The Influencing Mechanisms of Reclaimed Water on N2O Production in a Multiyear Maize–Wheat Rotation
Abstract
:1. Introduction
2. Materials and Methods
2.1. Experimental Design
- (1)
- the abiotic groups
- (2)
- the transformational groups
2.2. Soil Sample Collection
2.3. Incubation Process
2.4. Measurement of Gas and Soil Nitrogen Levels
2.5. Real-Time PCR
2.6. Data Analysis and Statistical Analyses
3. Results
3.1. The N2O Emission under Abiotic Groups
3.2. N2O Production during NH4+ Oxidation under RW Irrigation
3.3. N2O Production during NO3− Reduction under RW Irrigation
3.4. N2O Production during NO2− Oxidation under RW Irrigation
3.5. The Transformation of Soil Nitrogen and Its Properties
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hu, Y.; Wu, W. Review and Development Strategy of Irrigation with Unconventional Water Resources in China. Chin. J. Eng. Sci. 2018, 20, 69–76. [Google Scholar] [CrossRef]
- Saha, J.K.; Panwar, N.; Srivastava, A.; Biswas, A.K.; Kundu, S.; Rao, A.S. Chemical, Biochemical, and Biological Impact of Untreated Domestic Sewage Water Use on Vertisol and Its Consequences on Wheat (Triticum aestivum) Productivity. Environ. Monit. Assess. 2010, 161, 403–412. [Google Scholar] [CrossRef] [PubMed]
- Sun, J.; Chen, L.; Rene, E.R.; Hu, Q.; Ma, W.; Shen, Z. Biological Nitrogen Removal Using Soil Columns for the Reuse of Reclaimed Water: Performance and Microbial Community Analysis. J. Environ. Manag. 2018, 217, 100–109. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Wang, G.; Wanyan, H. Treated Wastewater Irrigation Effect on Soil, Crop and Environment: Wastewater Recycling in the Loess Area of China. J. Environ. Sci. 2007, 19, 1093–1099. [Google Scholar] [CrossRef] [PubMed]
- Chen, W.; Lu, S.; Pan, N.; Wang, Y.; Wu, L. Impact of Reclaimed Water Irrigation on Soil Health in Urban Green Areas. Chemosphere 2015, 119, 654–661. [Google Scholar] [CrossRef]
- Zou, J.; Liu, S.; Qin, Y.; Pan, G.; Zhu, D. Sewage Irrigation Increased Methane and Nitrous Oxide Emissions from Rice Paddies in Southeast China. Agric. Ecosyst. Environ. 2009, 129, 516–522. [Google Scholar] [CrossRef]
- Chi, Y.; Yang, P.; Ren, S.; Ma, N.; Yang, J.; Xu, Y. Effects of Fertilizer Types and Water Quality on Carbon Dioxide Emissions from Soil in Wheat-Maize Rotations. Sci. Total Environ. 2020, 698, 134010. [Google Scholar] [CrossRef]
- Xu, S.; Hou, P.; Xue, L.; Wang, S.; Yang, L. Treated Domestic Sewage Irrigation Significantly Decreased the CH4, N2O and NH3 Emissions from Paddy Fields with Straw Incorporation. Atmos. Environ. 2017, 169, 1–10. [Google Scholar] [CrossRef]
- Mosier, A.; Kroeze, C.; Nevison, C.; Oenema, O.; Seitzinger, S.; van Cleemput, O. Closing the Global N2O Budget: Nitrous Oxide Emissions through the Agricultural Nitrogen Cycle. Nutr. Cycl. Agroecosyst. 1998, 52, 225–248. [Google Scholar] [CrossRef]
- Ruser, R.; Flessa, H.; Russow, R.; Schmidt, G.; Buegger, F.; Munch, J.C. Emission of N2O, N2 and CO2 from Soil Fertilized with Nitrate: Effect of Compaction, Soil Moisture and Rewetting. Soil Biol. Biochem. 2006, 38, 263–274. [Google Scholar] [CrossRef]
- Snyder, C.S.; Bruulsema, T.W.; Jensen, T.L.; Fixen, P.E. Review of Greenhouse Gas Emissions from Crop Production Systems and Fertilizer Management Effects. Agric. Ecosyst. Environ. 2009, 133, 247–266. [Google Scholar] [CrossRef]
- Wunderlin, P.; Mohn, J.; Joss, A.; Emmenegger, L.; Siegrist, H. Mechanisms of N2O Production in Biological Wastewater Treatment under Nitrifying and Denitrifying Conditions. Water Res. 2012, 46, 1027–1037. [Google Scholar] [CrossRef] [PubMed]
- Müller, C.; Laughlin, R.J.; Spott, O.; Rütting, T. Quantification of N2O Emission Pathways via a 15N Tracing Model. Soil Biol. Biochem. 2014, 72, 44–54. [Google Scholar] [CrossRef]
- Wei, C.; Ren, S.; Yang, P.; Wang, Y.; He, X.; Xu, Z.; Wei, R.; Wang, S.; Chi, Y.; Zhang, M. Effects of Irrigation Methods and Salinity on CO2 Emissions from Farmland Soil during Growth and Fallow Periods. Sci. Total Environ. 2021, 752, 141639. [Google Scholar] [CrossRef] [PubMed]
- Qian, Y.L.; Mecham, B. Long-Term Effects of Recycled Wastewater Irrigation on Soil Chemical Properties on Golf Course Fairways. Agron. J. 2005, 97, 717–721. [Google Scholar] [CrossRef]
- Xu, M.; Bai, X.; Pei, L.; Pan, H. A Research on Application of Water Treatment Technology for Reclaimed Water Irrigation. Int. J. Hydrogen Energy 2016, 41, 15930–15937. [Google Scholar] [CrossRef]
- Guo, W.; Andersen, M.N.; Qi, X.; Li, P.; Li, Z.; Fan, X.; Zhou, Y. Effects of Reclaimed Water Irrigation and Nitrogen Fertilization on the Chemical Properties and Microbial Community of Soil. J. Integr. Agric. 2017, 16, 679–690. [Google Scholar] [CrossRef]
- Ndour, N.Y.B.; Baudoin, E.; Guissé, A.; Seck, M.; Khouma, M.; Brauman, A. Impact of Irrigation Water Quality on Soil Nitrifying and Total Bacterial Communities. Biol. Fertil. Soils 2008, 44, 797–803. [Google Scholar] [CrossRef]
- Wang, Y.Y.; Hu, C.S.; Ming, H.; Zhang, Y.M.; Li, X.X.; Dong, W.X.; Oenema, O. Concentration Profiles of CH4, CO2 and N2O in Soils of a Wheat–Maize Rotation Ecosystem in North China Plain, Measured Weekly over a Whole Year. Agric. Ecosyst. Environ. 2013, 164, 260–272. [Google Scholar] [CrossRef]
- Dijkstra, F.A.; Fitzhugh, R.D. Aluminum Solubility and Mobility in Relation to Organic Carbon in Surface Soils Affected by Six Tree Species of the Northeastern United States. Geoderma 2003, 114, 33–47. [Google Scholar] [CrossRef]
- Kollah, B.; Parmar, R.; Vishwakarma, A.; Dubey, G.; Patra, A.; Chaudhari, S.K.; Mohanty, S.R. Nitrous Oxide Production from Soybean and Maize under the Influence of Weedicides and Zero Tillage Conservation Agriculture. J. Hazard. Mater. 2021, 402, 123572. [Google Scholar] [CrossRef] [PubMed]
- Han, S.; Zeng, L.; Luo, X.; Xiong, X.; Wen, S.; Wang, B.; Chen, W.; Huang, Q. Shifts in Nitrobacter- and Nitrospira-like Nitrite-Oxidizing Bacterial Communities under Long-Term Fertilization Practices. Soil Biol. Biochem. 2018, 124, 118–125. [Google Scholar] [CrossRef]
- Wei, C.; Li, F.; Yang, P.; Ren, S.; Wang, S.; Wang, Y.; Xu, Z.; Xu, Y.; Wei, R.; Zhang, Y. Effects of Irrigation Water Salinity on Soil Properties, N2O Emission and Yield of Spring Maize under Mulched Drip Irrigation. Water 2019, 11, 1548. [Google Scholar] [CrossRef]
- Meng, L.; Ding, W.; Cai, Z. Long-Term Application of Organic Manure and Nitrogen Fertilizer on N2O Emissions, Soil Quality and Crop Production in a Sandy Loam Soil. Soil Biol. Biochem. 2005, 37, 2037–2045. [Google Scholar] [CrossRef]
- Fan, C.; Duan, P.; Zhang, X.; Shen, H.; Chen, M.; Xiong, Z. Mechanisms Underlying the Mitigation of Both N2O and NO Emissions with Field-Aged Biochar in an Anthrosol. Geoderma 2020, 364, 114178. [Google Scholar] [CrossRef]
- Grabb, K.C.; Buchwald, C.; Hansel, C.; Wankel, S. A Dual Nitrite Isotopic Investigation of Chemodenitrification by Mineral-Associated Fe(II) and Its Production of Nitrous Oxide. Geochim. Cosmochim. Acta J. Geochem. Soc. Meteorit. Soc. 2017, 196, 388–402. [Google Scholar] [CrossRef]
- Ding, W.; Yan, C.; Cai, Z.; Yagi, K.; Zheng, X. Nitrous Oxide Emissions from an Intensively Cultivated Maize-Wheat Rotation Soil in the North China Plain. Sci. Total Environ. 2007, 373, 501–511. [Google Scholar] [CrossRef]
- Thorn, K.A.; Mikta, A.M. Nitrite Fixation by Humic Substances: Nitrogen-15 Nuclear Magnetic Resonance Evidence for Potential Intermediates in Chemodenitrification. Soil Sci. Soc. Am. J. 2000, 43, 568–583. [Google Scholar] [CrossRef]
- Spott, O.; Russow, R.; Stange, C.F. Formation of Hybrid N2O and Hybrid N2 Due to Codenitrification: First Review of a Barely Considered Process of Microbially Mediated N-Nitrosation. Soil Biol. Biochem. 2011, 43, 1995–2011. [Google Scholar] [CrossRef]
- Müller, C.; Rütting, T.; Kattge, J.; Laughlin, R.J.; Stevens, R.J. Estimation of Parameters in Complex 15N Tracing Models by Monte Carlo Sampling. Soil Biol. Biochem. 2007, 39, 715–726. [Google Scholar] [CrossRef]
- Duan, P.; Zhou, J.; Feng, L.; Jansen-Willems, A.B.; Xiong, Z. Pathways and Controls of N2O Production in Greenhouse Vegetable Production Soils. Biol. Fertil. Soils 2019, 55, 285–297. [Google Scholar] [CrossRef]
- Barbosa, E.A.A.; Gonçalves, I.Z.; dos Santos, L.N.S.; Nazário, A.A.; Feitosa, D.R.C.; do Carmo, J.B.; Matsura, E.E. Greenhouse Gas Emission of Sugarcane Irrigated with Treated Domestic Sewage by Subsurface Drip in Southeast Brazil. Irrig. Drain. 2022, 2748. [Google Scholar] [CrossRef]
- Li, M.; Xue, L.; Zhou, B.; Duan, J.; He, Z.; Wang, X.; Xu, X.; Yang, L. Effects of Domestic Sewage from Different Sources on Greenhouse Gas Emission and Related Microorganisms in Straw-Returning Paddy Fields. Sci. Total Environ. 2020, 718, 137407. [Google Scholar] [CrossRef] [PubMed]
- Shang, F.; Ren, S.; Yang, P.; Chi, Y.; Xue, Y. Effects of Different Irrigation Water Types, N Fertilizer Types, and Soil Moisture Contents on N2O Emissions and N Fertilizer Transformations in Soils. Water Air Soil Pollut. 2016, 227, 225–243. [Google Scholar] [CrossRef]
- Kampschreur, M.J.; Temmink, H.; Kleerebezem, R.; Jetten, M.S.M. Nitrous Oxide Emission during Wastewater Treatment. Water Res. 2009, 43, 4093–4103. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.W.; Miyahara, M.; Fushinobu, S.; Wakagi, T.; Shoun, H. Nitrous Oxide Emission from Nitrifying Activated Sludge Dependent on Denitrification by Ammonia-Oxidizing Bacteria. Bioresour. Technol. 2010, 101, 3958–3963. [Google Scholar] [CrossRef]
- Wrage, N.; Velthof, G.L.; van Beusichem, M.L.; Oenema, O. Role of Nitrifier Denitrification in the Production of Nitrous Oxide. Soil Biol. Biochem. 2001, 33, 1724–1732. [Google Scholar] [CrossRef]
- Hofstra, N.; Bouwman, A.F. Denitrification in Agricultural Soils: Summarizing Published Data and Estimating Global Annual Rates. Nutr. Cycl. Agroecosyst. 2005, 72, 267–278. [Google Scholar] [CrossRef]
- Wang, J.; Chadwick, D.R.; Cheng, Y.; Yan, X. Global Analysis of Agricultural Soil Denitrification in Response to Fertilizer Nitrogen. Sci. Total Environ. 2018, 616–617, 908–917. [Google Scholar] [CrossRef]
Groups | Abbreviation | Nitrogen | Soil | Water Quality | Notes |
---|---|---|---|---|---|
abiotic groups | RWT | NaNO2 | sterilized | RW | The added amount is 200 N mg kg−1 |
DWT | NaNO2 | sterilized | DW | The added amount is 200 N mg kg−1 | |
transformational groups | RNI | NaNO2 | Regular | RW | The added amount is 200 N mg kg−1; serving as a control treatment for non-biological groups |
DNI | NaNO2 | Regular | DW | ||
RAN | (NH4)2SO4 | Regular | RW | The added amount is 200 N mg kg−1 | |
DAN | (NH4)2SO4 | Regular | DW | The added amount is 200 N mg kg−1 | |
RKN | KNO3 | Regular | RW | The added amount is 200 N mg kg−1 | |
DKN | KNO3 | Regular | DW | The added amount is 200 N mg kg−1 | |
R0 | / | Regular | RW | As a control treatment for transformational groups | |
D0 | / | Regular | DW |
Index | RW | DW | Soil–DW | Soil–RW |
---|---|---|---|---|
CODcr (mg L−1) | 41.23 ± 2.23 | 0 | / | / |
BOD5 (mg L−1) | 8.23 ± 5.23 | 0 | / | / |
NH4+-N (mg kg−1) | 7.21 ± 3.62 | 0 | 1.21 ± 0.12 | 0.81 ± 0.25 |
NO3−-N (mg kg−1) | 13.64 ± 4.12 | 0 | 9.12 ± 0.74 | 13.23 ± 0.37 |
SS (mg·L−1) | 11.23 ± 3.35 | 0 | / | / |
TN | 0.03 ± 4.61 | 0 | 3.33 ± 0.14 | 4.01 ± 1.22 |
NO2−-N (mg kg−1) | 4.2 ± 0.42 | 0 | 0.56 ± 0.02 | 0.85 ± 0.14 |
pH | 7.10 ± 0.2 | 7.10 ± 0.00 | 7.82 ± 0.31 | 7.73 ± 0.11 |
EC | 812.57 ± 21.12 | 23.74 ± 21.12 | 621.34 ± 32.32 | 812.34 ± 17.11 |
SOM (g kg−1) | / | / | 17.59 ± 3.21 | 20.70 ± 1.32 |
Gene | F | F- Gene Sequence | R | R- Gene Sequence |
---|---|---|---|---|
AOA | amoAF | STAATGGTCTGGCTTAGACG | amoAR | GCGGCCATCCATCTGTATGT |
AOB | bamoA1F | GGGGTTTCTACTGGTGGT | bamoA2R | CCCCTCKGSAAAGCCTTCTTC |
nosZ | 1126F | GGGCTBGGGCCRTTGCA | 1381R | GGGCTBGGGCCRTTGCA |
nirK | FLaCuF | ATCATGGTSCTGCCGCG | R3CuR | GCCTCGATCAGRTTGTGGTT |
nirS | cd3aF | GTSAACGTSAAGGARACSGG | R3cdR | GASTTCGGRTGSGTCTTGA |
NOB | NSR1113 | CCTGCTTTCAGTTGCTACCG | NSR1264 | GTTTGCAGCGCTTTGTACCG |
Treatments | Average N2O (μg kg−1 d−1) | Average NO (μg kg−1 d−1) | Nitrogen Conversion (mg kg−1 d−1) | Y-N (%) | |
---|---|---|---|---|---|
NH4+ oxidation | RAN | 20.79 ± 0.43 Bb | 0.37 ± 0.02 Bb | 4.23 | 0.44 |
DAN | 16.93 ± 2.04 Ba | 0.33 ± 0.02 Ba | 4.67 | 0.37 | |
NO3− reduction | RKN | 06.04 ± 0.64 Aa | 0.14 ± 0.04 Aa | 1.44 | 0.43 |
DKN | 05.09 ± 0.85 Aa | 0.11 ± 0.01 Aa | 0.93 | 0.56 | |
NO2− oxidation | RNI | 15.18 ± 1.15 Cb | 0.24 ± 0.03 Ba | 3.87 | 0.35 |
DNI | 10.48 ± 1.31 Ca | 0.19 ± 0.02 Ba | 4.41 | 0.24 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhu, Y.; Wei, C.; Chi, Y.; Yang, P. The Influencing Mechanisms of Reclaimed Water on N2O Production in a Multiyear Maize–Wheat Rotation. Agronomy 2023, 13, 2393. https://doi.org/10.3390/agronomy13092393
Zhu Y, Wei C, Chi Y, Yang P. The Influencing Mechanisms of Reclaimed Water on N2O Production in a Multiyear Maize–Wheat Rotation. Agronomy. 2023; 13(9):2393. https://doi.org/10.3390/agronomy13092393
Chicago/Turabian StyleZhu, Yuanhao, Chenchen Wei, Yanbing Chi, and Peiling Yang. 2023. "The Influencing Mechanisms of Reclaimed Water on N2O Production in a Multiyear Maize–Wheat Rotation" Agronomy 13, no. 9: 2393. https://doi.org/10.3390/agronomy13092393
APA StyleZhu, Y., Wei, C., Chi, Y., & Yang, P. (2023). The Influencing Mechanisms of Reclaimed Water on N2O Production in a Multiyear Maize–Wheat Rotation. Agronomy, 13(9), 2393. https://doi.org/10.3390/agronomy13092393