Next Article in Journal
Study and Analysis of the Implementation of 4.0 Technologies in the Agri-Food Supply Chain: A State of the Art
Previous Article in Journal
Comparison of Frequentist and Bayesian Generalized Linear Models for Analyzing the Effects of Fungicide Treatments on the Growth and Mortality of Piper Nigrum
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Development of New Rice (Oryza. sativa L.) Breeding Lines through Marker-Assisted Introgression and Pyramiding of Brown Planthopper, Blast, Bacterial Leaf Blight Resistance, and Aroma Genes

1
Agricultural College, Guangxi University, Nanning 530004, China
2
State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, Guangxi University, Nanning 530004, China
*
Author to whom correspondence should be addressed.
Agronomy 2021, 11(12), 2525; https://doi.org/10.3390/agronomy11122525
Submission received: 15 November 2021 / Revised: 5 December 2021 / Accepted: 8 December 2021 / Published: 13 December 2021

Abstract

Brown planthopper, blast, and bacterial blight are the main biotic stressors of rice and can cause a massive loss in rice production. Aroma is an important character of rice quality. It is of far-reaching significance to breed resistant and high-quality varieties using germplasms with objective genes. In this study, the introgression and pyramiding of brown planthopper (BPH), blast, and bacterial leaf blight (BLB) resistance genes and aroma genes into elite rice maintainers and restorers were conducted through conventional cross-breeding coupled with the marker-assisted selection (MAS) breeding method. Single-plant selection was performed from F2 onwards to select desirable recombinants possessing alleles of interest with suitable phenotypes. Respective linked markers were used in each generation from intercrossing to the F7 generation for tracking the presence of targeted genes. A total of 74 improved lines (ILs) have been developed which possess a combination of 1 to 4 genes for BPH, blast, and BLB resistance and aroma. These ILs showed moderate to high resistance to multiple biotic stresses (BPH, blast and BLB) or aromatic fragrance without obvious negative effects on agronomic traits. As multiple resistance and aromatic traits have become significant objectives in rice breeding, these resistance and/or aroma gene introgressed or pyramided lines have important application prospects. Core ideas: (1) marker-assisted breeding was used to pyramid multiple genes for an elite breeding line; (2) improved lines with the introgression of 1–4 genes were developed to achieve high resistance against various biotic stresses and aroma; (3) new lines were used as donor parents to introgress multiple genes in other genetic backgrounds.

1. Introduction

Rice is one of the main food crops in the world. More than half of the world’s population feeds on rice [1]. However, the prevalence of diseases and insect pests often causes serious losses in rice production [2,3]. Rice grain yield is significantly affected by multiple stresses. The major biotic stresses which result in yield penalty are BPH, blast, and BLB. At present, chemical pesticides, bactericides and fungicides are still widely applied in controlling BPH, blast and BLB. However, in addition to extra high costs in rice production, they are also not environmentally friendly and lead to food contamination. On the other hand, the long-term abuse of pesticides could stimulate the tolerance and evolution of pests and pathogens, which becomes a greater threat to the safety of rice production [4]. Meanwhile, the presence of aromatic fragrance becomes one of the critical criteria for grain quality and growing preferences in market demand [5]. Thus, developing varieties with enhanced genes conferring resistance and aromatic fragrance is one of the pursuits in rice breeding.
The brown planthopper (BPH), Nilaparvata lugens (Stål), is the most devastating insect which infests rice. BPH damage rice by ingesting sap from the phloem, causing not only significant reduction or even complete losses in rice yield [6] but also indirectly injury to rice plants by transmitting virus diseases [7,8]. Up until now, about 40 BPH resistance genes have been identified from different cultivated rice and wild Oryza species [9]. Among these, Bph3 demonstrates broader spectrum and more durable resistance which confers resistance to BPH biotypes I, II, III and IV and maintains resistance to BPH for more than 30 years [10]. Bph24(t) is a resistant gene against BPH derived from Guangxi common wild rice. The successful introgression of Bph3 or Bph24 has been reported to provide higher levels of resistance in the recipients and have been applied in breeding. Through the marker-assisted selection (MAS) method, Bph3 were introgressed into several improved varieties or lines, such as restorer lines Guihui582 and Gui7571, indica rice cultivar Jin 23B, 93-11 and Swarna+drought, and japonica variety Ningjing3 (NJ3) [11,12,13,14]. As for Bph24(t), the BPH resistance genes were introgressed into elite maintainer and restorer lines such as 9311, Tian B, Meng B, Xian B, Gui 118S, 187R, Guanghui998, R15, R2, Longtefu B and Minghui 63 [15,16,17]. However, until the present time, there have been relatively few varieties developed with pyramided Bph3 and Bph24(t) to encourage BPH resistance.
Rice blast, caused by Magnaporthe oryzae, is one of the most destructive fungal diseases of rice [18]. It infects rice crop from the vegetative to reproductive stages, causing a reduction of 10–30% of the annual yields [19,20] and even up to 85% of yield losses under severe infestation conditions [21]. To date, more than 100 blast resistance (R) genes have been identified in rice [22,23]. Pi2 [24], Pi9 [25], Pita [26] and Pib [27] are blast R genes which confer broad-spectrum resistance to diverse M. oryzae isolates. A number of attempts had been made to deploy them in rice breeding programs through the gene introgression or pyramiding approach. Thus, a series of new varieties or improved intermediate materials with various blast resistance gene combinations have been bred to achieve broader and more durable resistance. Previous studies have incorporated Pi2 into different genetic background of cultivated varieties, such as elite maintainer lines Jin 23B and thermo-sensitive genic male sterile (TGMS) lines such as C815S, GZ63-4S and Guangzhan63-4S [28,29,30,31]. Pi9 has been introgressed into different genetic backgrounds of cultivated varieties, such as indica cultivar Swarna + drought [14], elite restorer line Mianhui 725 (MH725) and R894, and TGMS lines 1892S [32,33,34]. Pi2 and Pi9 has been introgressed into indica cultivar Improved Lalaand Improved Tapaswinit [35,36]. Pita has been introgressed into elite indica cultivars Pusa Basmati 1 (PB1) and Mushk Budji and restorer line Hang-Hui-179 (HH179) [37,38,39]. Pi2 and Pita have been introgressed into an elite indica restoring line R175 [40]. Pib has been introgressed into a Malaysian rice variety MR219 and a Japonica variety Nanjing5055 [41,42]. Pimh was another blast R-gene derived from Minghui 63 (MH63), which is an elite restorer line with high resistance against blast [43,44]. However, there are few reports on the gene introgression or pyramiding of Pimh.
Bacterial leaf blight (BLB) is one of the most serious bacterial diseases caused by Xanthomonas oryzae pv. oryzae (Xoo). BLB infection causes leaf blight and seriously affects the growth of rice plants, leading to yield losses of nearly 10% in rice production, and even up to 50–60% in its severe form [1,45]. At present, 45 BLB resistance genes have been identified in diverse rice sources [46,47]. Among these genes, Xa23 is a major disease resistance gene identified from wild rice (Oryza rufipogon) and was found to act in a dominant manner and confer strong resistance to all naturally occurring biotypes of Xoo at all developmental stages [48,49]. As an excellent resource for breeding rice varieties resistant to BLB, the Xa23 gene has been introgressed into many elite cultivar varieties, such as Lu-You-Zhan (LYZ) and YueJinYinZhan (YJYZ), restorer lines such as R1813 and R186, and TGMS lines such as GZ63-4S and YueJing1S (YJ1S) using marker-assisted back crossing (MABC), which significantly improved BLB resistance in the recipient lines [30,50,51,52].
Aroma is an important grain quality trait in rice. The badh2 gene is the mutant form of the BADH2 gene, which produces a pleasant aroma by promoting the production of 2-acetyl-1-pyrroline (2AP) [53]. The first loss-of-function allele in badh2 (badh2.1 or badh2-E7) was identified as an 8-bp deletion in the seventh exon [54], which is the main allele functionally associated with fragrance [55]. The introduction of badh2.1 into the elite restorer line Mianhui 725 (MH725) created a new restorer rice line with aromatic fragrance [32].
Gene pyramiding in rice is the process of transferring more than one favourable gene/QTL of traits from multiple parents into a single genotype by marker-assisted selection (MAS). In current rice breeding practice, gene/QTL pyramiding has been successfully performed in programs aimed at enhancing resistance, yield and grain quality traits [56,57,58]. Most studies focused on pyramiding separate resistance genes to develop multiple resistances or increase the durability of resistance in rice to prevent the breakdown of resistance against biotic stressors such as BPH, blast, BLB, sheath blight and gall midge, as well as abiotic stressors such as submergence, salinity, drought, and cold stress [14,36,59,60,61]. The deployment of new genes into elite lines without the objective trait could remedy certain deficits. Moreover, the pyramiding of genes for a trait by combining two or more complementary genes could provide superior phenotypic benefits and stability compared to a single gene. The inclusion of suitable genes into a popular variety lacking their corresponding trait will be useful for further enhancing the production potential of that variety. For instance, many susceptible varieties have been successfully incorporated with different genes conferring a single resistance, namely BPH resistance [12,13], blast resistance [40,62,63] or BB resistance [64,65]. Furthermore, some studies have obtained achievements by QTL pyramiding genes to increase the yield and grain quality, such as grain number and number of primary branching, low Cd and high Zn or Se accumulation in grains, grain size and grain number [56,66,67,68,69].
Hence, using the MAS technique coupled with artificial identification, we performed the stacking of multiple genes endowing BPH, blast, BLB resistance and aroma to develop introgressed or pyramided lines of different genetic backgrounds to improve the resistance and the aromatic fragrance of rice. The aim was to lay a foundation for the breeding of high-quality, high-efficiency and green rice varieties in the future.

2. Materials and Methods

2.1. Plant Materials

Ten different donors were used in the crossing as parents to pyramid disease and insect resistance and aroma into the new lines (Table 1). Specifically, the BPH-resistant sources were Ptb33 (containing Bph3) and BPHR96 (containing Bph24). The blast-resistance gene donors were Huazhan (HZ) (containing Pi2), Minghui 63 (MH63) (containing Pimh), Xinyinzhan (XYZ) (containing Pib) and R1238 (containing Pi9 and Pita). P59 was a breeding material containing the BLB resistance gene Xa23. The elite lines Mengxiang B (MX B) and Yexiang B (YX B) contained the aroma gene badh2.
A series of elite maintainers and restorers of three-line hybrid rice cultivated in China were chosen as the recipients of the objective resistance and aroma genes. These maintainer and restorer lines, as parents to be improved, were susceptible to BPH, BLB and blast, and also without aroma. The maintainer lines included Zhongzhe B (ZZ B), Qun B, Yunfeng B (YF B), Meimeng B (MM B), 209B, and Hengfeng B (HF B). The restorer lines included Guanghui 998 (GH 998), R553, R8 and IR64.
Ptb33, HZ and P59 were used as the highly BPH-resistant, blast-resistant and BLB-resistant controls, respectively, while Tai-chung Native 1 (TN1) was used as the highly susceptible control for all the BPH, blast and BLB resistance evaluations.

2.2. Breeding Strategy and Genotyping

To introgress different biotic genes for BPH, blast and BLB together with an aroma gene into different recipient parents, the breeding scheme was initiated in the spring of 2017, with single crosses made among all donors and recipients. The procedure is shown in Figure 1.
Firstly, donors possessing the resistance or aroma genes were used to hybridize with different elite or newly bred maintainer and restorer lines, respectively, to create hybrid progenies of a single targeted gene. Secondly, the hybrid progenies containing two targeted genes derived from the hybridization of two donors were used to hybridize with the maintainer or restorer lines to obtain the hybrid progenies of the two targeted genes. Thirdly, hybridization was conducted between progenies that contained one and two targeted genes to create hybrid progenies of three or four targeted genes.
The F1 from multi-parental hybridization populations from different rounds of intercrosses with different gene combinations were screened using closely linked molecular markers for foreground selection. The DNA markers linked to BPH, blast, BLB resistance and aroma were based on the published literature (Table 1). MAS selection was repeated from F2 to F7 of the hybrid progenies (Figure 1, Table 2), and the progenies carrying targeted genes underwent intensive phenotypic selection followed by self-pollination to harvest self-bred seed in each generation until the F7 generation in order to achieve stable heredity. The elite individuals of the F7 generation were selected as the new ILs and grown in the field to evaluate the targeted traits and important agronomic traits.
The specific pedigree of each obtained progeny was conducted following the scheme shown in Table 3. Genomic DNA was extracted from fresh leaves using the CTAB method [75]. Each 10 µL PCR mixture included 1 µL of DNA (60 ng/µL), 5 μL 2 × Taq PCR MasterMix (Real-Times, Beijing, China), 1 μL each of forward and reverse primers (10 μM), and 2 μL ddH2O. The reaction mixture was initially denatured at 95 °C for 5 min followed by 34 cycles of PCR amplification with the following parameters: 30 s of denaturation at 95 °C, 30 s of primer annealing at 51~58 °C (annealing temperatures for specific primers are listed in Table 1), and 30 s of primer extension at 72 °C. Finally, the reaction mixture was maintained at 72 °C for 10 min before completion. The PCR products were resolved by casting high-resolution 8% (v/v) polyacrylamide gel electrophoresis.

2.3. Evaluation of BPH Resistance

All the ILs were selected to screen BPH resistance in the F7 generation through the standard seedbox screening test (SSST) method at a controlled glass house facility at Guangxi University, Nanning. The BPH nymphs were collected from an early season rice field at Guangxi University and propagated on plants of TN1 at the vigorous tillering stage in a glasshouse under 26–28 °C. The BPH populations used to infest the plants belonged to mixed biotypes, which mainly belonged to biotype II. The rice plants in each tested line were sown in plastic trays in three replications, together with the resistant control Ptb33 and susceptible control TN1. After germination seeds were sowed with 20–25 seeds per row for each replication, 20 uniform seedlings were maintained at the 3-leaf stage and infested with 2nd to 3rd instar BPH nymphs at a density of 10 insects per seedling. When all of the susceptible control TN1 plants withered, the BPH resistance of each line was evaluated and scored on a 0–9 scale as per the IRRI Standard Evaluation System (SES) scale [76].

2.4. Evaluation of Blast Resistance

All the ILs were selected to screen for blast resistance from the F2 to F7 generation. The leaf blast resistance was screened through artificial inoculation in the isolation glasshouse facility at Guangxi University using the blast strain Guy-11 [77]. The blast strain Guy-11 is a local isolate of Magnaporthe oryzae prevalent in the area and was used to screen for blast resistance under in vivo conditions. The rice plants in each tested line were sown in plastic trays in three replications together with the resistant control HZ and susceptible control TN1. Each tray was sown with 40 germinated seeds, and the seedlings were inoculated with Guy-11 by spraying at the 4-leaf stage with 12 mL conidial suspension per tray. The inoculated rice plants were incubated in a dark chamber at 25 °C for 48 h with over 95% relative humidity for disease development, and then transferred back to the greenhouse. Inoculated seedlings were monitored for the development of blast lesions 10–15 days after inoculation.
The panicle blast was screened at a natural blast screening nursery using a natural population of mixed isolates of blast disease. The rice plants in each tested line, together with the resistant and susceptible controls, were planted at the experimental field in Limu town, Cenxi City, Guangxi Province, where rice blast is seriously prevalent. Seedlings of the tested lines were grown in a paddy field spaced 20 × 20 cm and replicated in three plots. The field was normally managed by routine rice cultivation practices.
The leaf blast and neck blast resistance of each line was evaluated and scored according to the 0–9 scale as per the IRRI-SES scale [76].

2.5. Evaluation of BLB Resistance

ILs were selected to screen for BLB resistance from the F2 to F7 generation using the leaf-clipping method [78]. The Xoo strain GX1070 is the isolate of BLB prevalent in the Guangxi area which was grown on peptone sucrose agar media for inoculum production. Bacterial growth was scraped from all the plates and re-suspended in sterilized distilled water. The rice plants in each tested line and the resistant control P59 and susceptible control TN1 were planted in the field spaced 20 × 20 cm apart. Each entry included 30 plants and was managed using normal rice cultivation practices. A total of 3 to 5 uppermost leaves of each plant were inoculated in the maximum tillering stage with a freshly prepared BLB suspension of ~109 cells ml−1 in concentration. The lesion length was recorded on all inoculated leaves 20 d post-inoculation, and the average lesion length of three longest lesions from individual plants was calculated. The BLB resistance of each line was classified based on the IRRI-SES scale [76].

2.6. Evaluation of Aroma

The ILs were selected for the evaluation of the aroma character of the seeds from the F2 to F7 generations through the KOH soaking method [79] and the grain chewing method [80].

2.7. Investigation of the Agronomic Traits

Extensive phenotypic selection was carried out after the genotypic confirmation of plants during each generation. The ILs with the maximum targeted genes were evaluated for their agronomic performance. Each of the selected ILs along with the recipients were grown in a plot of 6 rows × 10 plants with 20 × 20 cm space. The field was normally managed. Eight plants in the middle row were selected to measure the agronomic traits, and the average data were calculated. The investigation involved the plant height, spike number per plant, flag leaf length, flag leaf width, grain number per panicle, seed-setting rate, 1000-grain weight and grain weight per plant. One-way analysis of variance (ANOVA) with the least significant difference (LSD) test was used to compare the means of the selected lines. Statistical analysis was performed using Microsoft Office Excel 2007 (Microsoft, Redmond, WA, USA).

3. Results

3.1. Marker-Assisted Breeding to Pyramid BPH, Blast, BLB and Aroma Genes

In the study, a breeding strategy involving foreground selection coupled with phenotypic selection in each generation was implemented in assembling the nine targeted genes from different donors in different genetic backgrounds of recipients.
The crossing program was initiated during the spring of 2017 to combine two genes for BPH resistance (BPH3 and BPH24), five genes for blast resistance (Pi2, Pi9, Pita, Pib and Pimh), one gene for BLB resistance (Xa23) and one gene for aroma (badh2) (Figure 1, Table 2). The recipients were crossed with the donors in several rounds of intercross combinations to develop different F1s. During the spring season of 2018, 513 F1 were confirmed using foreground selection of different targeted genes, among which 144 plants having 1 to 4 targeted genes in a heterozygous state were advanced to F2. During the winter season of 2018, about 6127 F2 seeds generated from positive F1 plants were grown and tested for the presence of targeted genes, from which 761 F2 plants possessing 1 to 4 genes in different combinations were identified.
Subsequently, the positive F2 plants went through strict phenotypic selection, including selection for resistance to BPH, blast and BLB and selection for aroma. These plants showed a wide range of reactions, among which only resistant or aromatic lines were reserved for the following generation, and the rest of the susceptible or non-aromatic materials were discarded. As a result, 272 F2 plants were advanced to F3. About 8109 F3 plants were generated during the spring season of 2019. Genotyping confirmation and phenotypic selection of the F3 plants was aimed at the plants possessing the introgressed genes and traits and which were similar or superior to the recipients regarding agronomic performance. As a result, 219 F3 plants were advanced to F4 families. The same strategy of genotypic and phenotypic selection was performed from the F4 generation in the summer season of 2019 to the F7 generation in the summer season of 2020, from which a total of 74 fixed lines with 1 to 4 genes in different combinations were found to be promising. The total number of plants evaluated and selected in each generation is shown in Table 3.
In the F1 generation, from multi-parental hybridization onwards, the markers for each targeted gene were deployed to track and guarantee the preservation of desirable alleles in each generation. Large population sizes during early generations were screened to select plants with different gene combinations along with desirable phenotypic performance and without observed yield penalty compared with popular varieties. As a result, a total of 74 stable ILs were developed with the introgression of BPH, blast, BLB resistance genes and an aroma gene in different combinations (Table 2, Figure 2).
Specifically, there were 6 lines pyramided with 4 targeted genes and 23 lines pyramided with 3 targeted genes (IL1-29). Among them, 6 lines were pyramided with genes controlling 3 targeted characters (IL1-3 with BPH resistance + blast resistance + BLB resistance, IL4-6 with BPH resistance + blast resistance + aroma), 20 lines with genes controlling 2 targeted characteristics (IL7-13 with BPH resistance + blast resistance, IL14-19 with BPH resistance + BLB resistance, IL20-26 with blast resistance + BLB resistance), and 3 lines with genes controlling single targeted characteristics (IL27-29 with blast resistance).
There were 30 lines pyramided with 2 targeted genes (IL30-59). Among them, 21 lines contained genes controlling two targeted characters, including 4 lines resistant to BPH and blast (IL30-33), 1 line resistant to BPH and BLB (IL34), 11 lines resistant to BPH and presenting aroma (IL35-45), 3 lines resistant to blast and BLB (IL46-48), and 1 line resistant to blast and presenting aroma (IL49-50). There were 9 lines with genes controlling a single targeted characteristic, including 6 lines with BPH resistance (IL51-IL56) and 3 lines with blast resistance (IL57-59).
There were 15 lines introgressed with a single resistance or aroma gene (IL60-74). Among them, 5 lines with Bph24 gained BPH resistance (IL60-64); 6 lines with Xa23 gained BLB resistance (IL65-70); and 4 lines with badh2 gained aroma (IL71-74).

3.2. Phenotypic Evaluation of Introgression Lines for BPH Resistance

After strict evaluation and selection during every breeding generation for disease and pest resistance, aroma and desirable economic traits, there were only 74 lines ultimately developed in the F7 generation. Resistance to BPH, blast and BLB and the aromatic traits of these lines were finally respectively evaluated during the spring season of 2021. Evaluation results were presented and analyzed in this part and following Section 3.3, Section 3.4 and Section 3.5.
Two BPH resistance genes (Bph3 and Bph24) were used in the introgression program. Genotyping of the 74 lines in the F7 generation revealed that 2 lines possessed Bph3, 24 lines possessed the Bph24 gene, and 20 lines possessed both Bph3 and Bph24 in combination of other genes. BPH resistance phenotyping of all the 74 introgressed lines along with the resistant control (Ptb33) and susceptible control (TN1) showed that there were 46 introgressed lines with either or both BPH genes expressing the same level of resistance (scored 3) against BPH, while the other 28 lines carried other targeted genes but, without either of the BPH resistance genes, presented complete susceptibility to BPH (scored 7 or 9), similar to the susceptible control TN1 (Table 2, Figure 3a and Figure S1).
These data indicate that lines introgressed with Bph3 and/or Bph24 effectively improved the resistance levels to BPH compared to that of the recipient elite parental lines.

3.3. Phenotypic Evaluation of Introgression Lines for Blast Resistance

Five blast resistance genes (Pi2, Pi9, Pita, Pib and Pimh) were used in the introgression program. Genotyping of the 74 lines revealed that 16 lines introgressed a single blast resistance gene (9 lines possess Pi2, 4 lines possess Pib and 3 lines possess Pimh), 15 lines introgressed two blast resistance genes (3 lines possess Pi2 + Pita, 2 lines possess Pi2 + Pib, 2 lines possess Pi2 + Pimh, 6 lines possess Pi9 + Pita and 2 lines possess Pib + Pimh), and 3 lines introgressed three blast resistance genes (Pi2 + Pib + Pimh).
The resistance screening for their reaction to leaf blast and panicle blast of all the 74 F7 introgressed lines along with the resistant controls (HZ) and susceptible controls (TN1) was carried out. Among them, 34 lines with introgressed blast resistance genes expressed high (HR) to moderate resistance (MR) against leaf blast and panicle blast, with SES scores of 1–3, while the remaining 40 lines without any of the blast resistance genes were found, as expected, to be highly susceptible (scored 7–9) (Table 2, Figure 3b, Figures S2 and S3). Notably, all 3 lines pyramiding three blast resistance genes (Pi2 + Pib + Pimh) demonstrated a higher resistance level (scored 1) against both leaf blast and panicle blast, exhibiting a significant cumulative effect. This indicated that gene pyramiding of multiple blast resistance genes in this study was effective and sufficient for blast resistance breeding practice, which was consistent with previous studies [62,63,81].
These data indicate that the introgression or pyramiding of the blast resistance gene (Pi2, Pi9, Pita, Pib and/or Pimh) significantly improved the resistance levels to blast compared to that of the recipient elite parental lines.

3.4. Phenotypic Evaluation of Introgression Lines for BLB Resistance

The dominant BLB resistance gene Xa23 was used in the introgression program, which confers an extremely broad level of resistance to various Xoo strains [82]. Genotyping and phenotyping of the 74 lines confirmed that 26 lines possessing Xa23 expressed a high level of resistance (scored 1) against BLB, while the remaining 48 lines without the introgression of Xa23 showed low resistance scores or complete susceptibility (scored 5–9) against BLB (Table 2; Figure 3c and Figure S4).
These data indicate that the introgression of Xa23 significantly improved the resistance levels to BLB compared to that of the recipient elite parental lines and was sufficient in BLB resistance breeding practice.

3.5. Phenotypic Evaluation of Introgression Lines for Aroma

The aroma gene badh2 was used in the introgression program. Genotyping and phenotyping of the 74 lines revealed that the 20 lines which possess badh2 exhibited aromatic phenotype as expected, while the remaining 54 lines not carrying badh2 did not show aromatic traits (Table 2).
These data indicate that the introgression of badh2 confers aromatic fragrance to the improved lines compared to that of the recipient elite parental lines.

3.6. Comparison of Agronomic Traits in the ILs

A total of 17 ILs pyramiding 3 or 4 targeted genes were evaluated for their agronomic traits during the spring season of 2021 (Table 2). Some of the recipients used in this study for introgression were also chosen for agronomic trait evaluation as controls. Data from eight agronomic traits were recorded for plant height, flag leaf length, flag leaf width, spike number per plant, grain number per panicle, seed-setting rate, 1000-grain weight and grain weight per plant (Table 4).
Evaluation of pyramided and representative recipient lines indicated that the plant height of the ILs ranged from 94.1 cm (IL18) to 126.6 cm (IL7); the flag leaf length of the ILs ranged from 27.2 cm (IL5) to 49.1 cm (IL8); and the flag leaf width of the ILs ranged from 1.5 cm (IL5) to 2.5 cm (IL7 and IL21). Most of the ILs generally had higher PH than the controls and their corresponding recipients.
The lowest average spike number was 6.5 in IL1. IL10 showed the highest average spike number of 13.8, followed by 12.4 in IL20, both of which were higher or on par with recipient parents HZ (9.8) and GH998 (12.6).
The seed-setting rate was highest in IL8 (84.2) and lowest in IL10 (79.6), close to that of the controls in the range of 79.4 to 86.2.
The average grain number per panicle of ILs ranged from 158.8 (IL10) to 243.0 (IL6); 14 out of 17 lines had a grain number per panicle over 170 (IL1, 3, 5, 6, 7, 9, 11, 12, 13, 18, 19, 21, 23, 27). Regarding the average grain number per panicle of recipient lines, except 298.7 in YFB, the lines showed a range from 142.8 to 172.6, which was lower than that of the ILs.
The 1000-grain weight was lowest in IL19 (15.7 g) and highest in IL11 (27.3 g), which showed a greater range of variation compared to that of the controls, which were in the range of 17.5 g to 24.5 g.
The grain weight per plant of ILs varied from 25.1 g (IL1) to 53.5 g (IL11), which showed a larger variation range in comparison to that of the controls, which were in the range of 30.2 g to 41.3 g.
Among the evaluated ILs, most ILs were found to be on par with the tested recipients lines, with 15 out of 17 lines (except for IL1 and IL19) having a grain weight per plant over 30.0 g; 8 out of 17 lines (IL3, 7, 9, 10, 11, 13, 20, 23) had a grain weight per plant over 40.0 g, which represented a higher yield than the tested recipient lines. IL3, IL9, IL11, IL13, and IL20 yielded the most among the evaluated lines (44.8–53.5 g) and were regarded as being promising in subsequent breeding projects.
The evaluation of pyramided and representative recipient lines indicated that most of the selected ILs showed overall good agronomic performance after aggregation of multi-resistance and aroma genes, suggesting that the gene pyramiding in this study had minor negative effects on the yield component traits. The selected ILs could be considered to be elite ILs to be directly used in production or as donor parents for breeding.

4. Discussion

More than half of the worldwide population consumes rice to meet their dietary requirements. Besides the growing population, the yield and quality of rice crops are always constrained by biotic stresses, including BPH, blast and BLB. Nowadays, as green production emphasized, the demand for high-yielding cultivars endowed with host-plant resistance and the growing preference for fragrant rice necessitates increased attention. Thus, the introgression of resistance and aroma genes into popular varieties is of importance to improve the productivity and the quality of the varieties.
The pyramiding of BPH, blast and BLB resistance genes along with the introgression of aroma gene becomes an important breeding strategy against these biotic stressors to improve the sustainable cultivation and quality of rice crops. In recent years, some efforts have been made to introgress multiple targeted genes/QTLs to improve elite rice varieties by marker-assisted pyramiding combined with field phenotyping, conferring resistance against multiple stresses along with preferred grain quality and yield.
For instance, Angeles-shim performed the introgression of pi21 for improved blast resistance in select Asian rice cultivars [62]. Ji developed new restorer lines pyramided with blast resistance genes (Pita, Pi1 and/or Pi2), BLB resistance genes (Xa23 and/or xa5) and/or a BPH resistance gene (Bph3) [83]. Reinke developed introgression lines in a japonica background with a BPH resistance gene (Bph18), rice stripe virus resistance QTL (qSTV11SG), blast resistance genes (Pib + Pik) and BLB resistance genes (Xa40/Xa3) [59]. Similarly, Ramalingam pyramided BLB resistance genes (xa5, xa13, and Xa21), blast resistance genes (Pi54), and sheath blight resistance QTLs (qSBR7-1, qSBR11-1, and qSBR11-2) in the background of the cultivars ASD 16 and ADT 43 [60]. The above pyramiding lines obtained higher levels of resistance/tolerance against the corresponding stresses or were found to be endowed with aromatic fragrance. Additionally, these lines maintained similar performance on main agronomic traits and grain quality.
However, most of the reported studies focused on pyramiding resistance or tolerance genes. There are few studies involving in integrating multiple resistance genes and aroma genes. Luo pyramided a BLB resistance gene (Xa27), blast resistance genes (Pi9), a submergence tolerance gene (Sub1A) and an aromatic fragrance gene (badh2.1) in an elite restorer line Mianhui 725 to develop a new line WH6725, which is a good demonstration of this attempt [32]. To the best of our knowledge, there are no reports on the large-scale construction of innovative germplasm resources containing multiple resistances and improved aroma as the intermediate materials for breeding. Thus, the present study was undertaken to develop a series of ILs introgressed or pyramided with target genes in different backgrounds that can withstand multiple biotic stresses and have aromatic fragrance.
In this study, an introgression program was deployed through a serious of complex crossing followed by marker-assisted breeding approach. This breeding strategy utilized both marker-assisted foreground selection and stringent phenotypic selection during each generation, which resulted in the development of lines possessing multiple targeted traits with the incorporation of a high yield potential. The crossing program transferred 9 genes from 10 different donor parents, which conferred resistance against BPH (Bph3, Bph24), blast (Pi2, Pi9, Pita, Pib, Pimh), and BLB (Xa23), as well as conferring aroma (badh2), into elite restorer or maintainer lines. Using different recipients in multiple crosses and an inter-crossing program with intensive genotypic-phenotypic selection has efficiently helped in obtaining plants of elite type to a great extent.
The bioassays of BPH resistance revealed that the ILs containing the Bph3 and/or Bph24(t) resistance genes displayed resistance to BPH (Table 2, Figure 3a). However, the lines combining Bph3 and Bph24 in this study did not show an expected higher resistance level compared with single resistance gene deployment. Previous studies on marker-assisted pyramiding of BPH resistance genes, such as Bph3 + Bph27 [13], Bph6 + Bph9 [84] and Bph14 + Bph15 [12] exhibited a consistent conclusion that the pyramiding of BPH resistance genes could significantly enhance resistance compared to monogenic lines. The inconsistency in this study could be due to the effect of genetic background interaction between donor and recipient parents in the introgression lines, such as epistatic interactions [85,86]. Alternatively, it could be possible that Bph3 or Bph24 introgressed lines already present relative higher resistance, such that their pyramiding could not further enhance the BPH resistance level (Table 2).
The bioassays of blast resistance revealed that the ILs containing at least one blast-resistant gene displayed a degree of increased resistance (Table 2, Figure 3b). We have performed the introgression of five blast resistance genes (Pi2, Pi9, Pita, Pib, Pimh) into a complex cross in order to achieve multiple-blast race resistance in rice. Upon inspection of lines with different gene combinations, the ILs that pyramided three blast-resistant genes exhibited higher blast resistance levels against the Guy-11 strain than the lines with one or two genes, consistent with previous studies [87,88]. The enhanced resistance might be the results of synergistic action or quantitative complementation of the combination of multiple blast-resistant genes [89]. Considering only the blast resistance genes, the three-gene pyramided line Pi2 + Pib + Pimh was found to have the highest resistant level, with a mean score of 1.0. The two-gene pyramided lines Pi2 + Pita, Pi2 + Pimh, Pi9 + Pita, Pi2 + Pib and Pib + Pimh were found to be highly to moderately resistant, with a mean score of 1.5 1.8, 2.0, 2.8 and 3.0. In monogenic lines, positive plants for Pimh, Pi2 and Pib performed almost equal to two-gene pyramided lines, with a mean score of 2.3, 2.6 and 3.0, respectively. Among the five blast resistance genes in the present study, Pi2 seems to function most effective alone or in combination. Except for Pimh, which has few reports on breeding, the effectiveness of introgression or pyramiding of Pi2, Pi9, Pita, Pib has been confirmed compared to previous studies [14,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42].
The bioassays for BLB resistance revealed that the ILs containing BLB resistance gene Xa23 displayed high resistance against Xoo. strain GX1070 (Table 2, Figure 3c). These results were consistent with the results of previous studies, which have shown Xa23 to confer strong and broad spectrum resistance against BLB in rice [30,48,49,50,51,52]
Some resistance genes can cause linkage drag (i.e., Pi21 is linked to poor flavor of the grain [18]), and gene pyramiding offered more opportunities for linkage drag arising from multiple R donors. In the current study, multi-parental hybridization is a breeding method to increase genetic recombination, which can break linkage drag and lead to novel rearrangements of alleles [90]. The complex genetic background could cause genotypic diversity, which could compensate for the effect, if any, of undesired linkage drag. Additionally, the population size during early generations was large enough to screen plants with desirable phenotypic performance. Consequently, the combination of multiple targeted genes has been successfully performed without significant linkage drag. All the ILs showed reliable resistance to corresponding bioassays and 17 ILs pyramided with 3 or 4 targeted genes showed good performance without obvious detriments to yield and quality, which are valuable germplasm resources in subsequent breeding programs.
The conventional backcross method has been applied to develop cultivars for a single targeted trait. Because the phenotypic screening process is difficult and time-consuming when accurately transferring multiple genes into the cultivar, the use of marker-assisted selection with stringent phenotypic selection increases efficiency and precision. Marker-assisted breeding coupled with complex hybridization is a powerful tool to improve complex traits and for breeding multi-resistant high-quality rice varieties. Considering the possible trade-offs of different traits in pyramiding breeding, there is no affirmatory correlation between the aggregation of more resistance genes and the enhancement of resistance. In addition, the function of resistance genes is, to some extent, at the expense of yield and grain quality [40]. Thus, we avoided pursuing stacking more R genes in the same line through hybridization among more donors. Instead, we tried to involve more recipients in the breeding program in order to obtain lines with more diverse genetic backgrounds to seek a balance between the introgressed traits and other main agronomic characters in the ILs. It can be predicted that, with the use of a greater number of parents, there will be a greater number of recombinations, and greater chances of accumulation of favorable alleles. However, we did not succeed in obtaining all the combinations of the four targeted traits because: (i) some gene combinations led to the non-synchronization of the flowering cycle; (ii) some lines could be rejected due to their unsatisfactory agronomic characters in any generation from F2 to F7; (iii) the pyramided lines possessing 1–4 genes were selected, which were endowed with 1-3 targeted traits. Regarding the ILs which integrated different traits, the phenotypic evaluation showed that the BPH-, blast- or BLB-resistant genes or the aroma gene in the ILs could independently display their function and did not exert significantly negative effects on each other. The lines introgressed with resistance genes acquired corresponding enhanced or multiple resistance, and the lines introgressed with aroma genes were endowed with strong aromatic fragrance.

5. Conclusions

The agronomic performance evaluation of lines which underwent pyramiding for three and four targeted genes revealed that most of the selected ILs did not exhibit major deleterious effects regarding their agro-morphological traits (Table 4). Moreover, five candidate lines (IL3, IL9, IL11, IL13, and IL20) produced significantly higher grain yields per plant than their representative recipient parents (44.8–53.5 g). It can be concluded that there was no obvious yield penalty, only important improvements, due to the pyramiding of the biotic resistance genes and aroma gene. Previous reports also revealed that the pyramiding of disease resistance genes in rice did not compromise the yield or grain quality [60,83].
The pyramiding of the BPH, blast and BLB resistance genes in elite varieties can contribute relative broad-spectrum and durable resistance to multiple biotic stresses. It will not only reduce the usage of pesticides, fungicides and bactericides, but also would contribute to the stability and sustainability of hybrid rice production. Moreover, rice with aromatic fragrance can have a significantly increased market value due to its good grain quality. In this study, regarding the lines introgressed with single or multiple targeted traits, the cumulation of the introgressed target genes produced satisfactory resistance to each stress and produced the expected aroma. Moreover, the diversity of the genetic backgrounds provides more possibilities for screening elite lines and developing diverse rice hybrids. The ILs obtained in the current study are promising germplasm resources, which are expected to be used as improved varieties or used as a potential donor for developing new rice varieties in breeding programs. Moreover, they can also be involved in the further aggregation of more genes with targeted functions which have an important application prospect in breeding multi-resistant and aromatic rice, and thus further contribute to rice production.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/agronomy11122525/s1, Figure S1: Performance of improved lines with resistance to B PH compared to susceptible check. 1–9, 11–19: Representative of improved lines introgressed with B PH resistant gene(s); 10, 20: TN1; Figure S2: Performance of improved lines introgressed with blast resistant gene(s) against leaf blast compared to susceptible check, 1–3: Representative of improved lines with SES score 1; 4–6: Representative of improved lines with SES score 3; 7: TN1; Figure S3: Performance of improved lines introgressed with blast resistant gene(s) against panicle blast compared to susceptible check, a: Representative of the whole plant (two plants per line). 1–6: improved lines with resistance to panicle blast; 7, 8: TN1; b: Representative of the panicle(two plants per line). 1–8: improved lines with resistan ce to panicle blast; 9, 10: TN1; Figure S4: Performance of improved lines with resistance to B LB compared to susceptible check. 1: TN1; 2–7: Representative of improved lines introgres sed with BLB resistant gene.

Author Contributions

Conceptualization, R.L.; methodology, X.W., X.G. and X.M.; validation, X.W., L.L. and Y.F.; formal analysis, X.W., N.Z. and Y.H.; investigation, X.W., Z.W., F.L. and B.Q.; writing—original draft preparation, X.W. and L.L.; writing—review and editing, X.W. and R.L.; visualization, X.W.; supervision, R.L.; project administration, R.L.; funding acquisition, R.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Guangxi Zhuang Autonomous Region Science and Technology Department, grant numbers AA17204070 and AB16380093 and the State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources (grant number SKLWSA-a201914).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

The blast strain Guy-11 was provided by Haowen Peng of Guangxi University. The Xoo strain GX1070 was provided by Yongqiang He of Guangxi University.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Liu, W.; Liu, J.; Triplett, L.; Leach, J.E.; Wang, G.-L. Novel Insights into Rice Innate Immunity against Bacterial and Fungal Pathogens. Annu. Rev. Phytopathol. 2014, 52, 213–241. [Google Scholar] [CrossRef] [Scilit]
  2. Akhtar, S.; Bhat, M.A.; Wani, S.A.; Bhat, K.A.; Mir, S.; Chalkoo, M.R.; Wani, S.A. Marker assisted selection in rice. J. Phytol. 2010, 2, 66–81. [Google Scholar]
  3. Hu, G.; Lu, F.; Zhai, B.-P.; Lu, M.-H.; Liu, W.-C.; Zhu, F.; Wu, X.-W.; Chen, G.-H.; Zhang, X.-X. Outbreaks of the Brown Planthopper Nilaparvata lugens (Stål) in the Yangtze River Delta: Immigration or Local Reproduction? PLoS ONE 2014, 9, e88973. [Google Scholar] [CrossRef] [Scilit]
  4. Tanaka, K.; Endo, S.; Kazano, H. Toxicity of insecticides to predators of rice planthoppers: Spiders, the mirid bug and the dryinid wasp. Appl. Entomol. Zool. 2000, 35, 177–187. [Google Scholar] [CrossRef] [Scilit]
  5. Mottaleb, K.A.; Mishra, A.K. Rice Consumption and Grain-Type Preference by Household: A Bangladesh Case. J. Agric. Appl. Econ. 2016, 48, 298–319. [Google Scholar] [CrossRef] [Scilit]
  6. Zhang, J.; Guan, W.; Huang, C.; Hu, Y.; Chen, Y.; Guo, J.; Zhou, C.; Chen, R.; Du, B.; Zhu, L.; et al. Combining next-generation sequencing and single-molecule sequencing to explore brown plant hopper responses to contrasting genotypes of japonica rice. BMC Genom. 2019, 20, 682. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Sōgawa, K. The Rice Brown Planthopper: Feeding Physiology and Host Plant Interactions. Annu. Rev. Entomol. 1982, 27, 49–73. [Google Scholar] [CrossRef] [Scilit]
  8. Cabauatan, P.Q.; Cabunagan, R.C.; Choi, I.R. Rice viruses transmitted by the brown planthopper Nilaparvata lugens Stål. In Planthoppers: New Threats to the Sustainability of Intensive Rice Production Systems in Asia; Heong, K.L., Hardy, B., Eds.; International Rice Research Institute: Los Baños, Philippines, 2009; pp. 357–368. [Google Scholar]
  9. Akanksha, S.; Jhansi, L.V.; Singh, A.K.; Deepthi, Y.; Chirutkar, P.M.; Ramdeen; Balakrishnan, D.; Sarla, N.; Mangrauthia, S.K.; Ram, T. Genetics of novel brown planthopper Nilaparvata lugens (Stål) resistance genes in derived introgression lines from the interspecific cross O. sativa var. Swarna × O. nivara. J. Genet. 2019, 98, 113. [Google Scholar] [CrossRef] [Scilit]
  10. Cruz, A.P.; Arida, A.; Heong, K.L.; Horgan, F.G. Aspects of brown planthopper adaptation to resistant rice varieties with the Bph3 gene. Entomol. Exp. Appl. 2011, 141, 245–257. [Google Scholar] [CrossRef] [Scilit]
  11. Qing, D.; Dai, G.; Zhou, W.; Huang, S.; Liang, H.; Gao, L.; Gao, J.; Huang, J.; Zhou, M.; Chen, R.; et al. Development of molecular marker and introgression of Bph3 into elite rice cultivars by marker-assisted selection. Breed. Sci. 2019, 69, 40–46. [Google Scholar] [CrossRef] [Scilit]
  12. Jiang, H.; Hu, J.; Li, Z.; Liu, J.; Gao, G.; Zhang, Q.; Xiao, J.; He, Y. Evaluation and breeding application of six brown planthopper resistance genes in rice maintainer line Jin 23B. Rice 2018, 11, 22. [Google Scholar] [CrossRef] [Scilit]
  13. Liu, Y.; Chen, L.; Liu, Y.; Dai, H.; He, J.; Kang, H.; Pan, G.; Huang, J.; Qiu, Z.; Wang, Q.; et al. Marker assisted pyramiding of two brown planthopper resistance genes, Bph3 and Bph27 (t), into elite rice Cultivars. Rice 2016, 9, 27. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Dixit, S.; Singh, U.M.; Singh, A.K.; Alam, S.; Venkateshwarlu, C.; Nachimuthu, V.V.; Yadav, S.; Abbai, R.; Selvaraj, R.; Devi, M.N.; et al. Marker assisted forward breeding to combine multiple biotic-abiotic stress resistance/tolerance in rice. Rice 2020, 13, 29. [Google Scholar] [CrossRef] [Scilit]
  15. Xiao, C.; Hu, J.; Ao, Y.-T.; Cheng, M.-X.; Gao, G.-J.; Zhang, Q.-L.; He, G.-C.; He, Y.Q. Development and evaluation of near-isogenic lines for brown planthopper resistance in rice cv. 9311. Sci. Rep. 2016, 6, 38159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Liu, K.Y.; Lu, S.N.; Qiu, J.L.; Li, X.X.; Ma, Z.F.; Chen, Q.; Li, C.; Wei, S.M.; Huang, F.K.; Zhang, Y.X.; et al. Development of Brown Planthopper Resistance Gene-Inserted and-Accumulated Lines of Rice Restorers. Mol. Plant Breed. 2011, 9, 410–417. [Google Scholar]
  17. Liu, K.; Zhang, Y.; Liu, F.; Qiu, Y.; Li, R. Resistant performance of bacterial blight and brown planthopper resistance gene-pyramided lines in rice. Southwest China J. Agric. Sci. 2013, 26, 1852–1857. [Google Scholar]
  18. Fukuoka, S.; Saka, N.; Koga, H.; Ono, K.; Shimizu, T.; Ebana, K.; Hayashi, N.; Takahashi, A.; Hirochika, H.; Okuno, K.; et al. Loss of Function of a Proline-Containing Protein Confers Durable Disease Resistance in Rice. Science 2009, 325, 998–1001. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Fernandez, J.; Orth, K. Rise of a Cereal Killer: The Biology of Magnaporthe oryzae Biotrophic Growth. Trends Microbiol. 2018, 26, 582–597. [Google Scholar] [CrossRef] [Scilit]
  20. He, M.; Su, J.; Xu, Y.; Chen, J.; Chern, M.; Lei, M.; Qi, T.; Wang, Z.; Ryder, L.S.; Tang, B.; et al. Discovery of broad-spectrum fungicides that block septin-dependent infection processes of pathogenic fungi. Nat. Microbiol. 2020, 5, 1565–1575. [Google Scholar] [CrossRef] [Scilit]
  21. Bundó, M.; Coca, M. Enhancing blast disease resistance by overexpression of the calcium-dependent protein kinase OsCPK4 in rice. Plant Biotechnol. J. 2016, 14, 1357–1367. [Google Scholar] [CrossRef] [Scilit]
  22. Dong, L.; Liu, S.; Kyaing, M.S.; Xu, P.; Tharreau, D.; Deng, W.; Li, X.; Bi, Y.; Zeng, L.; Li, J.; et al. Identification and fine mapping of Pi69(t), a new gene conferring broad-spectrum resistance against Magnaporthe oryzae from Oryza glaberrima Steud. Front. Plant Sci. 2020, 11, 1190. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Zhou, Y.; Lei, F.; Wang, Q.; He, W.; Yuan, B.; Yuan, W. Identification of Novel Alleles of the Rice Blast-Resistance Gene Pi9 through Sequence-Based Allele Mining. Rice 2020, 13, 80. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Zhou, B.; Qu, S.; Liu, G.; Dolan, M.; Sakai, H.; Lu, G.; Bellizzi, M.; Wang, G.L. The Eight Amino-Acid Differences within Three Leucine-Rich Repeats between Pi2 and Piz-t Resistance Proteins Determine the Resistance Specificity toMagnaporthe grisea. Mol. Plant-Microbe Interact. 2006, 19, 1216–1228. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Qu, S.; Liu, G.; Zhou, B.; Bellizzi, M.; Zeng, L.; Dai, L.; Han, B.; Wang, G.L. The broad-spectrum blast resistance gene Pi9 encodes a nucleotide-binding site–leucine-rich repeat protein and is a member of a multigene family in rice. Genetics 2006, 172, 1901–1914. [Google Scholar] [CrossRef] [Scilit]
  26. Jia, Y.; Bryan, G.T.; Farrall, L.; Valent, B. Natural Variation at the Pi-ta Rice Blast Resistance Locus. Phytopathology 2003, 93, 1452–1459. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Wang, Z.X.; Yano, M.; Yamanouchi, U.; Iwamoto, M.; Monna, L.; Hayasaka, H.; Katayose, Y.; Sasaki, T. The Pib gene for rice blast resistance belongs to the nucleotide binding and leucine-rich repeat class of plant disease resistance genes. Plant J. 1999, 19, 55–64. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Jiang, H.; Feng, Y.; Bao, L.; Li, X.; Gao, G.; Zhang, Q.; Xiao, J.; Xu, C.; He, Y. Improving blast resistance of Jin 23B and its hybrid rice by marker-assisted gene pyramiding. Mol. Breed. 2012, 30, 1679–1688. [Google Scholar] [CrossRef] [Scilit]
  29. Jiang, J.; Mou, T.; Yu, H.; Zhou, F. Molecular breeding of thermo-sensitive genic male sterile (TGMS) lines of rice for blast resistance using Pi2 gene. Rice 2015, 8, 11. [Google Scholar] [CrossRef] [Scilit]
  30. Jiang, J.; Yang, D.; Ali, J.; Mou, T. Molecular marker-assisted pyramiding of broad-spectrum disease resistance genes, Pi2 and Xa23, into GZ63-4S, an elite thermo-sensitive genic male-sterile line in rice. Mol. Breed. 2015, 35, 83. [Google Scholar] [CrossRef] [Scilit]
  31. Mi, J.; Yang, D.; Chen, Y.; Jiang, J.; Mou, H.; Huang, J.; Ouyang, Y.; Mou, T. Accelerated molecular breeding of a novel P/TGMS line with broad-spectrum resistance to rice blast and bacterial blight in two-line hybrid rice. Rice 2018, 11, 11. [Google Scholar] [CrossRef] [Scilit]
  32. Luo, Y.; Ma, T.; Zhang, A.; Ong, K.H.; Li, Z.; Yang, J.; Yin, Z. Marker-assisted breeding of the rice restorer line Wanhui 6725 for disease resistance, submergence tolerance and aromatic fragrance. Rice 2016, 9, 66. [Google Scholar] [CrossRef] [Scilit]
  33. Zhang, X.C.; Sun, J.H.; Wang, Q.; Wang, H.L.; Li, J.L.; Zhang, D.S.; Zhu, S.S. Breeding and application of blast-resistant restorer line Qianhui 101 in rice. China Rice 2021, 27, 108–110. [Google Scholar]
  34. Luo, Y.; Ma, T.; Teo, J.; Luo, Z.; Li, Z.; Yang, J. Marker-assisted breeding of thermo-sensitive genic male sterile line 1892s for disease resistance and submergence tolerance. Rice Sci. 2021, 28, 89–98. [Google Scholar]
  35. Das, G.; Rao, G.J. Molecular marker assisted gene stacking for biotic and abiotic stress resistance genes in an elite rice cultivar. Front. Plant Sci. 2015, 30, 698. [Google Scholar] [CrossRef] [Scilit]
  36. Das, G.; Rao, G.J.N.; Varier, M.; Prakash, A.; Prasad, D. Improved Tapaswini having four BB resistance genes pyramided with six genes/QTLs, resistance/tolerance to biotic and abiotic stresses in rice. Sci. Rep. 2018, 8, 2413. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Khanna, A.; Sharma, V.; Ellur, R.K.; Shikari, A.B.; Krishnan, S.G.; Singh, U.D.; Prakash, G.; Sharma, T.R.; Rathour, R.; Variar, M.; et al. Development and evaluation of near-isogenic lines for major blast resistance gene(s) in Basmati rice. Theor. Appl. Genet. 2015, 128, 1243–1259. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Khan, G.H.; Shikari, A.B.; Vaishnavi, R.; Najeeb, S.; Padder, B.A.; Bhat, Z.; Parray, G.A.; Bhat, M.A.; Kumar, R.; Singh, N.K. Marker-assisted introgression of three dominant blast resistance genes into an aromatic rice cultivar Mushk Budji. Sci. Rep. 2018, 8, 4091. [Google Scholar] [CrossRef] [Scilit]
  39. Xiao, W.-M.; Luo, L.-X.; Wang, H.; Guo, T.; Liu, Y.-Z.; Zhou, J.-Y.; Zhu, X.-Y.; Yang, Q.-Y.; Chen, Z.-Q. Pyramiding of Pi46 and Pita to improve blast resistance and to evaluate the resistance effect of the two R genes. J. Integr. Agric. 2016, 15, 2290–2298. [Google Scholar] [CrossRef] [Scilit]
  40. Xiao, W.; Yang, Q.; Huang, M.; Guo, T.; Liu, Y.; Wang, J.; Yang, G.; Zhou, J.; Yang, J.; Zhu, X.; et al. Improvement of rice blast resistance by developing monogenic lines, two-gene pyramids and three-gene pyramid through MAS. Rice 2019, 12, 78. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  41. Tanweer, F.A.; Rafii, M.Y.; Sijam, K.; Rahim, H.A.; Ahmed, F.; Ashkani, S.; Latif, M.A. Introgression of Blast Resistance Genes (Putative Pi-b and Pi-kh) into Elite Rice Cultivar MR219 through Marker-Assisted Selection. Front. Plant Sci. 2015, 6, 1002. [Google Scholar] [CrossRef] [Scilit]
  42. Yao, S.; Chen, T.; Zhang, Y.-D.; Zhu, Z.; Zhao, Q.-Y.; Zhou, L.-H.; Zhao, L.; Zhao, C.-F.; Wang, C.-L. Pyramiding Pi-ta, Pi-b, and Wx-mq Genes by Marker-assisted Selection in Rice (Oryza sativa L.). Acta Agron. Sin. 2017, 43, 1622–1631. [Google Scholar] [CrossRef] [Scilit]
  43. Ma, J. Fine Mapping of the Blast Resistance Gene Pimh(t) and Detection of Major QTLs in Rice Elite Restorer Line Minghu63. Master’s Thesis, Nanjing Agricultural University, Nanjing, China, 2010. [Google Scholar]
  44. Shi, K. Fine Mapping of a Novel Blast Resistance Gene Pimh(t) in an Elite Restorer Line Minghu63. Master’s Thesis, Chinese Academy of Agricultural Sciences, Beijing, China, 2008. [Google Scholar]
  45. Ellur, R.K.; Khanna, A.; Yadav, A.; Pathania, S.; Rajashekara, H.; Singh, V.K.; Krishnan, S.G.; Bhowmick, P.K.; Nagarajan, M.; Vinod, K.; et al. Improvement of Basmati rice varieties for resistance to blast and bacterial blight diseases using marker assisted backcross breeding. Plant Sci. 2016, 242, 330–341. [Google Scholar] [CrossRef] [Scilit]
  46. Neelam, K.; Mahajan, R.; Gupta, V.; Bhatia, D.; Gill, B.K.; Komal, R.; Lore, J.S.; Mangat, G.S.; Singh, K. High-resolution genetic mapping of a novel bacterial blight resistance gene xa-45(t) identified from Oryza glaberrima and transferred to Oryza sativa. Theor. Appl. Genet. 2019, 133, 689–705. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Angeles-Shim, R.B.; Shim, J.; Vinarao, R.B.; Lapis, R.S.; Singleton, J.J. A novel locus from the wild allotetraploid rice species Oryza latifolia Desv. confers bacterial blight (Xanthomonas oryzae pv. oryzae) resistance in rice (O. sativa). PLoS ONE 2020, 15, e0229155. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Wang, C.; Zhang, X.; Fan, Y.; Gao, Y.; Zhu, Q.; Zheng, C.; Qin, T.; Li, Y.; Che, J.; Zhang, M.; et al. Xa23 is an executor R protein and confers broad-spectrum disease resistance in rice. Mol. Plant. 2015, 8, 290–302. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Chukwu, S.C.; Rafii, M.Y.; Ramlee, S.I.; Ismail, S.I.; Hasan, M.M.; Oladosu, Y.A.; Magaji, U.G.; Akos, I.; Olalekan, K.K. Bacterial leaf blight resistance in rice: A review of conventional breeding to molecular approach. Mol. Biol. Rep. 2019, 46, 1519–1532. [Google Scholar] [CrossRef] [Scilit]
  50. Zhou, Y.-L.; Xu, J.-L.; Zhou, S.-C.; Yu, J.; Xie, X.-W.; Xu, M.-R.; Sun, Y.; Zhu, L.-H.; Fu, B.-Y.; Gao, Y.-M.; et al. Pyramiding Xa23 and Rxo1 for resistance to two bacterial diseases into an elite indica rice variety using molecular approaches. Mol. Breed. 2008, 23, 279–287. [Google Scholar] [CrossRef] [Scilit]
  51. Wang, S.; Liu, W.; Lu, D.; Lu, Z.; Wang, X.; Xue, J.; He, X. Distribution of bacterial blight resistance genes in the main cultivars and application of Xa23 in rce breeding. Front. Plant Sci. 2020, 11, 555228. [Google Scholar] [CrossRef] [Scilit]
  52. Xu, P.; Ye, S.T.; Mou, T.M. Improvement of Blast, Bacterial blight and brown planthopper resistance of rice restorer line R1813 by molecular marker-assisted selection. Hybrid Rice 2019, 34, 62–69. [Google Scholar]
  53. Wettewa, W.H.; Kottearahchi, N.S. Sequence analysis of the mutation in the 7th exon of badh2 gene in traditional aromatic rice varieties in Sri Lanka. J. Agric. Sci.—Sri Lanka 2014, 9, 24. [Google Scholar] [CrossRef] [Scilit]
  54. Bradbury, L.M.T.; Fitzgerald, T.L.; Henry, R.J.; Jin, Q.; Waters, D.L.E. The gene for fragrance in rice. Plant Biotechnol. J. 2005, 3, 363–370. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. He, Q.; Park, Y.-J. Discovery of a novel fragrant allele and development of functional markers for fragrance in rice. Mol. Breed. 2015, 35, 217. [Google Scholar] [CrossRef] [Scilit]
  56. Gouda, G.; Gupta, M.K.; Donde, R.; Mohapatra, T.; Vadde, R.; Behera, L. Marker-assisted selection for grain number and yield-related traits of rice (Oryza sativa L.). Physiol. Mol. Biol. Plants 2020, 26, 885–898. [Google Scholar] [CrossRef] [Scilit]
  57. Das, G.; Patra, J.K.; Baek, K.H. Insight into MAS: A molecular tool for development of stress resistant and quality of rice through gene stacking. Front. Plant Sci. 2017, 8, 985. [Google Scholar] [CrossRef] [Scilit]
  58. Fuchs, M. Pyramiding resistance-conferring gene sequences in crops. Curr. Opin. Virol. 2017, 26, 36–42. [Google Scholar] [CrossRef] [Scilit]
  59. Reinke, R.; Kim, S.-M.; Kim, B.-K. Developing japonica rice introgression lines with multiple resistance genes for brown planthopper, bacterial blight, rice blast, and rice stripe virus using molecular breeding. Mol. Genet. Genom. 2018, 293, 1565–1575. [Google Scholar] [CrossRef] [Scilit]
  60. Ramalingam, J.; Raveendra, C.; Savitha, P.; Vidya, V.; Chaithra, T.L.; Velprabakaran, S.; Saraswathi, R.; Ramanathan, A.; Pillai, M.P.A.; Arumugachamy, S.; et al. Gene Pyramiding for Achieving Enhanced Resistance to Bacterial Blight, Blast, and Sheath Blight Diseases in Rice. Front. Plant Sci. 2020, 11, 591457. [Google Scholar] [CrossRef] [Scilit]
  61. Li, Y.; Mo, Y.; Li, Z.; Yang, M.; Tang, L.; Cheng, L.; Qiu, Y. Characterization and application of a gall midge resistance gene (Gm6) from Oryza sativa ‘Kangwenqingzhan’. Theor. Appl. Genet. 2019, 133, 579–591. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  62. Angeles-Shim, R.B.; Reyes, V.P.; del Valle, M.M.; Lapis, R.S.; Shim, J.; Sunohara, H.; Jena, K.K.; Ashikari, M.; Doi, K. Marker-Assisted Introgression of Quantitative Resistance Gene pi21 Confers Broad Spectrum Resistance to Rice Blast. Rice Sci. 2020, 27, 113–123. [Google Scholar] [CrossRef] [Scilit]
  63. Jiang, H.; Li, Z.; Liu, J.; Shen, Z.; Gao, G.; Zhang, Q.; He, Y. Development and evaluation of improved lines with broad-spectrum resistance to rice blast using nine resistance genes. Rice 2019, 12, 29. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  64. Balachiranjeevi, C.H.; Naik, B.S.; Kumar, A.V.; Harika, G.; Swamy, M.H.K.; Hajira, S.; Kumar, D.T.; Anila, M.; Kale, R.R.; Yugender, A.; et al. Marker-assisted pyramiding of two major, broad-spectrum bacterial blight resistance genes, Xa21 and Xa33 into an elite maintainer line of rice, DRR17B. PLoS ONE 2018, 13, e0201271. [Google Scholar] [CrossRef] [Scilit]
  65. Hsu, Y.-C.; Chiu, C.-H.; Yap, R.; Tseng, Y.-C.; Wu, Y.-P. Pyramiding Bacterial Blight Resistance Genes in Tainung82 for Broad-Spectrum Resistance Using Marker-Assisted Selection. Int. J. Mol. Sci. 2020, 21, 1281. [Google Scholar] [CrossRef] [Scilit]
  66. Reyes, V.P.; Angeles-Shim, R.B.; Mendioro, M.S.; Manuel, M.; Lapis, R.S.; Shim, J.; Sunohara, H.; Nishiuchi, S.; Kikuta, M.; Makihara, D.; et al. Marker-Assisted Introgression and Stacking of Major QTLs Controlling Grain Number (Gn1a) and Number of Primary Branching (WFP) to NERICA Cultivars. Plants 2021, 10, 844. [Google Scholar] [CrossRef] [Scilit]
  67. Liu, C.; Ding, S.; Zhang, A.; Hong, K.; Jiang, H.; Yang, S.; Ruan, B.; Zhang, B.; Dong, G.; Guo, L.; et al. Development of nutritious rice with high zinc/selenium and low cadmium in grains through QTL pyramiding. J. Integr. Plant Biol. 2020, 62, 349–359. [Google Scholar] [CrossRef] [Scilit]
  68. Liang, P.; Wang, H.; Zhang, Q.; Zhou, K.; Li, M.; Li, R.; Xiang, S.; Zhang, T.; Ling, Y.; Yang, Z.; et al. Identifi-cation and pyramiding of QTLs for rice grain size based on short-wide grain CSSL-Z563 and fine-mapping of qGL3-2. Rice 2021, 14, 35. [Google Scholar] [CrossRef] [Scilit]
  69. Zeng, D.; Tian, Z.; Rao, Y.; Dong, G.; Yang, Y.; Huang, L.; Leng, Y.; Xu, J.; Sun, C.; Zhang, G.; et al. Rational design of high-yield and superior-quality rice. Nat. Plants 2017, 3, 17031. [Google Scholar] [CrossRef] [Scilit]
  70. Jairin, J.; Phengrat, K.; Teangdeerith, S.; Vanavichit, A.; Toojinda, T. Mapping of a broad-spectrum brown planthopper resistance gene, Bph3, on rice chromosome 6. Mol. Breed. 2006, 19, 35–44. [Google Scholar] [CrossRef] [Scilit]
  71. Tian, D.; Chen, Z.; Chen, Z.; Zhou, Y.; Wang, Z.; Wang, F.; Chen, S. Allele-specific marker-based assessment revealed that the rice blast resistance genes Pi2 and Pi9 have not been widely deployed in Chinese indica rice cultivars. Rice 2016, 9, 19. [Google Scholar] [CrossRef] [Scilit]
  72. Fjellstrom, R.; Conaway-Bormans, C.A.; McClung, A.M.; Marchetti, M.A.; Shank, A.R.; Park, W.D. Development of DNA Markers Suitable for Marker Assisted Selection of ThreePiGenes Conferring Resistance to MultiplePyricularia griseaPathotypes. Crop. Sci. 2004, 44, 1790–1798. [Google Scholar] [CrossRef] [Scilit]
  73. Wang, C.L.; Fan, Y.L.; Zheng, C.K.; Qin, T.F.; Zhang, X.P.; Zhao, K.J. High-resolution genetic mapping of rice bacterial blight resistance gene Xa23. Mol. Genet. Genom. 2014, 289, 745–753. [Google Scholar] [CrossRef] [Scilit]
  74. Piao, R.; Jin, Y.; Li, P.; Chen, M.; Meng, F.; Zhou, G.; Yan, Y. Analyses of Genetic Diversity and Badh2 Alleles of Aromatic Japonica Rice Germplasm Resources in Northern China. J. Jilin Agric. Univ. 2021, 43, 507–515. [Google Scholar] [CrossRef]
  75. Murray, M.G.; Thompson, W.F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 1980, 8, 4321–4326. [Google Scholar] [CrossRef] [Scilit]
  76. IRRI. Standard Evaluation System (SES) for Rice, 5th ed.; International Rice Research Institute: Manila, Philippines, 2013. [Google Scholar]
  77. Evasudevan, K.; Cruz, C.M.V.; Gruissem, W.; Bhullar, N.K. Large scale germplasm screening for identification of novel rice blast resistance sources. Front. Plant Sci. 2014, 5, 505. [Google Scholar] [CrossRef] [Scilit]
  78. Kauffman, H.E. An improved technique for evaluating resistance of rice varieties to Xanthomonas oryzae. Plant Dis. Rep. 1973, 57, 537–541. [Google Scholar]
  79. Sood, B.C.; Siddiq, E.A. A rapid technique for scent determination in rice. Indian J.Genet. Plant Breed. 1975, 38, 268–275. [Google Scholar]
  80. Dhulappanavar, C.V. Inheritance of scent in rice. Euphytica 1976, 25, 659–662. [Google Scholar] [CrossRef] [Scilit]
  81. Fukuoka, S.; Saka, N.; Mizukami, Y.; Koga, H.; Yamanouchi, U.; Yoshioka, Y.; Hayashi, N.; Ebana, K.; Mizobuchi, R.; Yano, M. Gene pyramiding enhances durable blast disease resistance in rice. Sci. Rep. 2015, 5, 7773. [Google Scholar] [CrossRef] [Scilit]
  82. Jiang, N.; Yan, J.; Liang, Y.; Shi, Y.; He, Z.; Wu, Y.; Zeng, Q.; Liu, X.; Peng, J. Resistance Genes and their Interactions with Bacterial Blight/Leaf Streak Pathogens (Xanthomonas oryzae) in Rice (Oryza sativa L.)—An Updated Review. Rice 2020, 13, 3. [Google Scholar] [CrossRef] [Scilit]
  83. Ji, Z.-J.; Yang, S.-D.; Zeng, Y.-X.; Liang, Y.; Yang, C.-D.; Qian, Q. Pyramiding blast, bacterial blight and brown planthopper resistance genes in rice restorer lines. J. Integr. Agric. 2016, 15, 1432–1440. [Google Scholar] [CrossRef] [Scilit]
  84. Wang, Y.; Jiang, W.; Liu, H.; Zeng, Y.; Du, B.; Zhu, L.; He, G.; Chen, R. Marker assisted pyramiding of Bph6 and Bph9 into elite restorer line 93–11 and development of functional marker for Bph9. Rice 2017, 10, 51. [Google Scholar] [CrossRef] [Scilit]
  85. Yadav, S.; Sandhu, N.; Majumder, R.R.; Dixit, S.; Kumar, S.; Singh, S.P.; Mandal, N.P.; Das, S.P.; Yadaw, R.B.; Singh, V.; et al. Epistatic interactions of major effect drought QTLs with genetic background loci determine grain yield of rice under drought stress. Sci. Rep. 2019, 9, 2616. [Google Scholar] [CrossRef] [Scilit]
  86. Yadav, S.; Sandhu, N.; Dixit, S.; Singh, V.K.; Catolos, M.; Mazumder, R.R.; Rahman, M.A.; Kumar, A. Genomics-assisted breeding for successful development of multiple-stress-tolerant, climate-smart rice for southern and southeastern Asia. Plant Genome 2021, 14, e20074. [Google Scholar] [CrossRef] [Scilit]
  87. Pandian, B.A.; Joel, J.; Nachimuthu, V.V.; Swaminathan, M.; Govintharaj, P.; Tannidi, S.; Sabariappan, R. Marker-aided selection and validation of various Pi gene combinations for rice blast resistance in elite rice variety ADT 43. J. Genet. 2018, 97, 945–952. [Google Scholar] [CrossRef] [Scilit]
  88. Xiao, N.; Wu, Y.; Pan, C.; Yu, L.; Chen, Y.; Liu, G.; Li, Y.; Zhang, X.; Wang, Z.; Dai, Z.; et al. Improving of Rice Blast Resistances in Japonica by Pyramiding Major R Genes. Front. Plant Sci. 2017, 7, 1918. [Google Scholar] [CrossRef] [Scilit]
  89. Sanchez, A.; Brar, D.; Huang, N.; Li, Z.; Khush, G. Sequence Tagged Site Marker-Assisted Selection for Three Bacterial Blight Resistance Genes in Rice. Crop. Sci. 2000, 40, 792–797. [Google Scholar] [CrossRef] [Scilit]
  90. Leung, H.; Raghavan, C.; Zhou, B.; Oliva, R.; Choi, I.R.; Lacorte, V.; Jubay, M.L.; Cruz, C.V.; Gregorio, G.; Singh, R.K.; et al. Allele mining and en-hanced genetic recombination for rice breeding. Rice 2015, 8, 34. [Google Scholar] [CrossRef] [Scilit]
Figure 2. Phenotypic evaluation of the ILs which possessed a single introgressed trait and more than one trait in combination.
Figure 2. Phenotypic evaluation of the ILs which possessed a single introgressed trait and more than one trait in combination.
Agronomy 11 02525 g002
Figure 3. Evaluation of promising ILs for BPH, blast and BLB resistance. (a) BPH resistance performance of ILs introgressed with BPH resistance genes in combination with other targeted genes. (b) Blast resistance performance of ILs introgressed with blast resistance genes in combination with other targeted genes. (c) BLB resistance performance of ILs introgressed with BLB resistance gene in combination with other targeted genes.
Figure 3. Evaluation of promising ILs for BPH, blast and BLB resistance. (a) BPH resistance performance of ILs introgressed with BPH resistance genes in combination with other targeted genes. (b) Blast resistance performance of ILs introgressed with blast resistance genes in combination with other targeted genes. (c) BLB resistance performance of ILs introgressed with BLB resistance gene in combination with other targeted genes.
Agronomy 11 02525 g003
Figure 1. Diagram describing the scheme of MAS breeding for developing ILs pyramiding multiple target genes in rice.
Figure 1. Diagram describing the scheme of MAS breeding for developing ILs pyramiding multiple target genes in rice.
Agronomy 11 02525 g001
Table 1. Donors and linked markers for BPH, blast, BLB resistance and aroma genes in foreground selection and their validation in the developed lines.
Table 1. Donors and linked markers for BPH, blast, BLB resistance and aroma genes in foreground selection and their validation in the developed lines.
Targeted TraitsDonorLinked GeneMarkersPrimer SequenceAnnealing Temperature (°C)Reference
ForwardReverse
Brown plant hopperPtb33Bph3RM589ATCATGGTCGGTGGCTTAACCAGGTTCCAACCAGACACTG56[70]
BPHR96 Bph24HJ22CTATGTGGTCCCATTTCTTCGTGTCGGTTCACATGCTCC56[15]
BlastHZPi29-ProTGATTATGTTTTTTATGTGGGGATTAGTGAGATCCATTGTTCC51[71]
R1238Pi9
PitaYL155/YL87AGCAGGTTATAAGCTAGGCCCTACCAACAAGTTCATCAAA60[39]
MH63PimhRM213ACAAGCAGATACTGACTGATGCCTTCTTTGCATCCAGACTTCC55[43]
XYZPibPibdomGAACAATGCCCAAACTTGAGAGGGTCCACATGTCAGTGAGC58[72]
Bacterial leaf blightP59 Xa23Lj74AAGCCATTTGATGAGCAACCGGATCCATTTCAGCATAACCTT54[73]
AromaMX Bbadh2FMbadh2-E7GGTTGCATTTACTGGGAGTTCAGTGAAACAGGCTGTCAAG54[74]
YX B
Table 2. Pyramiding targeted genes by MAS and evaluation of resistance and aroma in the new lines.
Table 2. Pyramiding targeted genes by MAS and evaluation of resistance and aroma in the new lines.
ILsCross CombinationGenes Recombined in Pyramided LinesNo. of Targeted GenesResistance ScoreAroma Trait
Bph3Bph24Pi2Pi9PitaPibPimhXa23badh2BPHLeaf BlastPanicle BlastBLB
IL1 *HZ/(GH998///P59//BPHR96/Ptb33)++++43 (MR)2 (HR)3 (MR)1 (HR)
IL2HZ/(GH998///P59//BPHR96/Ptb33)++++43 (MR)3 (MR)3 (MR)1 (HR)
IL3 *(GH998//XYZ/Ptb33)/(GH998/P59)+++33 (MR)3 (MR)3 (MR)1 (HR)
IL4HZ/(MX B//XYZ/BPHR96)++++43 (MR)2 (HR)3 (MR)7 (MS)+
IL5 *HZ/(MX B//XYZ/BPHR96)++-++43 (MR)3 (MR)3 (MR)7 (MS)+
IL6 *MX B//XYZ/BPHR96+++33 (MR)3 (MR)3 (MR)7 (MS)+
IL7 *HZ///MH63//R8/(GH998//BPHR96/Ptb33)++++43 (MR)2 (HR)1 (HR)5 (MS)
IL8 *(MH63/XYZ)//IR64/(R8///GH998//BPHR96/Ptb33)++++43 (MR)3 (MR)3 (MR)5 (MS)
IL9 *HZ///R8/(GH998//BPHR96/Ptb33)+++33 (MR)2 (HR)3 (MR)5 (MS)
IL10 *HZ//HZ/(R8///GH998//BPHR96/Ptb33)+++33 (MR)3 (MR)3 (MR)7 (MS)
IL11 *HZ//IR64/(R8///GH998//BPHR96/Ptb33)+++33 (MR)2 (HR)3 (MR)7 (MS)
IL12 *HZ/(GH998//BPHR96/Ptb33)//R8/(GH998//BPHR96/Ptb33)+++33 (MR)3 (MR)3 (MR)7 (MS)
IL13 *HZ///GH998//MH63/BPHR96-++-+33 (MR)3 (MR)1 (HR)5 (MS)
IL14GH998///GH998//GH998/(P59//BPHR96/Ptb33)+++33 (MR)9 (HS)9 (HS)1 (HR)
IL15GH998///GH998//GH998/(P59//BPHR96/Ptb33)++--+33 (MR)9 (HS)9 (HS)1 (HR)
IL16GH998///GH998//GH998/(P59//BPHR96/Ptb33)+++33 (MR)8 (MS)9 (HS)1 (HR)
IL17GH998///GH998//GH998/(P59//BPHR96/Ptb33)+++33 (MR)9 (HS)9 (HS)1 (HR)
IL18 *GH998///GH998//GH998/(P59//BPHR96/Ptb33)+++33 (MR)9 (HS)9 (HS)1 (HR)
IL19 *GH998/P59///GH998//BPHR96/Ptb33+++33 (MR)8 (MS)9 (HS)1 (HR)
IL20 *HZ//R1238/(GH998/P59)+++37 (MS)2 (HR)1 (HR)1 (HR)
IL21 *R1238///YF B//GH998/P59+++37 (MS)2 (HR)3 (MR)1 (HR)
IL22R1238///YF B//GH998/P59+++39 (HS)1 (HR)3 (MR)1 (HR)
IL23 *R1238//GH998/P59+++39 (HS)1 (HR)3 (MR)1 (HR)
IL24R1238//GH998/P59+++37 (MS)2 (HR)1 (HR)1 (HR)
IL25R1238//GH998/P59+++37 (MS)2 (HR)1 (HR)1 (HR)
IL26R1238//GH998/P59+++39 (HS)2 (HR)3 (MR)1 (HR)
IL27 *HZ//MH63/XYZ+++37 (MS)1 (HR)1 (HR)5 (MS)
IL28HZ//MH63/XYZ+++39 (HS)1 (HR)1 (HR)7 (MS)
IL29HZ//MH63/XYZ+++39 (HS)1 (HR)1 (HR)5 (MS)
IL30HZ//HZ/Ptb33++23 (MR)2 (HR)1 (HR)9 (HS)
IL31YF B/(XYZ//MM B/BPHR96++23 (MR)3 (MR)3 (MR)9 (HS)
IL32R8///(209B/GH998)//MH63/BPHR96++23 (MR)3 (MR)3 (MR)7 (MS)
IL33R8///(YF B/GH998)//MH63/BPHR96++23 (MR)2 (HR)3 (MR)7 (MS)
IL34MM B/P59//MM B/BPHR96++23 (MR)9 (HS)9 (HS)1 (HR)
IL35MX B//MM B/BPHR96++23 (MR)9 (HS)9 (HS)9 (HS)+
IL36Qun B///MX B//MM B/BPHR96++23 (MR)8 (MS)9 (HS)7 (MS)+
IL37Qun B///MX B//MM B/BPHR96++23 (MR)9 (HS)9 (HS)9 (HS)+
IL38Qun B///MX B//MM B/BPHR96++23 (MR)8 (MS)9 (HS)7 (MS)+
IL39Qun B///MX B//MM B/BPHR96++23 (MR)9 (HS)9 (HS)5 (MS)+
IL40Qun B///MX B//MM B/BPHR96++23 (MR)9 (HS)9 (HS)9 (HS)+
IL41Qun B///MX B//MM B/BPHR96++23 (MR)9 (HS)9 (HS)7 (MS)+
IL42Qun B///MX B//MM B/BPHR96++23 (MR)8 (MS)9 (HS)7 (MS)+
IL43Qun B///MX B//MM B/BPHR96++23 (MR)9 (HS)9 (HS)5 (MS)+
IL44Qun B///MX B//MM B/BPHR96++23 (MR)9 (HS)9 (HS)5 (MS)+
IL45Qun B///MX B//MM B/BPHR96++23 (MR)8 (MS)9 (HS)9 (HS)+
IL46HZ/(GH998/P59)++27 (MS)1 (HR)3 (MR)1 (HR)
IL47HZ//HZ/(GH998/P59)++27 (MS)2 (HR)3 (MR)1 (HR)
IL48MH63/P59++29 (HS)2 (HR)1 (HR)1 (HR)
IL49YX B/HZ--+-----+27 (MS)3 (MR)3 (MR)7 (MS)+
IL50YX B//XYZ/MX B++27 (MS)3 (MR)3 (MR)7 (MS)+
IL51(GH998//BPHR96/Ptb33)//R8/(GH998//BPHR96/Ptb33)++23 (MR)9 (HS)9 (HS)7 (MS)
IL52(GH998//BPHR96/Ptb33)//R8/(GH998//BPHR96/Ptb33)++23 (MR)9 (HS)9 (HS)7 (MS)
IL53(YF B/GH998)/(GH998//BPHR96/Ptb33)++23 (MR)8 (MS)9 (HS)9 (HS)
IL54(YF B/GH998)/(GH998//BPHR96/Ptb33)++23 (MR)9 (HS)9 (HS)7 (MS)
IL55IR64/(R8///GH998//BPHR96/Ptb33)++23 (MR)9 (HS)9 (HS)7 (MS)
IL56R8/(GH998//BPHR96/Ptb33)++23 (MR)9 (HS)9 (HS)7 (MS)
IL57HZ//IR64/(R8/R1238)++29 (HS)3 (MR)1 (HR)9 (HS)
IL58HZ/R1238++29 (HS)1 (HR)1 (HR)9 (HS)
IL59(MH63/XYZ)/R553++29 (HS)3 (MR)3 (MR)5 (MS)
IL60UF B//MM B/BPHR96+13 (MR)9 (HS)9 (HS)7 (MS)
IL61YF B//MM B/BPHR96+13 (MR)9 (HS)9 (HS)7 (MS)
IL62YF B//MM B/BPHR96+13 (MR)9 (HS)9 (HS)7 (MS)
IL63YF B//MM B/BPHR96+13 (MR)8 (MS)9 (HS)9 (HS)
IL64YF B//MM B/BPHR96+13 (MR)9 (HS)9 (HS)9 (HS)
IL65YF B/(GH998/P59)//(GH998/P59)+17 (MS)9 (HS)9 (HS)1 (HR)
IL66YF B/(GH998/P59)//(GH998/P59)+17 (MS)9 (HS)9 (HS)1 (HR)
IL67YF B/(GH998/P59)//(GH998/P59)+19 (HS)8 (MS)9 (HS)1 (HR)
IL68YF B//GH998/P59+19 (HS)8 (MS)9 (HS)1 (HR)
IL69YF B//GH998/P59+17 (MS)9 (HS)9 (HS)1 (HR)
IL70YF B//GH998/P59+17 (MS)9 (HS)9 (HS)1 (HR)
IL71YX B//MX B/ZZ B+19 (HS)8 (MS)9 (HS)9 (HS)+
IL72YX B//MX B/ZZ B+19 (HS)9 (HS)9 (HS)9 (HS)+
IL73YX B//YX B/HF B+17 (MS)8 (MS)9 (HS)9 (HS)+
IL74YX B//YX B/ZZ B+17 (MS)9 (HS)9 (HS)9 (HS)+
Ptb33BPH resistant control 3 (MR)7 (MS)7 (MS)9 (HS)
HZBL resistant control 9 (HS)2 (HR)2 (HR)7 (MS)
P59BLB resistant control 7 (MS)7 (MS)7 (MS)1 (HR)
TN1BPH-, blast- and BLB-susceptible control 9 (HS)7 (MS)9 (HS)9 (HS)
“IL” represents the improved lines; + indicates the presence of the targeted allele of the gene; − indicates the absence of the targeted allele of the gene; * indicates the selected ILs for agronomic trait evaluation; HR-resistance score, 0–1; MR-resistance score, 3; MS-resistance score, 5–8; HS-resistance score, 9.
Table 3. Number of plants evaluated and selected for multiple targeted genes in each generation.
Table 3. Number of plants evaluated and selected for multiple targeted genes in each generation.
GenerationNo. of Plants EvaluatedNo. of Plants SelectedNo. of Selected Plants Introgressed with a Different Number of Genes
1 Gene2 Genes3 Genes4 Genes
F151314457303918
F26127 (from 144 families)27291846631
F38109 (from 272 plant families)21980615226
F42433 (from 219 plant families)18578533915
F51891 (from 185 plant families)1063136309
F61152 (from 106 plant families)741530236
F774 promising lines-1530236
- indicates the selection was not made in F7 generation.
Table 4. Evaluation of agronomic performance of the selected 17 ILs and representative recipient parents.
Table 4. Evaluation of agronomic performance of the selected 17 ILs and representative recipient parents.
LinePlant Height
(cm)
Flag Leaf Length
(cm)
Flag Leaf Width
(cm)
Panicle Number per Plant Seed Set Rate
(%)
Grain Number per Panicle1000-Grain Weight
(g)
Grain Weight per Plant
(g)
Recipient Parents
IlsIL1104.4 ± 1.6036.6 ± 0.352.2 ± 0.026.5 ± 1.3184.0 ± 1.32220.2 ± 7.4519.0 ± 0.1425.1 ± 1.71HZ, GH998
IL3106.4 ± 0.9329.1 ± 0.621.8 ± 0.0910.2 ± 1.4182.2 ± 1.27186.0 ± 6.2225.3 ± 0.2647.1 ± 2.83GH998, XYZ
IL5103.6 ± 1.0227.2 ± 0.391.5 ± 0.069.1 ± 1.2983.1 ± 1.97192.3 ± 5.0621.7 ± 0.4437.5 ± 1.84HZ, MXB, XYZ
IL698.7 ± 1.2636.3 ± 0.962.2 ± 0.047.4 ± 0.5180.0 ± 1.54243.0 ± 8.0220.3 ± 0.3034.6 ± 3.01MXB, XYZ
IL7126.6 ± 0.9033.9 ± 0.782.5 ± 0.079.0 ± 1.3280.4 ± 1.62225.3 ± 5.6721.1 ± 0.3142.8 ± 1.10HZ, MH63,GH998
IL8111.4 ± 1.3049.1 ± 0.491.9 ± 0.0212.3 ± 1.2584.2 ± 1.55168.8 ± 7.1918.8 ± 0.9638.1 ± 2.38MH63, XYZ, GH998
IL995.8 ± 1.9437.8 ± 0.411.6 ± 0.099.3 ± 0.2582.4 ± 1.83216.6 ± 11.9425.9 ± 0.4950.5 ± 0.92HZ, GH998
IL10115.6 ± 0.4441.1 ± 1.281.8 ± 0.0413.8 ± 1.3779.6 ± 2.02158.8 ± 9.2319.0 ± 0.2142.2 ± 1.12HZ, GH998
IL11104.3 ± 1.4943.3 ± 1.202.2 ± 0.0710.9 ± 0.3983.6 ± 1.09178.0 ± 7.3727.3 ± 0.2753.5 ± 1.01HZ, GH998
IL12100.3 ± 2.5531.6 ± 0.301.6 ± 0.059.1 ± 0.3384.0 ± 2.26190.0 ± 6.5619.0 ± 0.3132.5 ± 3.22HZ, GH998
IL13120.4 ± 1.2741.6 ± 0.361.8 ± 0.0611.0 ± 0.4282.4 ± 1.91176.3 ± 12.5423.1 ± 0.4344.8 ± 1.45HZ, GH998,MH63
IL1894.1 ± 2.1233.3 ± 0.821.6 ± 0.038.6 ± 1.4482.2 ± 1.37204.5 ± 7.2116.8 ± 1.1830.8 ± 1.57GH998
IL1996.8 ± 0.5232.9 ± 0.551.8 ± 0.068.7 ± 1.2781.5 ± 1.88210.0 ± 7.5415.7 ± 0.5229.7 ± 1.32GH998
IL20116.6 ± 0.7845.7 ± 0.771.8 ± 0.0912.4 ± 1.5481.7 ± 1.63166.6 ± 6.4522.5 ± 0.2245.0 ± 1.15HZ, GH998
IL21107.8 ± 2.5944.7 ± 0.402.5 ± 0.0810.0 ± 0.3481.6 ± 1.48184.2 ± 6.7319.3 ± 1.2035.6 ± 2.17YFB, GH998
IL2397.6 ± 1.0928.7 ± 1.261.7 ± 0.0312.2 ± 1.3583.1 ± 2.20186.8 ± 9.0218.3 ± 0.3741.0 ± 1.03GH998
IL27116.7 ± 2.0345.1 ± 0.572.0 ± 0.049.4 ± 1.4382.8 ± 1.67182.9 ± 11.8523.2 ± 0.5038.2 ± 2.13HZ, MH63, XYZ
RecipientsHZ93.4 ± 0.3938.0 ± 0.441.6 ± 0.049.8 ± 0.3284.6 ± 1.20168.7 ± 7.5521.5 ± 0.7236.3 ± 1.33-
GH99898.0 ± 0.4936.8 ± 0.311.3 ± 0.0312.6 ± 1.0285.2 ± 1.52162.9 ± 9.7719.5 ± 0.4141.3 ± 1.54-
MH6397.6 ± 0.8738.6 ± 1.102.1 ± 0.0510.9 ± 0.3583.5 ± 1.70148.2 ± 6.0924.5 ± 0.5039.9 ± 0.69-
XYZ62.1 ± 0.4132.4 ± 0.621.4 ± 0.0712.0 ± 0.3286.2 ± 1.50142.8 ± 6.7119.5 ± 0.3933.4 ± 0.11-
YFB73.4 ± 0.9746.7 ± 0.471.9 ± 0.065.0 ± 1.3780.4 ± 2.15298.7 ± 6.9320.5 ± 0.6330.6 ± 1.48-
MXB70.6 ± 0.7336.1 ± 0.331.5 ± 0.039.9 ± 0.2083.9 ± 1.29167.5 ± 7.4618.0 ± 0.2230.2 ± 0.72-
MMB70.4 ± 1.2016.4 ± 0.241.7 ± 0.049.3 ± 0.4179.4 ± 1.44172.6 ± 10.0722.5 ± 0.4635.0 ± 0.32-
ZZB72.2 ± 0.6140.2 ± 1.251.3 ± 0.0512.2 ± 1.3182.4 ± 2.03158.7 ± 6.1218.0 ± 0.5634.3 ± 1.12-
R55396.2 ± 0.8640.3 ± 0.311.7 ± 0.0910.1 ± 1.2880.6 ± 1.72151.0 ± 6.7223.5 ± 0.3335.5 ± 0.23-
YXB73.5 ± 0.7438.9 ± 0.811.3 ± 0.0110.7 ± 0.2884.0 ± 1.98167.4 ± 7.8917.5 ± 0.8532.2 ± 1.57-
HFB63.5 ± 1.3333.4 ± 0.982.0 ± 0.0511.0 ± 1.3382.0 ± 1.34172.6 ± 7.3321.0 ± 0.3639.9 ± 1.90-
Note: - indicates the genetic background are not discussed. HZ—Huazhan, GH998—Guanghui 998, MH 6 3—Minhui 63, XYZ—Xinyunzhan, YF B—Yunfeng B, MX B—Mengxiang B, MM B—Meimeng B, ZZ B—Zhongzhe B, YX B—Yexiang B, HF B—Hengfeng B.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Wang, X.; Guo, X.; Ma, X.; Luo, L.; Fang, Y.; Zhao, N.; Han, Y.; Wei, Z.; Liu, F.; Qin, B.; et al. Development of New Rice (Oryza. sativa L.) Breeding Lines through Marker-Assisted Introgression and Pyramiding of Brown Planthopper, Blast, Bacterial Leaf Blight Resistance, and Aroma Genes. Agronomy 2021, 11, 2525. https://doi.org/10.3390/agronomy11122525

AMA Style

Wang X, Guo X, Ma X, Luo L, Fang Y, Zhao N, Han Y, Wei Z, Liu F, Qin B, et al. Development of New Rice (Oryza. sativa L.) Breeding Lines through Marker-Assisted Introgression and Pyramiding of Brown Planthopper, Blast, Bacterial Leaf Blight Resistance, and Aroma Genes. Agronomy. 2021; 11(12):2525. https://doi.org/10.3390/agronomy11122525

Chicago/Turabian Style

Wang, Xuan, Xinying Guo, Xixi Ma, Liang Luo, Yaoyu Fang, Neng Zhao, Yue Han, Zheng Wei, Fang Liu, Baoxiang Qin, and et al. 2021. "Development of New Rice (Oryza. sativa L.) Breeding Lines through Marker-Assisted Introgression and Pyramiding of Brown Planthopper, Blast, Bacterial Leaf Blight Resistance, and Aroma Genes" Agronomy 11, no. 12: 2525. https://doi.org/10.3390/agronomy11122525

APA Style

Wang, X., Guo, X., Ma, X., Luo, L., Fang, Y., Zhao, N., Han, Y., Wei, Z., Liu, F., Qin, B., & Li, R. (2021). Development of New Rice (Oryza. sativa L.) Breeding Lines through Marker-Assisted Introgression and Pyramiding of Brown Planthopper, Blast, Bacterial Leaf Blight Resistance, and Aroma Genes. Agronomy, 11(12), 2525. https://doi.org/10.3390/agronomy11122525

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop