrocoma. Species-specific primers were designed based on SNPs in the nrDNA-ITS region for ARMS-PCR, enabling effective differentiation of parental and hybrid genotypes, while GISH confirmed the chromosomal composition of hybrids, revealing an n + n inheritance pattern. The results demonstrated the potential of N. porphyrocoma to improve sugarcane’s tillering and leaf length, although sucrose content was lower in hybrids, suggesting the need for further breeding efforts. This study uniquely contributes to sugarcane breeding by providing an effective method for hybrid verification and laying a foundation for incorporating beneficial N. porphyrocoma genes into sugarcane cultivars.

1. Introduction

Sugarcane, belonging to the genus Saccharum in the family Poaceae, is cultivated extensively in tropical and subtropical regions, serving as a commercially important crop for sugar and bioenergy production [1,2]. Modern sugarcane cultivars, which are highly complex polyploids, resulted from limited interspecific crosses between the sugar-producing species S. officinarum (2n = 8x = 80, x = 10) and the wild species S. spontaneum (2n = 4x–16x = 40–128, x = 8, 9, or 10) over a century ago [3,4]. However, most commercial varieties predominantly derive their maternal cytoplasm from a limited number of S. officinarum clones, and selective breeding has constrained genetic diversity, thereby limiting advancements in the development of new cultivars [5]. Expanding genetic diversity and leveraging the gene pool of wild relatives remain vital for improving stress resistance and sucrose content [5]. To address this, breeders have increasingly focused on intergeneric hybridization within the ‘Saccharum complex’, including genera such as Narenga, Erianthus, Miscanthus, and Sclerostachya [6,7,8,9,10,11]. Among these, N. porphyrocoma (2n = 2x = 30, x = 15) has emerged as a promising germplasm source due to its superior ratooning and tillering abilities, high biomass productivity, and exceptional adaptability to both biotic and abiotic stresses [7,12,13]. These traits are being integrated into sugarcane improvement programs, laying the foundation for enhanced productivity and resilience.
Accurate verification of hybrid progeny is critical for subsequent introgression studies in sugarcane improvement programs. Traditional methods of hybrid identification, which rely on morphological characteristics, often produce ambiguous results due to the difficulty in differentiating true hybrids from selfed progeny [14]. Molecular markers provide a reliable alternative for hybrid identification. Over the past two decades, markers such as RAPD, RFLP, AFLP, ISSR, and SSR have been extensively used to identify Saccharum and sugarcane-related genera [7,8,11,15]. These markers produce distinct amplification bands that significantly aid in the differentiation of sugarcane hybrids and germplasms. However, interpreting these results can be challenging due to the presence of multiple amplification bands. Single-nucleotide polymorphisms (SNPs), as third-generation molecular markers, demonstrate high stability and are extensively applied in crop molecular genetics and marker-assisted breeding [16]. Among the over 10 SNP genotyping technologies developed, tetra-primer amplification refractory mutation system polymerase chain reaction (ARMS-PCR) is a simple, cost-effective method [17]. This technique uses allele-specific primers with a mismatch at the 3′ terminus to amplify only the perfectly complementary template, enabling accurate genotyping [18]. Tetra-primer ARMS-PCR has been widely applied for analyzing germplasm genotypes, including sweet potato, mouse, deer, and schistosomiasis [19,20,21,22]. Understanding chromosome transmission behavior in intergeneric hybrids is critical for advancing introgression strategies. The genomic in situ hybridization (GISH) technique facilitates the examination of chromosomal structure, exchange, and transmission modes between parental and filial generations. By hybridizing parental DNA probes with different markers to chromosomes during the metaphase of mitosis, GISH accurately identifies the parental origin of interspecies hybrids and detects chromosomal exchange [23]. As a widely used molecular cytogenetic technique, GISH offers a valuable tool for sugarcane breeding applications, particularly in determining chromosome composition in interspecific or intergeneric hybrids derived from two or more distinct species [24,25].
The internal transcribed spacer (ITS) region of the 18S-5.8S-26S nuclear ribosomal DNA (nrDNA), comprising the ITS1 spacer, the 5.8S rDNA gene, and the ITS2 spacer, is highly variable and extensively utilized as a DNA barcode for plant phylogenetic studies [26,27]. This region can be easily amplified using universal primers and sequenced. Owing to their high variability and differential rates of evolution, ITS regions are valuable for analyzing inter- or intraspecific genetic variations, evolutionary relationships, phylogeny, and germplasm identification in plants [26,27,28,29,30]. ITS sequences have been used to develop molecular markers for identifying medicinal herb germplasms [29] and distinguishing orchid interspecific hybrids [30] as well as intergeneric hybrids between Argyranthemum frutescens and Rhodanthemum gayanum [31]. Moreover, tetra-primer ARMS-PCR, based on a stable SNP in the nrDNA-ITS region, has been effectively employed to identify S. spontaneum and S. officinarum [32,33,34]. However, its application for identifying N. porphyrocoma hybrids remains unexplored. We hypothesize that the combined use of ARMS-PCR and GISH will be more effective in identifying intergeneric hybrids between S. officinarum and N. porphyrocoma. In this study, we employed two methods to identify true hybrids from intergeneric hybridization between S. officinarum and N. porphyrocoma. Initially, tetra-primer ARMS-PCR was used to detect intergeneric hybrids, and GISH analysis subsequently confirmed the results. These identified hybrids hold potential for sugarcane breeding programs aimed at integrating beneficial N. porphyrocoma genes into cultivated sugarcane.

2. Materials and Methods

2.1. Plant Materials and Growth Conditions

Two species, S. officinarum (Badila and Zhanjiang Qingpi) and N. porphyrocoma (Guangdong 32), were used in this study. Before pollen shedding, tassels of S. officinarum (Badila and Zhanjiang Qingpi) were subjected to 50 °C hot-water emasculation for 5 min, followed by a 2-day incubation in greenhouses maintained at 26–28 °C and 60–70% humidity, under natural light conditions. Fresh pollen of N. porphyrocoma was collected at 8:30 AM and manually applied to emasculated tassels of S. officinarum for five consecutive days. The hybrid tassels were subsequently transplanted to a greenhouse to produce hybrid seedlings. Seventeen F1 hybrids were obtained from intergeneric crosses between S. officinarum (Badila, female) and N. porphyrocoma (Guangdong 32, male), while thirteen F1 hybrids were produced using S. officinarum Zhanjiang Qingpi as the maternal parent. All F1 plants, along with their respective parental species, were cultivated under natural growth conditions at the Hainan Sugarcane Breeding Station, Institute of Nanfan and Seed Industry, Guangdong Academy of Sciences, Sanya, China.

2.2. DNA Extraction and PCR Amplification of nrDNA-ITS Region

Plant leaves were frozen in liquid nitrogen and ground into a fine powder, followed by genomic DNA extraction using the CTAB method [35]. The quality and concentration of the extracted DNA were evaluated using 0.8% agarose gel electrophoresis and a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Wilmington, NC, USA), and DNA samples were subsequently diluted to 20 ng/μL in deionized water for PCR amplification. The nrDNA-ITS region was amplified from the three parental species using the universal primers ITS1 (5′-TCCGTAGGTGAACCTGCGG-3′) and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′) [32]. The 20 μL PCR reaction mixtures contained 20 ng of template DNA, 0.5 μM of each primer, and 10 μL of 2× Super Pfx MasterMix (CWBIO, Taizhou, China). Amplification was carried out using a Bio-Rad C1000 TouchTM Thermal Cycler (CFX96TM Optics Module, Bio-Rad, Hercules, CA, USA). The amplification profile included a pre-denaturation cycle at 98 °C for 3 min, followed by 35 cycles of 98 °C for 10 s, 55 °C for 15 s, 72 °C for 15 s, and a final extension at 72 °C for 10 min. The PCR products were analyzed by 1.0% agarose gel electrophoresis with SuperRed staining (Biosharp, Beijing, China) and purified using the Omega EZNA gel extraction kit (Omega bio-tek, Guangzhou, China). After the addition of an adenosine (A) overhang, the purified products were cloned into the pMD19-T-vector (Takara, Dalian, China) and transformed into E. coli DH5α competent cells (Weidibio, Shanghai, China). Five recombinant clones per sample were selected for bidirectional sequencing performed by Tsingke Biotechnology Co., Ltd. (Beijing, China).

2.3. ITS Sequence Analysis and Alignment

The nrDNA-ITS sequences were analyzed and compared using the NCBI BLAST tool “http://www.ncbi.nlm.nih.gov/BLAST/ (accessed on 20 October 2023)”. The locations of ITS1, 5.8S rDNA, and ITS2 were determined by comparison with reference sequences in the NCBI database. The nrDNA-ITS sequences of the three parental species were aligned using ClustalW 2.0, with subsequent manual refinements to ensure accuracy. Sequences of the same nrDNA-ITS region from each species were considered to represent identical haplotypes. Sequence lengths (in base pairs) and variable site information for ITS1, 5.8S rDNA, and ITS2 were analyzed using DNAMAN 6.0 software. Additionally, fifteen nrDNA-ITS sequences from the two species (S. officinarum and N. porphyrocoma) were downloaded from the NCBI nucleotide archive “http://www.ncbi.nlm.nih.gov/nucleotide/ (accessed on 14 March 2023)” (see Supplementary Materials File S1).

2.4. ARMS-PCR Strategy

Tetra-primer ARMS-PCR primers were designed based on the nrDNA-ITS sequences of Badila, Zhangjiang Qingpi, and Guangdong 32, following the method described by Medrano and de Oliveira [18] for identifying intergeneric hybrids of S. officinarum and N. porphyrocoma. Hybrid identification was carried out using tetra-primer ARMS-PCR. The 20 μL PCR reaction mixture consisted of 20 ng of template DNA, 0.20 μM of each outer primer (ITS1 and RO), 0.40 μM of each inner primer (FI-So and RI-Np), and 10 μL of 2X Taq Master Mix (Vazyme, Nanjing, China) and was prepared on ice for amplification using a Bio-Rad C1000 TouchTM Thermal Cycler (CFX96TM Optics Module, Bio-Rad, Hercules, CA, USA). The PCR reaction conditions were as follows: (1) 1 pre-denaturation cycle at 94 °C for 5 min; (2) 5 cycles of denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s (decreasing by 1 °C per cycle), and extension at 72 °C for 45 s; (3) 30 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 45 s; (4) a final extension at 72 °C for 10 min. The PCR products were electrophoresed on a 1.0% agarose gel with SuperRed staining.

2.5. Genomic In Situ Hybridization Procedure

Genomic DNA from N porphyrocoma (Guangdong 32) was labeled with FITC-12-dUTP (green), and genomic DNA from S officinarum (Badila and Zhanjiang Qingpi) was labeled with Cy3-dUTP (red) using the Nick Translation Kit (Roche, Basel, Switzerland). Chromosome preparation, spreading, and GISH experiments were performed according to the protocols described by D’hont et al. [36] and Li et al. [33], with slight modifications. A hybridization solution containing both gDNA probes was prepared and dropped onto the dried slide, and then hybridization proceeded overnight in a moist box at 37 °C. After hybridization, coverslips were carefully removed, and the slides were washed three times for 5 min each in 1× PBS. The dried slides were then counterstained with DAPI, and well-spread metaphase images were observed under an AxioScope A1 Imager fluorescent microscope (Carl Zeiss, Gӧttingen, Germany). Images were captured using an AxioCam MRc5 camera and analyzed with the AxioVision v.4.7 imaging software (Carl Zeiss, Gӧttingen, Germany).

3. Results

3.1. PCR Amplification of nrDNA-ITS

Numerous S. officinarum and N. porphyrocoma nrDNA-ITS sequences have been published and deposited in GenBank. Additionally, 15 nrDNA-ITS sequences from these two species were downloaded from the NCBI nucleotide archive (Supplementary Materials File S1). As shown in Figure 1, in the ITS1-5.8S-ITS2 nrDNA region of S. officinarum, the ITS1 sequence varied from 206 to 207 bp, 5.8S rDNA region was 164 bp, and the ITS2 varied from 217 to 219 bp. In the ITS1-5.8S-ITS2 nrDNA region of N. porphyrocoma, the lengths of the ITS1, 5.8S rDNA, and ITS2 regions were 207 bp, 164 bp, and 219 bp, respectively. Obviously, the ITS1-5.8S-ITS2 nrDNA region length of N. porphyrocoma was more conserved than that of S. officinarum. The nrDNA-ITS (comprising ITS1-5.8S rDNA-ITS2) regions of Badila, Zhanjiang Qingpi, and Guangdong 32 were amplified using the ITS1 and ITS4 primer sets, producing a single, intense band of approximately 677 bp for each species (Figure 2).

3.2. Sequence Analysis of ITS1-5.8S-ITS2

The ITS1-5.8S rDNA-ITS2 regions of Badila and Zhanjiang Qingpi were determined to be 589 bp in length, with the ITS1, 5.8S rDNA, and ITS2 regions measuring 207 bp, 164 bp, and 218 bp, respectively. In contrast, the ITS1-5.8S rDNA-ITS2 region of Guangdong 32 measured 590 bp, with the ITS2 region being slightly longer at 219 bp (Figure 3). Notably, the sequence length of ITS1 and 5.8S rDNA showed greater conservation than that of ITS2. Analysis of the 590 aligned sites across the three parental sequences revealed 549 conserved sites and 41 variable sites (Figure 3). The distribution of variable sites within the ITS region indicated a hierarchy of variability: ITS1 (22 sites) > ITS2 (17 sites) > 5.8S rDNA (2 sites). The 5.8S rDNA region was the most conserved, with 162 out of 164 sites being identical (98.78%), followed by ITS2 (202 out of 219, 92.24%) and ITS1 (185 out of 207, 89.37%). As shown in Figure 3, haplotype diversity analysis identified nine haplotypes among the three parents Badila, Zhanjiang Qingpi, and Guangdong 32, with three haplotypes observed in each.

3.3. Tetra-Primer ARMS PCR Identification of Genuine Hybrids Between S. officinarum and N. porphyrocoma

Based on interspecific differences and conserved intraspecific SNP sites, species-specific SNP alleles for S. officinarum and N. porphyrocoma were detected in the nrDNA-ITS region at position 183 bp (Figure 3). These SNPs were used to design two species-specific primers using Oligo 7. The forward primer FI-So was designed specifically to amplify S. officinarum and was non-functional with N. porphyrocoma, whereas the reverse primer RI-Np was designed to target N. porphyrocoma (Figure 3). To enhance specificity, the third-to-last base of the 3′ primer end was deliberately designed to create a mismatch to any of the target sequences. In addition, as shown in Table 1, FI-So contained a G-T substitution at the last base of the 3′ primer end in S. officinarum relative to N. porphyrocoma, whereas RI-Np had an A-C substitution at the last base of the 3′ primer end in N. porphyrocoma relative to S. officinarum.
As shown in Figure 4A, these species-specific primers, with mismatches at the 3′ end, enabled the preferential amplification of one allele over another and were designated as inner primers. Two universal primers, ITS1 and RO, common to both S. officinarum and N. porphyrocoma, were referred to as outer primers in the tetra-primer ARMS-PCR technique. As illustrated in Figure 4B, the expected amplification products included a 486 bp fragment from S. officinarum amplified by the Forward Inner and Reverse Outer primers and a 200 bp fragment from N. porphyrocoma amplified by the Forward Outer and Reverse Inner primers. Additionally, a 647 bp product, serving as an internal control, was expected from both S. officinarum and N. porphyrocoma when using the Forward Outer and Reverse Outer primers. These three PCR products differed significantly in length, facilitating differentiation via agarose gel electrophoresis. The tetra-primer ARMS-PCR technique was employed to amplify DNA from the three parental species and all suspected F1 hybrids. As shown in Figure 5, both S. officinarum and N. porphyrocoma parents produced a 647 bp PCR product. Additionally, the S. officinarum parent uniquely produced a 486 bp fragment, while the N. porphyrocoma parent produced a 200 bp fragment. Among all suspected F1 hybrids, fourteen F1 progeny from Badila × Guangdong 32 (Figure 5A) and eleven F1 progeny from Zhanjiang Qingpi × Guangdong 32 (Figure 5B) exhibited both the S. officinarum and N. porphyrocoma PCR products, confirming these materials as genuine F1 hybrids from the intergeneric cross of S. officinarum and N. porphyrocoma.

3.4. Chromosome Composition of the F1 Intergeneric Hybrids by GISH

To further investigate the genomic composition of the F1 intergeneric hybrids, twenty-five hybrids were selected based on their confirmation as true hybrids via tetra-primer ARMS-PCR identification. This group included fourteen F1 hybrids from Badila × Guangdong 32 and eleven F1 hybrids from Zhanjiang Qingpi × Guangdong 32. The genomic compositions of these hybrids were determined using GISH. It has been previously reported that S. officinarum has 2n = 80 chromosomes [3], while N. porphyrocoma has 2n = 30 chromosomes [37]. As shown in Figure 6 and Figure 7, GISH analysis revealed that F1 hybrids from Badila × Guangdong 32 contained 15 N. porphyrocoma chromosomes and 40 S. officinarum chromosomes in mitotic metaphase (Figure 6). Similarly, F1 hybrids from Zhanjiang Qingpi × Guangdong 32 displayed identical chromosomal compositions (Figure 7). These results demonstrated that these hybrids’ genome contained both S. officinarum and N. porphyrocoma, and the chromosomal transfer model in the F1 generation of S. officinarum × N. porphyrocoma adheres to the n + n chromosomal transfer pattern.

3.5. Main Agronomic Traits of F1 Hybrids

As shown in Figure 8 and Supplementary Materials Figure S1, the intergeneric hybrid plants exhibited a stronger tillering ability compared to the female parent, resembling the male parent N. porphyrocoma (Figure 8A–C and Figure S1). The leaf width and stalk diameter of the hybrids were intermediate between those of the female and male parents (Figure 8D–H), while the stalk color closely resembled that of the female parent (Figure 8I–K). The agronomic characteristics of the F1 intergeneric hybrid plants are summarized in Table 2. For hybrids from Badila × Guangdong 32, the juice Brix value (11.11%) was approximately the average of the parental values. The hybrids produced an average of 20.93 tillers, which was lower than that of Guangdong 32 (64.33) but greater than that of Badila (5.08). The mean stalk length, stalk diameter, internode number, and leaf width of the hybrids were all lower than those of Badila but higher than those of Guangdong 32. Notably, the hybrids had an average leaf length of 166.20 cm, which was significantly greater than that of both the female parent Badila (136.33 cm) and the male parent Guangdong 32 (124.80 cm). For hybrids from Zhanjiang Qingpi × Guangdong 32, the hybrids’ mean tiller production (22.73) was lower than that of the male parent Guangdong 32 (64.33) but higher than that of the female parent Zhanjiang Qingpi (5.25). The mean stalk length, stalk diameter, internode number, leaf width, and juice Brix value of the hybrids were all lower than those of Zhanjiang Qingpi but greater than those of Guangdong 32. Similarly, the average leaf length of the hybrids was 165.47 cm, which was significantly greater than that of the female parent Zhanjiang Qingpi (136.47 cm) and the male parent Guangdong 32 (124.80 cm). Taken together, these results indicate that the F1 hybrids inherited the superior tillering traits from the paternal parent, N. porphyrocoma, but did not inherit the high-sugar traits from the maternal parent, S. officinarum.

4. Discussion

Verifying true intergeneric hybrids continues to pose a significant challenge in the innovation of sugarcane germplasm. In this study, we identified base 183 as a stable mutation within the nrDNA-ITS sequence of S. officinarum and N. porphyrocoma. We designed primers for tetra-primer ARMS-PCR based on this SNP in the nrDNA-ITS sequence. After optimization, the primers ITS1, RO, FI-So, and RI-Np were found effective for identifying intergeneric hybrids of S. officinarum × N. porphyrocoma. To the best of our knowledge, this is the first instance of using tetra-primer ARMS-PCR to identify S. officinarum, N. porphyrocoma, and their intergeneric hybrids. Additionally, GISH results corroborated the reliability of the tetra-primer ARMS-PCR identification outcomes. These findings are valuable for the verification of true intergeneric hybrids and for enhancing the efficiency of sugarcane germplasm innovation.
In sugarcane breeding, the introgression of beneficial genes through intergeneric hybridization represents a powerful strategy for enhancing crop productivity and adaptability [5]. Intergeneric hybrids of Saccharum with related genera, such as E. arundinaceus [9], E. rockii [11], E. fulvus [8], and Miscanthus [10], have been developed. Notably, some excellent progeny resulting from the hybridization of Saccharum with E. arundinaceus have been utilized as parents in commercial breeding programs [5,38]. Within the genus Narrenga, closely related to Saccharum, the species N. porphyrocoma has the potential to impart valuable traits to sugarcane, including adaptation to biotic and abiotic stresses, ratooning ability, and high biomass production [7,12,13]. In this study, seventeen F1 hybrids were produced from the intergeneric cross between S. officinarum (Badila, female) and N. porphyrocoma (Guangdong 32, male), while thirteen F1 hybrids were generated using S. officinarum Zhanjiang Qingpi as the maternal parent [Figure 5]. Traditional methods for identifying Saccharum intergeneric hybrids, which primarily rely on morphological characteristics, often result in ambiguous identifications due to the difficulty in distinguishing genuine hybrids from a high level of selfing in the female Saccharum parent. In contrast, molecular marker methods, such as RAPD, AFLP, and SSR, have increasingly been employed as conventional techniques for identifying hybrid crosses between Saccharum and its related genera over the past two decades [7,8,11,14]. However, all of these methods rely on the presence of multiple amplification bands to identify species, which can yield variable results in the authentication of sugarcane germplasms. Several characteristics of nrDNA-ITS make it a valuable tool for evaluating and analyzing evolutionary relationships, as well as distinguishing between Saccharum and its related genera, including its high variability, rapid evolutionary rate, and the simplicity of PCR amplification and sequencing [26,27,39]. In this study, a 678 bp fragment was amplified using the general primers ITS1 and ITS4, which encompass the entire ITS sequence (Figure 2). SNPs in the nrDNA-ITS sequence have been identified in numerous crops and have served as valuable molecular markers for identifying interspecies germplasms [40], thereby contributing to molecular breeding strategies for crops. In this study, our results demonstrate that the SNP at position 183 bp in the nrDNA-ITS region is reliable for discriminating between S. officinarum and N. porphyrocoma (Figure 3 and Table 1).
Tetra-primer ARMS-PCR, a derivative technique based on standard PCR, is specifically designed for SNP detection [17]. The SNP site in the nrDNA-ITS region, along with the successfully employed ARMS-PCR technique, has been used to distinguish between S. officinarum and S. spontaneum and was validated through allele-specific PCR amplification [32,33,34]. Yang et al. [32] reported a stable mutation at base 89 in the nrDNA-ITS sequence of the genus Saccharum, which has since been successfully applied to identify genetic signatures of S. spontaneum within the genus Saccharum. In this study, tetra-primer ARMS-PCR results showed that genuine hybrid generations between S. officinarum and N. porphyrocoma yielded three bands (647 bp, 486 bp, 200 bp), while the false hybrids produced two bands (647 bp, 486 bp), similar to the maternal parent S. officinarum (Figure 5). These findings highlight the tetra-primer ARMS-PCR assay as a rapid, simple, and cost-effective method for identifying intergeneric hybrids from S. officinarum and N. porphyrocoma. Additionally, GISH has proven to be an effective method for examining the chromosome composition of intergeneric hybrids between Saccharum and its related genera, providing a detailed description of the genomic composition of the hybrids [41,42]. In this study, GISH analysis revealed that F1 hybrids, confirmed as genuine by species-specific markers, contained 55 chromosomes (Figure 6A,B and Figure 7A,B). Among these, 40 chromosomes originated from S. officinarum, and 15 chromosomes originated from N. porphyrocoma (Figure 6C and Figure 7C), conforming to the n + n inheritance pattern and suggesting genomic balance in the F1 generation. n + n transmission in the F1 generation is a common mode of inheritance and has been reported in previous studies [6,38,43]. These findings align with tetra-primer ARMS-PCR results (Figure 5), further validating the reliability of the molecular markers.
In general, the introgression of S. officinarum clones with N. porphyrocoma improved tillering ability and leaf length; however, the intergeneric F1 hybrids exhibited low sucrose levels [Figure 8 and Table 2], which hindered the effective utilization of N. porphyrocoma. Consequently, our subsequent breeding program will require a backcrossing strategy with S. officinarum or other high-sugar hybrids to improve the sucrose traits of the F1 hybrids and develop new varieties with commercially acceptable sucrose levels and enhanced tillering.

5. Conclusions

We identified true intergeneric hybrids between S. officinarum and N. porphyrocoma through allele-specific ARMS-PCR analysis using specific primers designed for the SNP at base 183 of the nrDNA-ITS sequences. Our results demonstrate that nrDNA-ITS barcoding, combined with tetra-primer ARMS-PCR, represents an efficient and reliable approach for hybrid identification. To further validate the molecular findings, GISH assays were employed to analyze the chromosome composition of the hybrids, confirming the molecular marker identification results. The successful identification of intergeneric hybrids facilitates the incorporation of valuable genes from N. porphyrocoma. This advancement lays a strong foundation for integrating N. porphyrocoma traits into modern sugarcane cultivars and highlights the utility of nrDNA-ITS barcoding, combined with tetra-primer ARMS-PCR, for marker-assisted identification of genuine intergeneric hybrids.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/agronomy15010121/s1: File S1: Fifteen nrDNA-ITS sequences of S. officinarum and N. porphyrocoma retrieved from the NCBI database; Figure S1: Plant type with tillering of S. officinarum Badila (A) and Zhanjiang Qingpi (B).

Author Contributions

H.C. and G.W. designed the experiments. G.W. performed most of the experiments and wrote the manuscript. H.C. and W.Z. conducted the sugarcane crossing experiments. W.Z. and Q.W. (Qingdan Wu) collected the phenotypic data. Y.Q., Q.L., J.W. (Jianqiang Wang), S.S., and Z.W. analyzed data. J.W. (Jiantao Wu), Y.A., and Q.W. (Qinnan Wang) supervised this study. H.C. conceived and supervised the research and writing. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by GDAS’ Project of Science and Technology Development (2022GDASZH-2022010102) and the GDAS’s Project of Technical Innovation and Incubation Service Platform Construction (2021GDASYL-20210301001) and was supported by provincial scientific research institutions’ stability support sub-project in 2020 “Breeding and construction of healthy seedling propagation system of new sugarcane varieties (lines)”.

Data Availability Statement

The datasets supporting the conclusions of this manuscript and materials generated in this study are available from the corresponding author upon request.

Acknowledgments

The authors express their sincere gratitude to Zuhu Deng from Fujian Agriculture and Forestry University for his invaluable assistance in conducting the GISH assay.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Dillon, S.L.; Shapter, F.M.; Henry, R.J.; Cordeiro, G.; Izquierdo, L.; Lee, L.S. Domestication to crop improvement: Genetic resources for Sorghum and Saccharum (Andropogoneae). Ann. Bot. 2007, 100, 975–989. [Google Scholar] [CrossRef] [PubMed]
  2. Waclawovsky, A.J.; Sato, P.M.; Lembke, C.G.; Moore, P.H.; Souza, G.M. Sugarcane for bioenergy production: An assessment of yield and regulation of sucrose content. Plant Biotechnol. J. 2010, 8, 263–276. [Google Scholar] [CrossRef] [PubMed]
  3. D’Hont, A.; Ison, D.; Alix, K.; Roux, C.; Glaszmann, J.C. Determination of basic chromosome numbers in the genus Saccharum by physical mapping of ribosomal RNA genes. Genome 1998, 41, 221–225. [Google Scholar] [CrossRef]
  4. Piperidis, N.; D’Hont, A. Sugarcane genome architecture decrypted with chromosome-specific oligo probes. Plant J. 2020, 103, 2039–2051. [Google Scholar] [CrossRef] [PubMed]
  5. Qi, Y.W.; Gao, X.N.; Zeng, Q.Y.; Zheng, Z.; Wu, C.W. Sugarcane breeding, germplasm development and related molecular research in China. Sugar Tech 2022, 24, 73–85. [Google Scholar] [CrossRef]
  6. Li, H.W.; Ma, T.H.; Yao, S.Y.; Shang, K.C. Cytological studies of sugarcane and its relatives. ⅩⅡ. F1 hybrids of POJ2725 × Narenga porphyrocoma (Hance) Bor. Taiwan Sug. 1954, 1, 1–11. [Google Scholar]
  7. Liu, X.H.; Fang, F.X.; Zhang, R.H.; Song, H.Z.; Yang, R.Z.; Gao, Y.J.; Ou, H.P.; Lei, J.C.; Luo, T.; Duan, W.X.; et al. Identification of progenies from sugarcane × Narenga porphyrocoma (Hance) Bor. by SSR marker. Southwest China J. Agric. Sci. 2012, 25, 38–43. (In Chinese) [Google Scholar]
  8. Wang, X.H.; Yang, Q.H.; Li, F.S.; He, L.L.; He, S.C. Molecular identification of Saccharum spp. × Erianthus fulvus hybrids using sequence-characterized amplified region markers. Crop Sci. 2009, 49, 864–870. [Google Scholar] [CrossRef]
  9. Cai, Q.; Aitken, K.; Deng, H.H.; Chen, X.W.; Fu, C.; Jackson, P.A.; Mcintyre, C.L. Verification of the introgression of Erianthus arundinaceus germplasm into sugarcane using molecular markers. Plant Breed. 2005, 124, 322–328. [Google Scholar] [CrossRef]
  10. Kar, S.; Weng, T.Y.; Nakashima, T.; Villanueva-Morales, A.; Stewart, J.R.; Sacks, E.J.; Terajima, Y.; Yamada, T. Field performance of Saccharum × Miscanthus intergeneric hybrids (miscanes) under cool climatic conditions of northern Japan. Bioenerg. Res. 2020, 13, 132–146. [Google Scholar] [CrossRef]
  11. Aitken, K.; Li, J.; Wang, L.; Cai, Q.; Fan, Y.H.; Jackson, P. Characterization of intergeneric hybrids of Erianthus rockii and Saccharum using molecular markers. Genet. Resour. Crop Evol. 2007, 54, 1395–1405. [Google Scholar] [CrossRef]
  12. Duan, W.X.; Zhang, B.Q.; Zhou, S.; Huang, Y.X.; Wang, Z.P.; Gao, Y.J.; Yang, C.F.; Lin, S.H.; Zhang, G.M. Identification and preliminary evaluation of smut resistance in BC1 hybrids derived from Saccharum L. × Narenga porphyrocoma (Hance) Bor. J. China Agric. Univ. 2018, 23, 29–37. (In Chinese) [Google Scholar] [CrossRef]
  13. Wei, J.J.; Xiu, Z.H.; Ou, H.P.; Chen, J.H.; Tan, H.W.; Liu, X.H. Transcriptome profile analysis of twisted leaf disease response in susceptible sugarcane with Narenga porphyrocoma genetic background. Trop. Plant Biol. 2019, 12, 293–303. [Google Scholar] [CrossRef]
  14. Koujalagi, D.; Jeena, A.S.; Singh, S.P.; Chourasia, K.; Khan, K.A. Hybridity tests to identify true hybrids in sugarcane. J. Hill Agric. 2017, 8, 10–16. [Google Scholar] [CrossRef]
  15. Devarumath, R.M.; Kalwade, S.B.; Kawar, P.G.; Sushir, K.V. Assessment of Genetic Diversity in Sugarcane Germplasm Using ISSR and SSR Markers. Sugar Tech 2012, 14, 334–344. [Google Scholar] [CrossRef]
  16. Brookes, A.J. The essence of SNPs. Gene 1999, 234, 177–186. [Google Scholar] [CrossRef] [PubMed]
  17. Ye, S.; Dhillon, S.; Ke, X.; Collins, A.R.; Day, I.N. An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Res. 2001, 29, E88. [Google Scholar] [CrossRef]
  18. Medrano, R.F.; de Oliveira, C.A. Guidelines for the tetra-primer ARMS-PCR technique development. Mol. Biotechnol. 2014, 56, 599–608. [Google Scholar] [CrossRef]
  19. Park, H.J.; Kim, S.J.; Nie, H.L.; Kim, H.Y.; Lee, J.E. Molecular identification of sweet potato accessions using ARMS-PCR based on SNPs. J. Plant Biotechnol. 2020, 47, 124–130. [Google Scholar] [CrossRef]
  20. Chen, J.; Xu, X.; Dalhaimer, P.; Zhao, L. Tetra-Primer amplification-refractory mutation system (ARMS)-PCR for genotyping mouse leptin gene mutation. Animals 2022, 12, 2680. [Google Scholar] [CrossRef] [PubMed]
  21. Yu, K.X.; Chen, X.; Hu, Q.Q.; Yao, Y.A.; Wang, X.M.; Xu, A.C.; Ge, J.; Guan, F. Development of a tetra-primer ARMS-PCR for identification of sika and red deer and their hybrids. Anal. Sci. 2023, 39, 1947–1956. [Google Scholar] [CrossRef]
  22. Blin, M.; Dametto, S.; Agniwo, P.; Webster, B.L.; Angora, E.; Dabo, A.; Boissier, J. A duplex tetra-primer ARMS-PCR assay to discriminate three species of the Schistosoma haematobium group: Schistosoma curassoni, S. bovis, S. haematobium and their hybrids. Parasit Vectors 2023, 16, 121. [Google Scholar] [CrossRef] [PubMed]
  23. Piperidis, N. GISH: Resolving interspecific and intergeneric hybrids. Methods Mol. Biol. 2021, 2222, 381–394. [Google Scholar] [CrossRef] [PubMed]
  24. Wu, J.Y.; Huang, Y.J.; Deng, Z.H.; Li, Q.W.; Huang, Z.X.; Chen, R.K.; Zhang, M.Q. Unexpected inheritance pattern of Erianthus arundinaceus chromosomes in the intergeneric progeny between Saccharum spp. and Erianthus arundinaceus. PLoS ONE 2014, 9, e110390. [Google Scholar] [CrossRef]
  25. Yu, F.; Wang, P.; Deng, Z.H.; Wu, J.Y.; Yang, Y.Q.; Chen, R.K.; Zhang, M.Q.; Xu, L.N. Characterization of chromosome composition of sugarcane in nobilization by using genomic in situ hybridization. Mol. Cytogenet. 2018, 11, 35. [Google Scholar] [CrossRef]
  26. Yang, C.F.; Yang, L.T.; Li, Y.R.; Zhang, G.M.; Zhang, C.Y.; Wang, W.Z. Sequence characteristics and phylogenetic implications of the nrDNA internal transcribed spacers (ITS) in protospecies and landraces of sugarcane (Saccharum officinarum L.). Sugar Tech 2016, 18, 8–15. [Google Scholar] [CrossRef]
  27. Liu, X.L.; Li, X.J.; Liu, H.B.; Xu, C.H.; Lin, X.Q.; Li, C.J.; Deng, Z.H. Phylogenetic analysis of different ploidy Saccharum spontaneum based on rDNA-ITS sequences. PLoS ONE 2016, 11, e0151524. [Google Scholar] [CrossRef] [PubMed]
  28. Lv, Y.W.; He, Z.H.; Xiao, Y.; Ouyang, K.X.; Wang, X.; Hu, X.S. Population structure and genetic diversity in the natural distribution of Neolamarckia cadamba in China. Genes 2023, 14, 855. [Google Scholar] [CrossRef]
  29. Kim, W.J.; Yang, S.; Choi, G.; Park, I.; Noh, P.; Kim, M.J.; Moon, B.C. Accurate and rapid identification of Longan Arillus and Litchi Semen by a multiplex PCR assay. Plants 2020, 9, 948. [Google Scholar] [CrossRef]
  30. Sun, Y.W.; Liao, Y.J.; Hung, Y.S.; Chang, J.C.; Sung, J.M. Development of ITS sequence based SCAR markers for discrimination of Paphiopedilum armeniacum, Paphiopedilum micranthum, Paphiopedilum delenatii and their hybrids. Sci. Hortic. 2011, 127, 405–410. [Google Scholar] [CrossRef]
  31. Muto, T.; Kuronuma, T.; Ando, M.; Katsuoka, H.; Inaba, Z.; Watanabe, H. Development of the sequence-characterized amplified region (SCAR) marker for distinction of intergeneric hybrids between Argyranthemum frutescens (L.) Sch. Bip. and Rhodanthemum gayanum (Cross. & Durieu) B.H. Wilcox, K. Bremer & Humphries. Plant Biotechnol. 2020, 37, 77–81. [Google Scholar] [CrossRef]
  32. Yang, S.; Li, X.T.; Huang, F.; Deng, Z.H.; Chen, R.K.; Zhang, M.Q. A new method based on SNP of nrDNA-ITS to identify Saccharum spontaneum and its progeny in the genus Saccharum. PLoS ONE 2018, 13, e0197458. [Google Scholar] [CrossRef]
  33. Li, X.T.; Guo, Y.R.; Huang, F.; Wu, J.Y.; Zhang, M.Q.; Deng, Z.H. Authenticity identification of Saccharum officinarum and Saccharum spontaneum germplasm materials. Agronomy 2022, 12, 819. [Google Scholar] [CrossRef]
  34. Lin, P.P.; Hu, X.G.; Xue, L.; Zhang, M.Q.; Deng, Z.H.; Yu, F. Identification of sugarcane S. spontaneum (Poaceae) germplasm: Evidence from rDNA-ITS and rDNA locus analyses. Agronomy 2022, 12, 3167. [Google Scholar] [CrossRef]
  35. Doyle, J.J.T.; Doyle, J.L. Isolation of plant DNA from fresh tissue. Focus 1990, 12, 39–40. [Google Scholar]
  36. D’Hont, A.; Grivet, L.; Feldmann, P.; Rao, S.; Berding, N.; Glaszmann, J.C. Characterisation of the double genome structure of modern sugarcane cultivars (Saccharum spp.) by molecular cytogenetics. Mol. Gen. Genet. 1996, 250, 405–413. [Google Scholar] [CrossRef] [PubMed]
  37. Chang, H.L.; Wang, Q.N.; Qiu, Y.S.; Qin, Y.X.; Li, X.T.; Fang, N. Production, identification and characterization of Erianthus rockii × Narenga porphyrocoma intergeneric hybrids as a new germplasm for sugarcane breeding and genetic research. Sugar Tech 2020, 22, 389–395. [Google Scholar] [CrossRef]
  38. Meena, M.R.; Govindaraj, P.; Kumar, R.A.; Elayaraja, K.; Appunu, C.; Kumar, R.; Chhabra, M.L.; Kulshreshtha, N.; Hemaprabha, G. Biomass and energy potential of Erianthus arundinaceus and Saccharum spontaneum-derived novel sugarcane hybrids in rainfed environments. BMC Plant Biol. 2024, 24, 198. [Google Scholar] [CrossRef]
  39. Hodkinson, T.R.; Chase, M.W.; Lledó, M.D.; Salamin, N.; Renvoize, S.A. Phylogenetics of Miscanthus, Saccharum and related genera (Saccharinae, Andropogoneae, Poaceae) based on DNA sequences from ITS nuclear ribosomal DNA and plastid trnL intron and trnL-F intergenic spacers. J. Plant Res. 2002, 115, 381–392. [Google Scholar] [CrossRef]
  40. Wang, H.T.; Kim, M.K.; Kim, Y.J.; Lee, H.N.; Jin, H.Z.; Chen, J.Y.; Yang, D.C. Molecular authentication of the Oriental medicines Pericarpium citri reticulatae and Citri unshius pericarpium using SNP markers. Gene 2012, 494, 92–95. [Google Scholar] [CrossRef] [PubMed]
  41. Pachakkil, B.; Terajima, Y.; Ohmido, N.; Ebina, M.; Irei, S.; Hayashi, H.; Takagi, H. Cytogenetic and agronomic characterization of intergeneric hybrids between Saccharum spp. hybrid and Erianthus arundinaceus. Sci. Rep. 2019, 9, 1748. [Google Scholar] [CrossRef]
  42. Yang, S.; Zeng, K.; Deng, Z.H.; Huang, Y.J.; Huang, F.; Chen, R.K.; Zhang, M.Q. Chromosome transmission in BC4 progenies of intergeneric hybrids between Saccharum spp. and Erianthus arundinaceus (Retz.) Jeswiet. Sci. Rep. 2019, 9, 2528. [Google Scholar] [CrossRef] [PubMed]
  43. Liu, X.H.; Zhang, R.H.; Li, H.B.; Zhang, G.M.; Song, H.Z.; Li, Y.R. The chromosome transmission of the hybrid progeny of S. officinarum and Narenga porphyrocoma and the inheritance of Narenga porphyrocoma blood relationship in the offspring. Mol. Plant Breed. 2019, 17, 411–418. (In Chinese) [Google Scholar]
Agronomy 15 00121 g001
Figure 1. Schematic representation of the nrDNA-ITS region from S. officinarum and N. porphyrocoma. Numbers inside the bars represent the lengths of ITS1, 5.8S rDNA, and ITS2 regions of S. officinarum and N. porphyrocoma ITS sequences retrieved from the NCBI database. The red arrow indicates the position of the universal primers used for amplifying the ITS region.
Figure 1. Schematic representation of the nrDNA-ITS region from S. officinarum and N. porphyrocoma. Numbers inside the bars represent the lengths of ITS1, 5.8S rDNA, and ITS2 regions of S. officinarum and N. porphyrocoma ITS sequences retrieved from the NCBI database. The red arrow indicates the position of the universal primers used for amplifying the ITS region.
Agronomy 15 00121 g001
Agronomy 15 00121 g002
Figure 2. Electrophoretogram of nrDNA-ITS PCR products. Lane M: DL5000 DNA marker; lanes 1–2: Badila, belonging to S. officinarum; lanes 3–4: Zhanjiang Qingpi, belonging to S. officinarum; lanes 5–6: N. porphyrocoma.
Figure 2. Electrophoretogram of nrDNA-ITS PCR products. Lane M: DL5000 DNA marker; lanes 1–2: Badila, belonging to S. officinarum; lanes 3–4: Zhanjiang Qingpi, belonging to S. officinarum; lanes 5–6: N. porphyrocoma.
Agronomy 15 00121 g002
Agronomy 15 00121 g003
Figure 3. Multiple sequence alignments of the nrDNA-ITS region from three clones of S. officinarum and N. porphyrocoma, including the positions and directions of primers used in this study. The bases with blue highlight show the identical sequences of the two species. Other highlight bases indicate the SNP sites. ‘.’ indicates deletion. Green arrows indicate the amplification direction of primers. Different colored boxes, along with the corresponding color names on each box, represent the respective regions of nrDNA-ITS. Heterozygous sites were defined according to IUPAC, with R = A/G.
Figure 3. Multiple sequence alignments of the nrDNA-ITS region from three clones of S. officinarum and N. porphyrocoma, including the positions and directions of primers used in this study. The bases with blue highlight show the identical sequences of the two species. Other highlight bases indicate the SNP sites. ‘.’ indicates deletion. Green arrows indicate the amplification direction of primers. Different colored boxes, along with the corresponding color names on each box, represent the respective regions of nrDNA-ITS. Heterozygous sites were defined according to IUPAC, with R = A/G.
Agronomy 15 00121 g003
Agronomy 15 00121 g004
Figure 4. Schematic representation of the tetra-primer ARMS-PCR assay for SNP genotyping (A) and a diagram illustrating the expected PCR product sizes for S. officinarum, N. porphyrocoma, and their F1 hybrids on the agarose gel (B). (A) Targeted SNPs are highlighted in red, and the blue underlined bases in the Forward Inner primer and the Reverse Inner primer represent mismatches with the primer binding sequences. Colored thick arrows indicate the amplification direction of primers, and black thick T-symbols denote ineffective primer amplification. (B) Different colors indicate distinct primers involved in the PCR reaction.
Figure 4. Schematic representation of the tetra-primer ARMS-PCR assay for SNP genotyping (A) and a diagram illustrating the expected PCR product sizes for S. officinarum, N. porphyrocoma, and their F1 hybrids on the agarose gel (B). (A) Targeted SNPs are highlighted in red, and the blue underlined bases in the Forward Inner primer and the Reverse Inner primer represent mismatches with the primer binding sequences. Colored thick arrows indicate the amplification direction of primers, and black thick T-symbols denote ineffective primer amplification. (B) Different colors indicate distinct primers involved in the PCR reaction.
Agronomy 15 00121 g004
Agronomy 15 00121 g005
Figure 5. Electrophoretogram of tetra-primer ARMS-PCR products for identifying intergeneric hybrids from S. officinarum × N. porphyrocoma. (A) Lane M: DL5000 DNA marker; lanes 1–2: S. officinarum Badila; lanes 3–4: N. porphyrocoma Guangdong 32; lanes 5–21: seventeen suspected F1 intergeneric hybrids from Badila × Guangdong 32; lane 22: ddH2O. (B) Lane M: DL5000 DNA marker; lanes 1–2: S. officinarum Zhanjiang Qingpi; lanes 3–4: N. porphyrocoma Guangdong 32; lanes 5–17: thirteen suspected F1 interspecific hybrids from Zhanjiang Qingpi × Guangdong 32; lane 18: ddH2O.
Figure 5. Electrophoretogram of tetra-primer ARMS-PCR products for identifying intergeneric hybrids from S. officinarum × N. porphyrocoma. (A) Lane M: DL5000 DNA marker; lanes 1–2: S. officinarum Badila; lanes 3–4: N. porphyrocoma Guangdong 32; lanes 5–21: seventeen suspected F1 intergeneric hybrids from Badila × Guangdong 32; lane 22: ddH2O. (B) Lane M: DL5000 DNA marker; lanes 1–2: S. officinarum Zhanjiang Qingpi; lanes 3–4: N. porphyrocoma Guangdong 32; lanes 5–17: thirteen suspected F1 interspecific hybrids from Zhanjiang Qingpi × Guangdong 32; lane 18: ddH2O.
Agronomy 15 00121 g005
Agronomy 15 00121 g006
Figure 6. GISH analysis of F1 intergeneric hybrids between S. officinarum Badila and N. porphyrocoma. (A) C19-15; (B) C19-28; (C) statistical analysis of S. officinarum and N. porphyrocoma chromosomes from (A). The genomic DNA of S. officinarum Badila (labeled with red) and that of N. porphyrocoma Guangdong 32 (labeled with green) were utilized as probes, with the chromosomes counterstained using DAPI (blue). Bars = 10 μm.
Figure 6. GISH analysis of F1 intergeneric hybrids between S. officinarum Badila and N. porphyrocoma. (A) C19-15; (B) C19-28; (C) statistical analysis of S. officinarum and N. porphyrocoma chromosomes from (A). The genomic DNA of S. officinarum Badila (labeled with red) and that of N. porphyrocoma Guangdong 32 (labeled with green) were utilized as probes, with the chromosomes counterstained using DAPI (blue). Bars = 10 μm.
Agronomy 15 00121 g006
Agronomy 15 00121 g007
Figure 7. GISH analysis of F1 intergeneric hybrids between S. officinarum Zhanjiang Qingpi and N. porphyrocoma. (A) C19-41; (B) C19-46; (C) statistical analysis of S. officinarum and N porphyrocoma chromosomes from (A). The genomic DNA of S. officinarum Zhanjiang Qingpi (labeled with red) and that of N. porphyrocoma Guangdong 32 (labeled with green) were utilized as probes, with the chromosomes counterstained using DAPI (blue). Bars = 10 μm.
Figure 7. GISH analysis of F1 intergeneric hybrids between S. officinarum Zhanjiang Qingpi and N. porphyrocoma. (A) C19-41; (B) C19-46; (C) statistical analysis of S. officinarum and N porphyrocoma chromosomes from (A). The genomic DNA of S. officinarum Zhanjiang Qingpi (labeled with red) and that of N. porphyrocoma Guangdong 32 (labeled with green) were utilized as probes, with the chromosomes counterstained using DAPI (blue). Bars = 10 μm.
Agronomy 15 00121 g007
Agronomy 15 00121 g008
Figure 8. Plant phenotypes of intergeneric hybrids between S. officinarum and N. porphyrocoma. (A–C) Plant type with tillering of N. porphyrocoma Guangdong 32 (A) and F1 intergeneric hybrids from S. officinarum Badila × Guangdong 32 (B) and S. officinarum Zhanjiang Qingpi × Guangdong 32 (C). (D–H) Leaf phenotype of S. officinarum Badila (D), S. officinarum Zhanjiang Qingpi (E), N. porphyrocoma Guangdong 32 (F), F1 intergeneric hybrids from Badila × Guangdong 32 (G), and F1 intergeneric hybrids from Zhanjiang Qingpi × Guangdong 32 (H). (I–K) Cane type of the three parental species (S. officinarum Badila, Zhanjiang Qingpi, and N. porphyrocoma Guangdong 32, shown sequentially from left to right) (I) and F1 intergeneric hybrids from Badila × Guangdong 32 (J) and Zhanjiang Qingpi × Guangdong 32 (K). Bars = 10 cm for (A,D–K), 20 cm for (B,C).
Figure 8. Plant phenotypes of intergeneric hybrids between S. officinarum and N. porphyrocoma. (A–C) Plant type with tillering of N. porphyrocoma Guangdong 32 (A) and F1 intergeneric hybrids from S. officinarum Badila × Guangdong 32 (B) and S. officinarum Zhanjiang Qingpi × Guangdong 32 (C). (D–H) Leaf phenotype of S. officinarum Badila (D), S. officinarum Zhanjiang Qingpi (E), N. porphyrocoma Guangdong 32 (F), F1 intergeneric hybrids from Badila × Guangdong 32 (G), and F1 intergeneric hybrids from Zhanjiang Qingpi × Guangdong 32 (H). (I–K) Cane type of the three parental species (S. officinarum Badila, Zhanjiang Qingpi, and N. porphyrocoma Guangdong 32, shown sequentially from left to right) (I) and F1 intergeneric hybrids from Badila × Guangdong 32 (J) and Zhanjiang Qingpi × Guangdong 32 (K). Bars = 10 cm for (A,D–K), 20 cm for (B,C).
Agronomy 15 00121 g008
Table 1. Sequences of the two species-specific primers developed in this study compared with the reported ITS sequences of S. officinarum and N. porphyrocoma.
Table 1. Sequences of the two species-specific primers developed in this study compared with the reported ITS sequences of S. officinarum and N. porphyrocoma.
Species NameHaplotype of ITS SequenceFI-So (5′-3′)RI-Np (5′-3′)GenBank Accession No.
GGAACACCTAAATTGCCTTGCGGGCCGACCGCCCCGCTGA
S. officinarumSoITS-1GGAACACCTAAATTGCCTTGCGGGCCGACCGCTCCACCGCAB250691 SRR528718
SoITS-2GGAACACCTATATTGCCTTGCGGGCCGACCGCTCCACCGCAB250692 AY116284
SoITS-3GGAACACCTATATTGCCTTGCGGGCCGATCGCTCCACCGCAF345229 AF345230 AF345231
SoITS-4GGAGCACCTATATTGCCCTGCGGGCCGACCGCTCCACCGCAB250693
N. porphyrocomaNpITS-1GGAACACTCATATTGCCTTGCTGGCCGACCGCTCCGCCGAAF345233AF345234AF345235AF345236
NpITS-2GGAACACTCATATTGCCCTGCTGGCCGACCGCTCCGCCGAJX156343 SRR3399436
NpITS-3GGAACACTTATATTGCCTTGCTGGCCGACCGCTCCGCCGAEF211957
Bold letters indicate the SNP used to design species-specific primers in this study.
Table 2. Main agronomic traits of intergeneric hybrids between S. officinarum and N. porphyrocoma.
Table 2. Main agronomic traits of intergeneric hybrids between S. officinarum and N. porphyrocoma.
Material NameTiller Number (no./stool)Stalk Length (cm)Internode NumberLeaf Length (cm)Leaf Width (cm)Stalk Diameter (mm)Juice Brix %
Badila5.08 ± 0.67207.20 ± 13.1520.25 ± 1.14136.33 ± 6.875.46 ± 0.2739.29 ± 2.4820.98 ± 0.62
Zhanjiang Qingpi5.25 ± 0.62213.53 ± 16.5716.08 ± 1.16136.47 ± 5.637.10 ± 0.4940.39 ± 2.4415.16 ± 0.68
Guangdong 3264.33 ± 11.39163.87 ± 15.365.67 ± 0.65124.80 ± 6.881.74 ± 0.176.77 ± 0.654.34 ± 1.08
Badila × Guangdong 3220.93 ± 2.65 **174.08 ± 7.32 **15.73 ± 1.03 **166.20 ± 11.45 **4.80 ± 0.27 **17.48 ± 1.93 **11.11 ± 1.54 **
Zhanjiang Qingpi × Guangdong 3222.73 ± 3.03 **183.67 ± 12.89 **13.67 ± 1.11 **165.47 ± 7.41 **6.81 ± 0.2819.12 ± 1.82 **12.33 ± 1.53 **
Data and error bars represent mean ± SD. ** Significant difference of F1 hybrids in Student’s t test (p < 0.01).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, G.; Zhang, W.; Qin, Y.; Wu, Q.; Liang, Q.; Wu, J.; Sun, S.; Wang, Z.; An, Y.; Wang, J.; et al. Verification of the Introgression of Narenga porphyrocoma Germplasm into Saccharum officinarum Using Molecular Markers and GISH Analysis. Agronomy 2025, 15, 121. https://doi.org/10.3390/agronomy15010121

AMA Style

Wang G, Zhang W, Qin Y, Wu Q, Liang Q, Wu J, Sun S, Wang Z, An Y, Wang J, et al. Verification of the Introgression of Narenga porphyrocoma Germplasm into Saccharum officinarum Using Molecular Markers and GISH Analysis. Agronomy. 2025; 15(1):121. https://doi.org/10.3390/agronomy15010121

Chicago/Turabian Style

Wang, Gang, Wei Zhang, Yuanxia Qin, Qingdan Wu, Qinggan Liang, Jiantao Wu, Shengren Sun, Zhuqing Wang, Yuxing An, Jianqiang Wang, and et al. 2025. "Verification of the Introgression of Narenga porphyrocoma Germplasm into Saccharum officinarum Using Molecular Markers and GISH Analysis" Agronomy 15, no. 1: 121. https://doi.org/10.3390/agronomy15010121

APA Style

Wang, G., Zhang, W., Qin, Y., Wu, Q., Liang, Q., Wu, J., Sun, S., Wang, Z., An, Y., Wang, J., Wang, Q., & Chang, H. (2025). Verification of the Introgression of Narenga porphyrocoma Germplasm into Saccharum officinarum Using Molecular Markers and GISH Analysis. Agronomy, 15(1), 121. https://doi.org/10.3390/agronomy15010121

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop