Development of New Rice (Oryza. sativa L.) Breeding Lines through Marker-Assisted Introgression and Pyramiding of Brown Planthopper, Blast, Bacterial Leaf Blight Resistance, and Aroma Genes
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Breeding Strategy and Genotyping
2.3. Evaluation of BPH Resistance
2.4. Evaluation of Blast Resistance
2.5. Evaluation of BLB Resistance
2.6. Evaluation of Aroma
2.7. Investigation of the Agronomic Traits
3. Results
3.1. Marker-Assisted Breeding to Pyramid BPH, Blast, BLB and Aroma Genes
3.2. Phenotypic Evaluation of Introgression Lines for BPH Resistance
3.3. Phenotypic Evaluation of Introgression Lines for Blast Resistance
3.4. Phenotypic Evaluation of Introgression Lines for BLB Resistance
3.5. Phenotypic Evaluation of Introgression Lines for Aroma
3.6. Comparison of Agronomic Traits in the ILs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Liu, W.; Liu, J.; Triplett, L.; Leach, J.E.; Wang, G.-L. Novel Insights into Rice Innate Immunity against Bacterial and Fungal Pathogens. Annu. Rev. Phytopathol. 2014, 52, 213–241. [Google Scholar] [CrossRef] [Green Version]
- Akhtar, S.; Bhat, M.A.; Wani, S.A.; Bhat, K.A.; Mir, S.; Chalkoo, M.R.; Wani, S.A. Marker assisted selection in rice. J. Phytol. 2010, 2, 66–81. [Google Scholar]
- Hu, G.; Lu, F.; Zhai, B.-P.; Lu, M.-H.; Liu, W.-C.; Zhu, F.; Wu, X.-W.; Chen, G.-H.; Zhang, X.-X. Outbreaks of the Brown Planthopper Nilaparvata lugens (Stål) in the Yangtze River Delta: Immigration or Local Reproduction? PLoS ONE 2014, 9, e88973. [Google Scholar] [CrossRef]
- Tanaka, K.; Endo, S.; Kazano, H. Toxicity of insecticides to predators of rice planthoppers: Spiders, the mirid bug and the dryinid wasp. Appl. Entomol. Zool. 2000, 35, 177–187. [Google Scholar] [CrossRef]
- Mottaleb, K.A.; Mishra, A.K. Rice Consumption and Grain-Type Preference by Household: A Bangladesh Case. J. Agric. Appl. Econ. 2016, 48, 298–319. [Google Scholar] [CrossRef] [Green Version]
- Zhang, J.; Guan, W.; Huang, C.; Hu, Y.; Chen, Y.; Guo, J.; Zhou, C.; Chen, R.; Du, B.; Zhu, L.; et al. Combining next-generation sequencing and single-molecule sequencing to explore brown plant hopper responses to contrasting genotypes of japonica rice. BMC Genom. 2019, 20, 682. [Google Scholar] [CrossRef] [PubMed]
- Sōgawa, K. The Rice Brown Planthopper: Feeding Physiology and Host Plant Interactions. Annu. Rev. Entomol. 1982, 27, 49–73. [Google Scholar] [CrossRef]
- Cabauatan, P.Q.; Cabunagan, R.C.; Choi, I.R. Rice viruses transmitted by the brown planthopper Nilaparvata lugens Stål. In Planthoppers: New Threats to the Sustainability of Intensive Rice Production Systems in Asia; Heong, K.L., Hardy, B., Eds.; International Rice Research Institute: Los Baños, Philippines, 2009; pp. 357–368. [Google Scholar]
- Akanksha, S.; Jhansi, L.V.; Singh, A.K.; Deepthi, Y.; Chirutkar, P.M.; Ramdeen; Balakrishnan, D.; Sarla, N.; Mangrauthia, S.K.; Ram, T. Genetics of novel brown planthopper Nilaparvata lugens (Stål) resistance genes in derived introgression lines from the interspecific cross O. sativa var. Swarna × O. nivara. J. Genet. 2019, 98, 113. [Google Scholar] [CrossRef]
- Cruz, A.P.; Arida, A.; Heong, K.L.; Horgan, F.G. Aspects of brown planthopper adaptation to resistant rice varieties with the Bph3 gene. Entomol. Exp. Appl. 2011, 141, 245–257. [Google Scholar] [CrossRef]
- Qing, D.; Dai, G.; Zhou, W.; Huang, S.; Liang, H.; Gao, L.; Gao, J.; Huang, J.; Zhou, M.; Chen, R.; et al. Development of molecular marker and introgression of Bph3 into elite rice cultivars by marker-assisted selection. Breed. Sci. 2019, 69, 40–46. [Google Scholar] [CrossRef] [Green Version]
- Jiang, H.; Hu, J.; Li, Z.; Liu, J.; Gao, G.; Zhang, Q.; Xiao, J.; He, Y. Evaluation and breeding application of six brown planthopper resistance genes in rice maintainer line Jin 23B. Rice 2018, 11, 22. [Google Scholar] [CrossRef]
- Liu, Y.; Chen, L.; Liu, Y.; Dai, H.; He, J.; Kang, H.; Pan, G.; Huang, J.; Qiu, Z.; Wang, Q.; et al. Marker assisted pyramiding of two brown planthopper resistance genes, Bph3 and Bph27 (t), into elite rice Cultivars. Rice 2016, 9, 27. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dixit, S.; Singh, U.M.; Singh, A.K.; Alam, S.; Venkateshwarlu, C.; Nachimuthu, V.V.; Yadav, S.; Abbai, R.; Selvaraj, R.; Devi, M.N.; et al. Marker assisted forward breeding to combine multiple biotic-abiotic stress resistance/tolerance in rice. Rice 2020, 13, 29. [Google Scholar] [CrossRef]
- Xiao, C.; Hu, J.; Ao, Y.-T.; Cheng, M.-X.; Gao, G.-J.; Zhang, Q.-L.; He, G.-C.; He, Y.Q. Development and evaluation of near-isogenic lines for brown planthopper resistance in rice cv. 9311. Sci. Rep. 2016, 6, 38159. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, K.Y.; Lu, S.N.; Qiu, J.L.; Li, X.X.; Ma, Z.F.; Chen, Q.; Li, C.; Wei, S.M.; Huang, F.K.; Zhang, Y.X.; et al. Development of Brown Planthopper Resistance Gene-Inserted and-Accumulated Lines of Rice Restorers. Mol. Plant Breed. 2011, 9, 410–417. [Google Scholar]
- Liu, K.; Zhang, Y.; Liu, F.; Qiu, Y.; Li, R. Resistant performance of bacterial blight and brown planthopper resistance gene-pyramided lines in rice. Southwest China J. Agric. Sci. 2013, 26, 1852–1857. [Google Scholar]
- Fukuoka, S.; Saka, N.; Koga, H.; Ono, K.; Shimizu, T.; Ebana, K.; Hayashi, N.; Takahashi, A.; Hirochika, H.; Okuno, K.; et al. Loss of Function of a Proline-Containing Protein Confers Durable Disease Resistance in Rice. Science 2009, 325, 998–1001. [Google Scholar] [CrossRef] [PubMed]
- Fernandez, J.; Orth, K. Rise of a Cereal Killer: The Biology of Magnaporthe oryzae Biotrophic Growth. Trends Microbiol. 2018, 26, 582–597. [Google Scholar] [CrossRef]
- He, M.; Su, J.; Xu, Y.; Chen, J.; Chern, M.; Lei, M.; Qi, T.; Wang, Z.; Ryder, L.S.; Tang, B.; et al. Discovery of broad-spectrum fungicides that block septin-dependent infection processes of pathogenic fungi. Nat. Microbiol. 2020, 5, 1565–1575. [Google Scholar] [CrossRef]
- Bundó, M.; Coca, M. Enhancing blast disease resistance by overexpression of the calcium-dependent protein kinase OsCPK4 in rice. Plant Biotechnol. J. 2016, 14, 1357–1367. [Google Scholar] [CrossRef] [Green Version]
- Dong, L.; Liu, S.; Kyaing, M.S.; Xu, P.; Tharreau, D.; Deng, W.; Li, X.; Bi, Y.; Zeng, L.; Li, J.; et al. Identification and fine mapping of Pi69(t), a new gene conferring broad-spectrum resistance against Magnaporthe oryzae from Oryza glaberrima Steud. Front. Plant Sci. 2020, 11, 1190. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Lei, F.; Wang, Q.; He, W.; Yuan, B.; Yuan, W. Identification of Novel Alleles of the Rice Blast-Resistance Gene Pi9 through Sequence-Based Allele Mining. Rice 2020, 13, 80. [Google Scholar] [CrossRef] [PubMed]
- Zhou, B.; Qu, S.; Liu, G.; Dolan, M.; Sakai, H.; Lu, G.; Bellizzi, M.; Wang, G.L. The Eight Amino-Acid Differences within Three Leucine-Rich Repeats between Pi2 and Piz-t Resistance Proteins Determine the Resistance Specificity toMagnaporthe grisea. Mol. Plant-Microbe Interact. 2006, 19, 1216–1228. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Qu, S.; Liu, G.; Zhou, B.; Bellizzi, M.; Zeng, L.; Dai, L.; Han, B.; Wang, G.L. The broad-spectrum blast resistance gene Pi9 encodes a nucleotide-binding site–leucine-rich repeat protein and is a member of a multigene family in rice. Genetics 2006, 172, 1901–1914. [Google Scholar] [CrossRef] [Green Version]
- Jia, Y.; Bryan, G.T.; Farrall, L.; Valent, B. Natural Variation at the Pi-ta Rice Blast Resistance Locus. Phytopathology 2003, 93, 1452–1459. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Z.X.; Yano, M.; Yamanouchi, U.; Iwamoto, M.; Monna, L.; Hayasaka, H.; Katayose, Y.; Sasaki, T. The Pib gene for rice blast resistance belongs to the nucleotide binding and leucine-rich repeat class of plant disease resistance genes. Plant J. 1999, 19, 55–64. [Google Scholar] [CrossRef] [PubMed]
- Jiang, H.; Feng, Y.; Bao, L.; Li, X.; Gao, G.; Zhang, Q.; Xiao, J.; Xu, C.; He, Y. Improving blast resistance of Jin 23B and its hybrid rice by marker-assisted gene pyramiding. Mol. Breed. 2012, 30, 1679–1688. [Google Scholar] [CrossRef]
- Jiang, J.; Mou, T.; Yu, H.; Zhou, F. Molecular breeding of thermo-sensitive genic male sterile (TGMS) lines of rice for blast resistance using Pi2 gene. Rice 2015, 8, 11. [Google Scholar] [CrossRef] [Green Version]
- Jiang, J.; Yang, D.; Ali, J.; Mou, T. Molecular marker-assisted pyramiding of broad-spectrum disease resistance genes, Pi2 and Xa23, into GZ63-4S, an elite thermo-sensitive genic male-sterile line in rice. Mol. Breed. 2015, 35, 83. [Google Scholar] [CrossRef]
- Mi, J.; Yang, D.; Chen, Y.; Jiang, J.; Mou, H.; Huang, J.; Ouyang, Y.; Mou, T. Accelerated molecular breeding of a novel P/TGMS line with broad-spectrum resistance to rice blast and bacterial blight in two-line hybrid rice. Rice 2018, 11, 11. [Google Scholar] [CrossRef]
- Luo, Y.; Ma, T.; Zhang, A.; Ong, K.H.; Li, Z.; Yang, J.; Yin, Z. Marker-assisted breeding of the rice restorer line Wanhui 6725 for disease resistance, submergence tolerance and aromatic fragrance. Rice 2016, 9, 66. [Google Scholar] [CrossRef] [Green Version]
- Zhang, X.C.; Sun, J.H.; Wang, Q.; Wang, H.L.; Li, J.L.; Zhang, D.S.; Zhu, S.S. Breeding and application of blast-resistant restorer line Qianhui 101 in rice. China Rice 2021, 27, 108–110. [Google Scholar]
- Luo, Y.; Ma, T.; Teo, J.; Luo, Z.; Li, Z.; Yang, J. Marker-assisted breeding of thermo-sensitive genic male sterile line 1892s for disease resistance and submergence tolerance. Rice Sci. 2021, 28, 89–98. [Google Scholar]
- Das, G.; Rao, G.J. Molecular marker assisted gene stacking for biotic and abiotic stress resistance genes in an elite rice cultivar. Front. Plant Sci. 2015, 30, 698. [Google Scholar] [CrossRef] [Green Version]
- Das, G.; Rao, G.J.N.; Varier, M.; Prakash, A.; Prasad, D. Improved Tapaswini having four BB resistance genes pyramided with six genes/QTLs, resistance/tolerance to biotic and abiotic stresses in rice. Sci. Rep. 2018, 8, 2413. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Khanna, A.; Sharma, V.; Ellur, R.K.; Shikari, A.B.; Krishnan, S.G.; Singh, U.D.; Prakash, G.; Sharma, T.R.; Rathour, R.; Variar, M.; et al. Development and evaluation of near-isogenic lines for major blast resistance gene(s) in Basmati rice. Theor. Appl. Genet. 2015, 128, 1243–1259. [Google Scholar] [CrossRef] [PubMed]
- Khan, G.H.; Shikari, A.B.; Vaishnavi, R.; Najeeb, S.; Padder, B.A.; Bhat, Z.; Parray, G.A.; Bhat, M.A.; Kumar, R.; Singh, N.K. Marker-assisted introgression of three dominant blast resistance genes into an aromatic rice cultivar Mushk Budji. Sci. Rep. 2018, 8, 4091. [Google Scholar] [CrossRef]
- Xiao, W.-M.; Luo, L.-X.; Wang, H.; Guo, T.; Liu, Y.-Z.; Zhou, J.-Y.; Zhu, X.-Y.; Yang, Q.-Y.; Chen, Z.-Q. Pyramiding of Pi46 and Pita to improve blast resistance and to evaluate the resistance effect of the two R genes. J. Integr. Agric. 2016, 15, 2290–2298. [Google Scholar] [CrossRef] [Green Version]
- Xiao, W.; Yang, Q.; Huang, M.; Guo, T.; Liu, Y.; Wang, J.; Yang, G.; Zhou, J.; Yang, J.; Zhu, X.; et al. Improvement of rice blast resistance by developing monogenic lines, two-gene pyramids and three-gene pyramid through MAS. Rice 2019, 12, 78. [Google Scholar] [CrossRef] [PubMed]
- Tanweer, F.A.; Rafii, M.Y.; Sijam, K.; Rahim, H.A.; Ahmed, F.; Ashkani, S.; Latif, M.A. Introgression of Blast Resistance Genes (Putative Pi-b and Pi-kh) into Elite Rice Cultivar MR219 through Marker-Assisted Selection. Front. Plant Sci. 2015, 6, 1002. [Google Scholar] [CrossRef] [Green Version]
- Yao, S.; Chen, T.; Zhang, Y.-D.; Zhu, Z.; Zhao, Q.-Y.; Zhou, L.-H.; Zhao, L.; Zhao, C.-F.; Wang, C.-L. Pyramiding Pi-ta, Pi-b, and Wx-mq Genes by Marker-assisted Selection in Rice (Oryza sativa L.). Acta Agron. Sin. 2017, 43, 1622–1631. [Google Scholar] [CrossRef]
- Ma, J. Fine Mapping of the Blast Resistance Gene Pimh(t) and Detection of Major QTLs in Rice Elite Restorer Line Minghu63. Master’s Thesis, Nanjing Agricultural University, Nanjing, China, 2010. [Google Scholar]
- Shi, K. Fine Mapping of a Novel Blast Resistance Gene Pimh(t) in an Elite Restorer Line Minghu63. Master’s Thesis, Chinese Academy of Agricultural Sciences, Beijing, China, 2008. [Google Scholar]
- Ellur, R.K.; Khanna, A.; Yadav, A.; Pathania, S.; Rajashekara, H.; Singh, V.K.; Krishnan, S.G.; Bhowmick, P.K.; Nagarajan, M.; Vinod, K.; et al. Improvement of Basmati rice varieties for resistance to blast and bacterial blight diseases using marker assisted backcross breeding. Plant Sci. 2016, 242, 330–341. [Google Scholar] [CrossRef] [Green Version]
- Neelam, K.; Mahajan, R.; Gupta, V.; Bhatia, D.; Gill, B.K.; Komal, R.; Lore, J.S.; Mangat, G.S.; Singh, K. High-resolution genetic mapping of a novel bacterial blight resistance gene xa-45(t) identified from Oryza glaberrima and transferred to Oryza sativa. Theor. Appl. Genet. 2019, 133, 689–705. [Google Scholar] [CrossRef] [PubMed]
- Angeles-Shim, R.B.; Shim, J.; Vinarao, R.B.; Lapis, R.S.; Singleton, J.J. A novel locus from the wild allotetraploid rice species Oryza latifolia Desv. confers bacterial blight (Xanthomonas oryzae pv. oryzae) resistance in rice (O. sativa). PLoS ONE 2020, 15, e0229155. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.; Zhang, X.; Fan, Y.; Gao, Y.; Zhu, Q.; Zheng, C.; Qin, T.; Li, Y.; Che, J.; Zhang, M.; et al. Xa23 is an executor R protein and confers broad-spectrum disease resistance in rice. Mol. Plant. 2015, 8, 290–302. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chukwu, S.C.; Rafii, M.Y.; Ramlee, S.I.; Ismail, S.I.; Hasan, M.M.; Oladosu, Y.A.; Magaji, U.G.; Akos, I.; Olalekan, K.K. Bacterial leaf blight resistance in rice: A review of conventional breeding to molecular approach. Mol. Biol. Rep. 2019, 46, 1519–1532. [Google Scholar] [CrossRef]
- Zhou, Y.-L.; Xu, J.-L.; Zhou, S.-C.; Yu, J.; Xie, X.-W.; Xu, M.-R.; Sun, Y.; Zhu, L.-H.; Fu, B.-Y.; Gao, Y.-M.; et al. Pyramiding Xa23 and Rxo1 for resistance to two bacterial diseases into an elite indica rice variety using molecular approaches. Mol. Breed. 2008, 23, 279–287. [Google Scholar] [CrossRef]
- Wang, S.; Liu, W.; Lu, D.; Lu, Z.; Wang, X.; Xue, J.; He, X. Distribution of bacterial blight resistance genes in the main cultivars and application of Xa23 in rce breeding. Front. Plant Sci. 2020, 11, 555228. [Google Scholar] [CrossRef]
- Xu, P.; Ye, S.T.; Mou, T.M. Improvement of Blast, Bacterial blight and brown planthopper resistance of rice restorer line R1813 by molecular marker-assisted selection. Hybrid Rice 2019, 34, 62–69. [Google Scholar]
- Wettewa, W.H.; Kottearahchi, N.S. Sequence analysis of the mutation in the 7th exon of badh2 gene in traditional aromatic rice varieties in Sri Lanka. J. Agric. Sci.—Sri Lanka 2014, 9, 24. [Google Scholar] [CrossRef] [Green Version]
- Bradbury, L.M.T.; Fitzgerald, T.L.; Henry, R.J.; Jin, Q.; Waters, D.L.E. The gene for fragrance in rice. Plant Biotechnol. J. 2005, 3, 363–370. [Google Scholar] [CrossRef] [PubMed]
- He, Q.; Park, Y.-J. Discovery of a novel fragrant allele and development of functional markers for fragrance in rice. Mol. Breed. 2015, 35, 217. [Google Scholar] [CrossRef]
- Gouda, G.; Gupta, M.K.; Donde, R.; Mohapatra, T.; Vadde, R.; Behera, L. Marker-assisted selection for grain number and yield-related traits of rice (Oryza sativa L.). Physiol. Mol. Biol. Plants 2020, 26, 885–898. [Google Scholar] [CrossRef]
- Das, G.; Patra, J.K.; Baek, K.H. Insight into MAS: A molecular tool for development of stress resistant and quality of rice through gene stacking. Front. Plant Sci. 2017, 8, 985. [Google Scholar] [CrossRef] [Green Version]
- Fuchs, M. Pyramiding resistance-conferring gene sequences in crops. Curr. Opin. Virol. 2017, 26, 36–42. [Google Scholar] [CrossRef]
- Reinke, R.; Kim, S.-M.; Kim, B.-K. Developing japonica rice introgression lines with multiple resistance genes for brown planthopper, bacterial blight, rice blast, and rice stripe virus using molecular breeding. Mol. Genet. Genom. 2018, 293, 1565–1575. [Google Scholar] [CrossRef]
- Ramalingam, J.; Raveendra, C.; Savitha, P.; Vidya, V.; Chaithra, T.L.; Velprabakaran, S.; Saraswathi, R.; Ramanathan, A.; Pillai, M.P.A.; Arumugachamy, S.; et al. Gene Pyramiding for Achieving Enhanced Resistance to Bacterial Blight, Blast, and Sheath Blight Diseases in Rice. Front. Plant Sci. 2020, 11, 591457. [Google Scholar] [CrossRef]
- Li, Y.; Mo, Y.; Li, Z.; Yang, M.; Tang, L.; Cheng, L.; Qiu, Y. Characterization and application of a gall midge resistance gene (Gm6) from Oryza sativa ‘Kangwenqingzhan’. Theor. Appl. Genet. 2019, 133, 579–591. [Google Scholar] [CrossRef] [PubMed]
- Angeles-Shim, R.B.; Reyes, V.P.; del Valle, M.M.; Lapis, R.S.; Shim, J.; Sunohara, H.; Jena, K.K.; Ashikari, M.; Doi, K. Marker-Assisted Introgression of Quantitative Resistance Gene pi21 Confers Broad Spectrum Resistance to Rice Blast. Rice Sci. 2020, 27, 113–123. [Google Scholar] [CrossRef]
- Jiang, H.; Li, Z.; Liu, J.; Shen, Z.; Gao, G.; Zhang, Q.; He, Y. Development and evaluation of improved lines with broad-spectrum resistance to rice blast using nine resistance genes. Rice 2019, 12, 29. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Balachiranjeevi, C.H.; Naik, B.S.; Kumar, A.V.; Harika, G.; Swamy, M.H.K.; Hajira, S.; Kumar, D.T.; Anila, M.; Kale, R.R.; Yugender, A.; et al. Marker-assisted pyramiding of two major, broad-spectrum bacterial blight resistance genes, Xa21 and Xa33 into an elite maintainer line of rice, DRR17B. PLoS ONE 2018, 13, e0201271. [Google Scholar] [CrossRef] [Green Version]
- Hsu, Y.-C.; Chiu, C.-H.; Yap, R.; Tseng, Y.-C.; Wu, Y.-P. Pyramiding Bacterial Blight Resistance Genes in Tainung82 for Broad-Spectrum Resistance Using Marker-Assisted Selection. Int. J. Mol. Sci. 2020, 21, 1281. [Google Scholar] [CrossRef] [Green Version]
- Reyes, V.P.; Angeles-Shim, R.B.; Mendioro, M.S.; Manuel, M.; Lapis, R.S.; Shim, J.; Sunohara, H.; Nishiuchi, S.; Kikuta, M.; Makihara, D.; et al. Marker-Assisted Introgression and Stacking of Major QTLs Controlling Grain Number (Gn1a) and Number of Primary Branching (WFP) to NERICA Cultivars. Plants 2021, 10, 844. [Google Scholar] [CrossRef]
- Liu, C.; Ding, S.; Zhang, A.; Hong, K.; Jiang, H.; Yang, S.; Ruan, B.; Zhang, B.; Dong, G.; Guo, L.; et al. Development of nutritious rice with high zinc/selenium and low cadmium in grains through QTL pyramiding. J. Integr. Plant Biol. 2020, 62, 349–359. [Google Scholar] [CrossRef] [Green Version]
- Liang, P.; Wang, H.; Zhang, Q.; Zhou, K.; Li, M.; Li, R.; Xiang, S.; Zhang, T.; Ling, Y.; Yang, Z.; et al. Identifi-cation and pyramiding of QTLs for rice grain size based on short-wide grain CSSL-Z563 and fine-mapping of qGL3-2. Rice 2021, 14, 35. [Google Scholar] [CrossRef]
- Zeng, D.; Tian, Z.; Rao, Y.; Dong, G.; Yang, Y.; Huang, L.; Leng, Y.; Xu, J.; Sun, C.; Zhang, G.; et al. Rational design of high-yield and superior-quality rice. Nat. Plants 2017, 3, 17031. [Google Scholar] [CrossRef]
- Jairin, J.; Phengrat, K.; Teangdeerith, S.; Vanavichit, A.; Toojinda, T. Mapping of a broad-spectrum brown planthopper resistance gene, Bph3, on rice chromosome 6. Mol. Breed. 2006, 19, 35–44. [Google Scholar] [CrossRef]
- Tian, D.; Chen, Z.; Chen, Z.; Zhou, Y.; Wang, Z.; Wang, F.; Chen, S. Allele-specific marker-based assessment revealed that the rice blast resistance genes Pi2 and Pi9 have not been widely deployed in Chinese indica rice cultivars. Rice 2016, 9, 19. [Google Scholar] [CrossRef] [Green Version]
- Fjellstrom, R.; Conaway-Bormans, C.A.; McClung, A.M.; Marchetti, M.A.; Shank, A.R.; Park, W.D. Development of DNA Markers Suitable for Marker Assisted Selection of ThreePiGenes Conferring Resistance to MultiplePyricularia griseaPathotypes. Crop. Sci. 2004, 44, 1790–1798. [Google Scholar] [CrossRef] [Green Version]
- Wang, C.L.; Fan, Y.L.; Zheng, C.K.; Qin, T.F.; Zhang, X.P.; Zhao, K.J. High-resolution genetic mapping of rice bacterial blight resistance gene Xa23. Mol. Genet. Genom. 2014, 289, 745–753. [Google Scholar] [CrossRef]
- Piao, R.; Jin, Y.; Li, P.; Chen, M.; Meng, F.; Zhou, G.; Yan, Y. Analyses of Genetic Diversity and Badh2 Alleles of Aromatic Japonica Rice Germplasm Resources in Northern China. J. Jilin Agric. Univ. 2021, 43, 507–515. [Google Scholar] [CrossRef]
- Murray, M.G.; Thompson, W.F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 1980, 8, 4321–4326. [Google Scholar] [CrossRef] [Green Version]
- IRRI. Standard Evaluation System (SES) for Rice, 5th ed.; International Rice Research Institute: Manila, Philippines, 2013. [Google Scholar]
- Evasudevan, K.; Cruz, C.M.V.; Gruissem, W.; Bhullar, N.K. Large scale germplasm screening for identification of novel rice blast resistance sources. Front. Plant Sci. 2014, 5, 505. [Google Scholar] [CrossRef] [Green Version]
- Kauffman, H.E. An improved technique for evaluating resistance of rice varieties to Xanthomonas oryzae. Plant Dis. Rep. 1973, 57, 537–541. [Google Scholar]
- Sood, B.C.; Siddiq, E.A. A rapid technique for scent determination in rice. Indian J.Genet. Plant Breed. 1975, 38, 268–275. [Google Scholar]
- Dhulappanavar, C.V. Inheritance of scent in rice. Euphytica 1976, 25, 659–662. [Google Scholar] [CrossRef]
- Fukuoka, S.; Saka, N.; Mizukami, Y.; Koga, H.; Yamanouchi, U.; Yoshioka, Y.; Hayashi, N.; Ebana, K.; Mizobuchi, R.; Yano, M. Gene pyramiding enhances durable blast disease resistance in rice. Sci. Rep. 2015, 5, 7773. [Google Scholar] [CrossRef] [Green Version]
- Jiang, N.; Yan, J.; Liang, Y.; Shi, Y.; He, Z.; Wu, Y.; Zeng, Q.; Liu, X.; Peng, J. Resistance Genes and their Interactions with Bacterial Blight/Leaf Streak Pathogens (Xanthomonas oryzae) in Rice (Oryza sativa L.)—An Updated Review. Rice 2020, 13, 3. [Google Scholar] [CrossRef] [Green Version]
- Ji, Z.-J.; Yang, S.-D.; Zeng, Y.-X.; Liang, Y.; Yang, C.-D.; Qian, Q. Pyramiding blast, bacterial blight and brown planthopper resistance genes in rice restorer lines. J. Integr. Agric. 2016, 15, 1432–1440. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Jiang, W.; Liu, H.; Zeng, Y.; Du, B.; Zhu, L.; He, G.; Chen, R. Marker assisted pyramiding of Bph6 and Bph9 into elite restorer line 93–11 and development of functional marker for Bph9. Rice 2017, 10, 51. [Google Scholar] [CrossRef] [Green Version]
- Yadav, S.; Sandhu, N.; Majumder, R.R.; Dixit, S.; Kumar, S.; Singh, S.P.; Mandal, N.P.; Das, S.P.; Yadaw, R.B.; Singh, V.; et al. Epistatic interactions of major effect drought QTLs with genetic background loci determine grain yield of rice under drought stress. Sci. Rep. 2019, 9, 2616. [Google Scholar] [CrossRef] [Green Version]
- Yadav, S.; Sandhu, N.; Dixit, S.; Singh, V.K.; Catolos, M.; Mazumder, R.R.; Rahman, M.A.; Kumar, A. Genomics-assisted breeding for successful development of multiple-stress-tolerant, climate-smart rice for southern and southeastern Asia. Plant Genome 2021, 14, e20074. [Google Scholar] [CrossRef]
- Pandian, B.A.; Joel, J.; Nachimuthu, V.V.; Swaminathan, M.; Govintharaj, P.; Tannidi, S.; Sabariappan, R. Marker-aided selection and validation of various Pi gene combinations for rice blast resistance in elite rice variety ADT 43. J. Genet. 2018, 97, 945–952. [Google Scholar] [CrossRef]
- Xiao, N.; Wu, Y.; Pan, C.; Yu, L.; Chen, Y.; Liu, G.; Li, Y.; Zhang, X.; Wang, Z.; Dai, Z.; et al. Improving of Rice Blast Resistances in Japonica by Pyramiding Major R Genes. Front. Plant Sci. 2017, 7, 1918. [Google Scholar] [CrossRef] [Green Version]
- Sanchez, A.; Brar, D.; Huang, N.; Li, Z.; Khush, G. Sequence Tagged Site Marker-Assisted Selection for Three Bacterial Blight Resistance Genes in Rice. Crop. Sci. 2000, 40, 792–797. [Google Scholar] [CrossRef]
- Leung, H.; Raghavan, C.; Zhou, B.; Oliva, R.; Choi, I.R.; Lacorte, V.; Jubay, M.L.; Cruz, C.V.; Gregorio, G.; Singh, R.K.; et al. Allele mining and en-hanced genetic recombination for rice breeding. Rice 2015, 8, 34. [Google Scholar] [CrossRef] [Green Version]
Targeted Traits | Donor | Linked Gene | Markers | Primer Sequence | Annealing Temperature (°C) | Reference | |
---|---|---|---|---|---|---|---|
Forward | Reverse | ||||||
Brown plant hopper | Ptb33 | Bph3 | RM589 | ATCATGGTCGGTGGCTTAAC | CAGGTTCCAACCAGACACTG | 56 | [70] |
BPHR96 | Bph24 | HJ22 | CTATGTGGTCCCATTTCTTC | GTGTCGGTTCACATGCTCC | 56 | [15] | |
Blast | HZ | Pi2 | 9-Pro | TGATTATGTTTTTTATGTGGGG | ATTAGTGAGATCCATTGTTCC | 51 | [71] |
R1238 | Pi9 | ||||||
Pita | YL155/YL87 | AGCAGGTTATAAGCTAGGCC | CTACCAACAAGTTCATCAAA | 60 | [39] | ||
MH63 | Pimh | RM213 | ACAAGCAGATACTGACTGATGC | CTTCTTTGCATCCAGACTTCC | 55 | [43] | |
XYZ | Pib | Pibdom | GAACAATGCCCAAACTTGAGA | GGGTCCACATGTCAGTGAGC | 58 | [72] | |
Bacterial leaf blight | P59 | Xa23 | Lj74 | AAGCCATTTGATGAGCAACC | GGATCCATTTCAGCATAACCTT | 54 | [73] |
Aroma | MX B | badh2 | FMbadh2-E7 | GGTTGCATTTACTGGGAGTT | CAGTGAAACAGGCTGTCAAG | 54 | [74] |
YX B |
ILs | Cross Combination | Genes Recombined in Pyramided Lines | No. of Targeted Genes | Resistance Score | Aroma Trait | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Bph3 | Bph24 | Pi2 | Pi9 | Pita | Pib | Pimh | Xa23 | badh2 | BPH | Leaf Blast | Panicle Blast | BLB | ||||
IL1 * | HZ/(GH998///P59//BPHR96/Ptb33) | + | + | + | − | − | − | − | + | − | 4 | 3 (MR) | 2 (HR) | 3 (MR) | 1 (HR) | − |
IL2 | HZ/(GH998///P59//BPHR96/Ptb33) | + | + | + | − | − | − | − | + | − | 4 | 3 (MR) | 3 (MR) | 3 (MR) | 1 (HR) | − |
IL3 * | (GH998//XYZ/Ptb33)/(GH998/P59) | + | − | − | − | − | + | − | + | − | 3 | 3 (MR) | 3 (MR) | 3 (MR) | 1 (HR) | − |
IL4 | HZ/(MX B//XYZ/BPHR96) | − | + | + | − | − | + | − | − | + | 4 | 3 (MR) | 2 (HR) | 3 (MR) | 7 (MS) | + |
IL5 * | HZ/(MX B//XYZ/BPHR96) | − | + | + | - | − | + | − | − | + | 4 | 3 (MR) | 3 (MR) | 3 (MR) | 7 (MS) | + |
IL6 * | MX B//XYZ/BPHR96 | − | + | − | − | − | + | − | − | + | 3 | 3 (MR) | 3 (MR) | 3 (MR) | 7 (MS) | + |
IL7 * | HZ///MH63//R8/(GH998//BPHR96/Ptb33) | + | + | + | − | − | − | + | − | − | 4 | 3 (MR) | 2 (HR) | 1 (HR) | 5 (MS) | − |
IL8 * | (MH63/XYZ)//IR64/(R8///GH998//BPHR96/Ptb33) | + | + | − | − | − | + | + | − | − | 4 | 3 (MR) | 3 (MR) | 3 (MR) | 5 (MS) | − |
IL9 * | HZ///R8/(GH998//BPHR96/Ptb33) | + | + | + | − | − | − | − | − | − | 3 | 3 (MR) | 2 (HR) | 3 (MR) | 5 (MS) | − |
IL10 * | HZ//HZ/(R8///GH998//BPHR96/Ptb33) | + | + | + | − | − | − | − | − | − | 3 | 3 (MR) | 3 (MR) | 3 (MR) | 7 (MS) | − |
IL11 * | HZ//IR64/(R8///GH998//BPHR96/Ptb33) | + | + | + | − | − | − | − | − | − | 3 | 3 (MR) | 2 (HR) | 3 (MR) | 7 (MS) | − |
IL12 * | HZ/(GH998//BPHR96/Ptb33)//R8/(GH998//BPHR96/Ptb33) | + | + | + | − | − | − | − | − | − | 3 | 3 (MR) | 3 (MR) | 3 (MR) | 7 (MS) | − |
IL13 * | HZ///GH998//MH63/BPHR96 | - | + | + | - | − | − | + | − | − | 3 | 3 (MR) | 3 (MR) | 1 (HR) | 5 (MS) | − |
IL14 | GH998///GH998//GH998/(P59//BPHR96/Ptb33) | + | + | − | − | − | − | − | + | − | 3 | 3 (MR) | 9 (HS) | 9 (HS) | 1 (HR) | − |
IL15 | GH998///GH998//GH998/(P59//BPHR96/Ptb33) | + | + | − | − | - | - | − | + | − | 3 | 3 (MR) | 9 (HS) | 9 (HS) | 1 (HR) | − |
IL16 | GH998///GH998//GH998/(P59//BPHR96/Ptb33) | + | + | − | − | − | − | − | + | − | 3 | 3 (MR) | 8 (MS) | 9 (HS) | 1 (HR) | − |
IL17 | GH998///GH998//GH998/(P59//BPHR96/Ptb33) | + | + | − | − | − | − | − | + | − | 3 | 3 (MR) | 9 (HS) | 9 (HS) | 1 (HR) | − |
IL18 * | GH998///GH998//GH998/(P59//BPHR96/Ptb33) | + | + | − | − | − | − | − | + | − | 3 | 3 (MR) | 9 (HS) | 9 (HS) | 1 (HR) | − |
IL19 * | GH998/P59///GH998//BPHR96/Ptb33 | + | + | − | − | − | − | − | + | − | 3 | 3 (MR) | 8 (MS) | 9 (HS) | 1 (HR) | − |
IL20 * | HZ//R1238/(GH998/P59) | − | − | + | − | + | − | − | + | − | 3 | 7 (MS) | 2 (HR) | 1 (HR) | 1 (HR) | − |
IL21 * | R1238///YF B//GH998/P59 | − | − | − | + | + | − | − | + | − | 3 | 7 (MS) | 2 (HR) | 3 (MR) | 1 (HR) | − |
IL22 | R1238///YF B//GH998/P59 | − | − | − | + | + | − | − | + | − | 3 | 9 (HS) | 1 (HR) | 3 (MR) | 1 (HR) | − |
IL23 * | R1238//GH998/P59 | − | − | − | + | + | − | − | + | − | 3 | 9 (HS) | 1 (HR) | 3 (MR) | 1 (HR) | − |
IL24 | R1238//GH998/P59 | − | − | − | + | + | − | − | + | − | 3 | 7 (MS) | 2 (HR) | 1 (HR) | 1 (HR) | − |
IL25 | R1238//GH998/P59 | − | − | − | + | + | − | − | + | − | 3 | 7 (MS) | 2 (HR) | 1 (HR) | 1 (HR) | − |
IL26 | R1238//GH998/P59 | − | − | − | + | + | − | − | + | − | 3 | 9 (HS) | 2 (HR) | 3 (MR) | 1 (HR) | − |
IL27 * | HZ//MH63/XYZ | − | − | + | − | − | + | + | − | − | 3 | 7 (MS) | 1 (HR) | 1 (HR) | 5 (MS) | − |
IL28 | HZ//MH63/XYZ | − | − | + | − | − | + | + | − | − | 3 | 9 (HS) | 1 (HR) | 1 (HR) | 7 (MS) | − |
IL29 | HZ//MH63/XYZ | − | − | + | − | − | + | + | − | − | 3 | 9 (HS) | 1 (HR) | 1 (HR) | 5 (MS) | − |
IL30 | HZ//HZ/Ptb33 | + | − | + | − | − | − | − | − | − | 2 | 3 (MR) | 2 (HR) | 1 (HR) | 9 (HS) | − |
IL31 | YF B/(XYZ//MM B/BPHR96 | − | + | − | − | − | + | − | − | − | 2 | 3 (MR) | 3 (MR) | 3 (MR) | 9 (HS) | − |
IL32 | R8///(209B/GH998)//MH63/BPHR96 | − | + | − | − | − | − | + | − | − | 2 | 3 (MR) | 3 (MR) | 3 (MR) | 7 (MS) | − |
IL33 | R8///(YF B/GH998)//MH63/BPHR96 | − | + | − | − | − | − | + | − | − | 2 | 3 (MR) | 2 (HR) | 3 (MR) | 7 (MS) | − |
IL34 | MM B/P59//MM B/BPHR96 | − | + | − | − | − | − | − | + | − | 2 | 3 (MR) | 9 (HS) | 9 (HS) | 1 (HR) | − |
IL35 | MX B//MM B/BPHR96 | − | + | − | − | − | − | − | − | + | 2 | 3 (MR) | 9 (HS) | 9 (HS) | 9 (HS) | + |
IL36 | Qun B///MX B//MM B/BPHR96 | − | + | − | − | − | − | − | − | + | 2 | 3 (MR) | 8 (MS) | 9 (HS) | 7 (MS) | + |
IL37 | Qun B///MX B//MM B/BPHR96 | − | + | − | − | − | − | − | − | + | 2 | 3 (MR) | 9 (HS) | 9 (HS) | 9 (HS) | + |
IL38 | Qun B///MX B//MM B/BPHR96 | − | + | − | − | − | − | − | − | + | 2 | 3 (MR) | 8 (MS) | 9 (HS) | 7 (MS) | + |
IL39 | Qun B///MX B//MM B/BPHR96 | − | + | − | − | − | − | − | − | + | 2 | 3 (MR) | 9 (HS) | 9 (HS) | 5 (MS) | + |
IL40 | Qun B///MX B//MM B/BPHR96 | − | + | − | − | − | − | − | − | + | 2 | 3 (MR) | 9 (HS) | 9 (HS) | 9 (HS) | + |
IL41 | Qun B///MX B//MM B/BPHR96 | − | + | − | − | − | − | − | − | + | 2 | 3 (MR) | 9 (HS) | 9 (HS) | 7 (MS) | + |
IL42 | Qun B///MX B//MM B/BPHR96 | − | + | − | − | − | − | − | − | + | 2 | 3 (MR) | 8 (MS) | 9 (HS) | 7 (MS) | + |
IL43 | Qun B///MX B//MM B/BPHR96 | − | + | − | − | − | − | − | − | + | 2 | 3 (MR) | 9 (HS) | 9 (HS) | 5 (MS) | + |
IL44 | Qun B///MX B//MM B/BPHR96 | − | + | − | − | − | − | − | − | + | 2 | 3 (MR) | 9 (HS) | 9 (HS) | 5 (MS) | + |
IL45 | Qun B///MX B//MM B/BPHR96 | − | + | − | − | − | − | − | − | + | 2 | 3 (MR) | 8 (MS) | 9 (HS) | 9 (HS) | + |
IL46 | HZ/(GH998/P59) | − | − | + | − | − | − | − | + | − | 2 | 7 (MS) | 1 (HR) | 3 (MR) | 1 (HR) | − |
IL47 | HZ//HZ/(GH998/P59) | − | − | + | − | − | − | − | + | − | 2 | 7 (MS) | 2 (HR) | 3 (MR) | 1 (HR) | − |
IL48 | MH63/P59 | − | − | − | − | − | − | + | + | − | 2 | 9 (HS) | 2 (HR) | 1 (HR) | 1 (HR) | − |
IL49 | YX B/HZ | - | - | + | - | - | - | - | - | + | 2 | 7 (MS) | 3 (MR) | 3 (MR) | 7 (MS) | + |
IL50 | YX B//XYZ/MX B | − | − | − | − | − | + | − | − | + | 2 | 7 (MS) | 3 (MR) | 3 (MR) | 7 (MS) | + |
IL51 | (GH998//BPHR96/Ptb33)//R8/(GH998//BPHR96/Ptb33) | + | + | − | − | − | − | − | − | − | 2 | 3 (MR) | 9 (HS) | 9 (HS) | 7 (MS) | − |
IL52 | (GH998//BPHR96/Ptb33)//R8/(GH998//BPHR96/Ptb33) | + | + | − | − | − | − | − | − | − | 2 | 3 (MR) | 9 (HS) | 9 (HS) | 7 (MS) | − |
IL53 | (YF B/GH998)/(GH998//BPHR96/Ptb33) | + | + | − | − | − | − | − | − | − | 2 | 3 (MR) | 8 (MS) | 9 (HS) | 9 (HS) | − |
IL54 | (YF B/GH998)/(GH998//BPHR96/Ptb33) | + | + | − | − | − | − | − | − | − | 2 | 3 (MR) | 9 (HS) | 9 (HS) | 7 (MS) | − |
IL55 | IR64/(R8///GH998//BPHR96/Ptb33) | + | + | − | − | − | − | − | − | − | 2 | 3 (MR) | 9 (HS) | 9 (HS) | 7 (MS) | − |
IL56 | R8/(GH998//BPHR96/Ptb33) | + | + | − | − | − | − | − | − | − | 2 | 3 (MR) | 9 (HS) | 9 (HS) | 7 (MS) | − |
IL57 | HZ//IR64/(R8/R1238) | − | − | + | − | + | − | − | − | − | 2 | 9 (HS) | 3 (MR) | 1 (HR) | 9 (HS) | − |
IL58 | HZ/R1238 | − | − | + | − | + | − | − | − | − | 2 | 9 (HS) | 1 (HR) | 1 (HR) | 9 (HS) | − |
IL59 | (MH63/XYZ)/R553 | − | − | − | − | − | + | + | − | − | 2 | 9 (HS) | 3 (MR) | 3 (MR) | 5 (MS) | − |
IL60 | UF B//MM B/BPHR96 | − | + | − | − | − | − | − | − | − | 1 | 3 (MR) | 9 (HS) | 9 (HS) | 7 (MS) | − |
IL61 | YF B//MM B/BPHR96 | − | + | − | − | − | − | − | − | − | 1 | 3 (MR) | 9 (HS) | 9 (HS) | 7 (MS) | − |
IL62 | YF B//MM B/BPHR96 | − | + | − | − | − | − | − | − | − | 1 | 3 (MR) | 9 (HS) | 9 (HS) | 7 (MS) | − |
IL63 | YF B//MM B/BPHR96 | − | + | − | − | − | − | − | − | − | 1 | 3 (MR) | 8 (MS) | 9 (HS) | 9 (HS) | − |
IL64 | YF B//MM B/BPHR96 | − | + | − | − | − | − | − | − | − | 1 | 3 (MR) | 9 (HS) | 9 (HS) | 9 (HS) | − |
IL65 | YF B/(GH998/P59)//(GH998/P59) | − | − | − | − | − | − | − | + | − | 1 | 7 (MS) | 9 (HS) | 9 (HS) | 1 (HR) | − |
IL66 | YF B/(GH998/P59)//(GH998/P59) | − | − | − | − | − | − | − | + | − | 1 | 7 (MS) | 9 (HS) | 9 (HS) | 1 (HR) | − |
IL67 | YF B/(GH998/P59)//(GH998/P59) | − | − | − | − | − | − | − | + | − | 1 | 9 (HS) | 8 (MS) | 9 (HS) | 1 (HR) | − |
IL68 | YF B//GH998/P59 | − | − | − | − | − | − | − | + | − | 1 | 9 (HS) | 8 (MS) | 9 (HS) | 1 (HR) | − |
IL69 | YF B//GH998/P59 | − | − | − | − | − | − | − | + | − | 1 | 7 (MS) | 9 (HS) | 9 (HS) | 1 (HR) | − |
IL70 | YF B//GH998/P59 | − | − | − | − | − | − | − | + | − | 1 | 7 (MS) | 9 (HS) | 9 (HS) | 1 (HR) | − |
IL71 | YX B//MX B/ZZ B | − | − | − | − | − | − | − | − | + | 1 | 9 (HS) | 8 (MS) | 9 (HS) | 9 (HS) | + |
IL72 | YX B//MX B/ZZ B | − | − | − | − | − | − | − | − | + | 1 | 9 (HS) | 9 (HS) | 9 (HS) | 9 (HS) | + |
IL73 | YX B//YX B/HF B | − | − | − | − | − | − | − | − | + | 1 | 7 (MS) | 8 (MS) | 9 (HS) | 9 (HS) | + |
IL74 | YX B//YX B/ZZ B | − | − | − | − | − | − | − | − | + | 1 | 7 (MS) | 9 (HS) | 9 (HS) | 9 (HS) | + |
Ptb33 | BPH resistant control | 3 (MR) | 7 (MS) | 7 (MS) | 9 (HS) | − | ||||||||||
HZ | BL resistant control | 9 (HS) | 2 (HR) | 2 (HR) | 7 (MS) | − | ||||||||||
P59 | BLB resistant control | 7 (MS) | 7 (MS) | 7 (MS) | 1 (HR) | − | ||||||||||
TN1 | BPH-, blast- and BLB-susceptible control | 9 (HS) | 7 (MS) | 9 (HS) | 9 (HS) | − |
Generation | No. of Plants Evaluated | No. of Plants Selected | No. of Selected Plants Introgressed with a Different Number of Genes | |||
---|---|---|---|---|---|---|
1 Gene | 2 Genes | 3 Genes | 4 Genes | |||
F1 | 513 | 144 | 57 | 30 | 39 | 18 |
F2 | 6127 (from 144 families) | 272 | 91 | 84 | 66 | 31 |
F3 | 8109 (from 272 plant families) | 219 | 80 | 61 | 52 | 26 |
F4 | 2433 (from 219 plant families) | 185 | 78 | 53 | 39 | 15 |
F5 | 1891 (from 185 plant families) | 106 | 31 | 36 | 30 | 9 |
F6 | 1152 (from 106 plant families) | 74 | 15 | 30 | 23 | 6 |
F7 | 74 promising lines | - | 15 | 30 | 23 | 6 |
Line | Plant Height (cm) | Flag Leaf Length (cm) | Flag Leaf Width (cm) | Panicle Number per Plant | Seed Set Rate (%) | Grain Number per Panicle | 1000-Grain Weight (g) | Grain Weight per Plant (g) | Recipient Parents | |
---|---|---|---|---|---|---|---|---|---|---|
Ils | IL1 | 104.4 ± 1.60 | 36.6 ± 0.35 | 2.2 ± 0.02 | 6.5 ± 1.31 | 84.0 ± 1.32 | 220.2 ± 7.45 | 19.0 ± 0.14 | 25.1 ± 1.71 | HZ, GH998 |
IL3 | 106.4 ± 0.93 | 29.1 ± 0.62 | 1.8 ± 0.09 | 10.2 ± 1.41 | 82.2 ± 1.27 | 186.0 ± 6.22 | 25.3 ± 0.26 | 47.1 ± 2.83 | GH998, XYZ | |
IL5 | 103.6 ± 1.02 | 27.2 ± 0.39 | 1.5 ± 0.06 | 9.1 ± 1.29 | 83.1 ± 1.97 | 192.3 ± 5.06 | 21.7 ± 0.44 | 37.5 ± 1.84 | HZ, MXB, XYZ | |
IL6 | 98.7 ± 1.26 | 36.3 ± 0.96 | 2.2 ± 0.04 | 7.4 ± 0.51 | 80.0 ± 1.54 | 243.0 ± 8.02 | 20.3 ± 0.30 | 34.6 ± 3.01 | MXB, XYZ | |
IL7 | 126.6 ± 0.90 | 33.9 ± 0.78 | 2.5 ± 0.07 | 9.0 ± 1.32 | 80.4 ± 1.62 | 225.3 ± 5.67 | 21.1 ± 0.31 | 42.8 ± 1.10 | HZ, MH63,GH998 | |
IL8 | 111.4 ± 1.30 | 49.1 ± 0.49 | 1.9 ± 0.02 | 12.3 ± 1.25 | 84.2 ± 1.55 | 168.8 ± 7.19 | 18.8 ± 0.96 | 38.1 ± 2.38 | MH63, XYZ, GH998 | |
IL9 | 95.8 ± 1.94 | 37.8 ± 0.41 | 1.6 ± 0.09 | 9.3 ± 0.25 | 82.4 ± 1.83 | 216.6 ± 11.94 | 25.9 ± 0.49 | 50.5 ± 0.92 | HZ, GH998 | |
IL10 | 115.6 ± 0.44 | 41.1 ± 1.28 | 1.8 ± 0.04 | 13.8 ± 1.37 | 79.6 ± 2.02 | 158.8 ± 9.23 | 19.0 ± 0.21 | 42.2 ± 1.12 | HZ, GH998 | |
IL11 | 104.3 ± 1.49 | 43.3 ± 1.20 | 2.2 ± 0.07 | 10.9 ± 0.39 | 83.6 ± 1.09 | 178.0 ± 7.37 | 27.3 ± 0.27 | 53.5 ± 1.01 | HZ, GH998 | |
IL12 | 100.3 ± 2.55 | 31.6 ± 0.30 | 1.6 ± 0.05 | 9.1 ± 0.33 | 84.0 ± 2.26 | 190.0 ± 6.56 | 19.0 ± 0.31 | 32.5 ± 3.22 | HZ, GH998 | |
IL13 | 120.4 ± 1.27 | 41.6 ± 0.36 | 1.8 ± 0.06 | 11.0 ± 0.42 | 82.4 ± 1.91 | 176.3 ± 12.54 | 23.1 ± 0.43 | 44.8 ± 1.45 | HZ, GH998,MH63 | |
IL18 | 94.1 ± 2.12 | 33.3 ± 0.82 | 1.6 ± 0.03 | 8.6 ± 1.44 | 82.2 ± 1.37 | 204.5 ± 7.21 | 16.8 ± 1.18 | 30.8 ± 1.57 | GH998 | |
IL19 | 96.8 ± 0.52 | 32.9 ± 0.55 | 1.8 ± 0.06 | 8.7 ± 1.27 | 81.5 ± 1.88 | 210.0 ± 7.54 | 15.7 ± 0.52 | 29.7 ± 1.32 | GH998 | |
IL20 | 116.6 ± 0.78 | 45.7 ± 0.77 | 1.8 ± 0.09 | 12.4 ± 1.54 | 81.7 ± 1.63 | 166.6 ± 6.45 | 22.5 ± 0.22 | 45.0 ± 1.15 | HZ, GH998 | |
IL21 | 107.8 ± 2.59 | 44.7 ± 0.40 | 2.5 ± 0.08 | 10.0 ± 0.34 | 81.6 ± 1.48 | 184.2 ± 6.73 | 19.3 ± 1.20 | 35.6 ± 2.17 | YFB, GH998 | |
IL23 | 97.6 ± 1.09 | 28.7 ± 1.26 | 1.7 ± 0.03 | 12.2 ± 1.35 | 83.1 ± 2.20 | 186.8 ± 9.02 | 18.3 ± 0.37 | 41.0 ± 1.03 | GH998 | |
IL27 | 116.7 ± 2.03 | 45.1 ± 0.57 | 2.0 ± 0.04 | 9.4 ± 1.43 | 82.8 ± 1.67 | 182.9 ± 11.85 | 23.2 ± 0.50 | 38.2 ± 2.13 | HZ, MH63, XYZ | |
Recipients | HZ | 93.4 ± 0.39 | 38.0 ± 0.44 | 1.6 ± 0.04 | 9.8 ± 0.32 | 84.6 ± 1.20 | 168.7 ± 7.55 | 21.5 ± 0.72 | 36.3 ± 1.33 | - |
GH998 | 98.0 ± 0.49 | 36.8 ± 0.31 | 1.3 ± 0.03 | 12.6 ± 1.02 | 85.2 ± 1.52 | 162.9 ± 9.77 | 19.5 ± 0.41 | 41.3 ± 1.54 | - | |
MH63 | 97.6 ± 0.87 | 38.6 ± 1.10 | 2.1 ± 0.05 | 10.9 ± 0.35 | 83.5 ± 1.70 | 148.2 ± 6.09 | 24.5 ± 0.50 | 39.9 ± 0.69 | - | |
XYZ | 62.1 ± 0.41 | 32.4 ± 0.62 | 1.4 ± 0.07 | 12.0 ± 0.32 | 86.2 ± 1.50 | 142.8 ± 6.71 | 19.5 ± 0.39 | 33.4 ± 0.11 | - | |
YFB | 73.4 ± 0.97 | 46.7 ± 0.47 | 1.9 ± 0.06 | 5.0 ± 1.37 | 80.4 ± 2.15 | 298.7 ± 6.93 | 20.5 ± 0.63 | 30.6 ± 1.48 | - | |
MXB | 70.6 ± 0.73 | 36.1 ± 0.33 | 1.5 ± 0.03 | 9.9 ± 0.20 | 83.9 ± 1.29 | 167.5 ± 7.46 | 18.0 ± 0.22 | 30.2 ± 0.72 | - | |
MMB | 70.4 ± 1.20 | 16.4 ± 0.24 | 1.7 ± 0.04 | 9.3 ± 0.41 | 79.4 ± 1.44 | 172.6 ± 10.07 | 22.5 ± 0.46 | 35.0 ± 0.32 | - | |
ZZB | 72.2 ± 0.61 | 40.2 ± 1.25 | 1.3 ± 0.05 | 12.2 ± 1.31 | 82.4 ± 2.03 | 158.7 ± 6.12 | 18.0 ± 0.56 | 34.3 ± 1.12 | - | |
R553 | 96.2 ± 0.86 | 40.3 ± 0.31 | 1.7 ± 0.09 | 10.1 ± 1.28 | 80.6 ± 1.72 | 151.0 ± 6.72 | 23.5 ± 0.33 | 35.5 ± 0.23 | - | |
YXB | 73.5 ± 0.74 | 38.9 ± 0.81 | 1.3 ± 0.01 | 10.7 ± 0.28 | 84.0 ± 1.98 | 167.4 ± 7.89 | 17.5 ± 0.85 | 32.2 ± 1.57 | - | |
HFB | 63.5 ± 1.33 | 33.4 ± 0.98 | 2.0 ± 0.05 | 11.0 ± 1.33 | 82.0 ± 1.34 | 172.6 ± 7.33 | 21.0 ± 0.36 | 39.9 ± 1.90 | - |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, X.; Guo, X.; Ma, X.; Luo, L.; Fang, Y.; Zhao, N.; Han, Y.; Wei, Z.; Liu, F.; Qin, B.; et al. Development of New Rice (Oryza. sativa L.) Breeding Lines through Marker-Assisted Introgression and Pyramiding of Brown Planthopper, Blast, Bacterial Leaf Blight Resistance, and Aroma Genes. Agronomy 2021, 11, 2525. https://doi.org/10.3390/agronomy11122525
Wang X, Guo X, Ma X, Luo L, Fang Y, Zhao N, Han Y, Wei Z, Liu F, Qin B, et al. Development of New Rice (Oryza. sativa L.) Breeding Lines through Marker-Assisted Introgression and Pyramiding of Brown Planthopper, Blast, Bacterial Leaf Blight Resistance, and Aroma Genes. Agronomy. 2021; 11(12):2525. https://doi.org/10.3390/agronomy11122525
Chicago/Turabian StyleWang, Xuan, Xinying Guo, Xixi Ma, Liang Luo, Yaoyu Fang, Neng Zhao, Yue Han, Zheng Wei, Fang Liu, Baoxiang Qin, and et al. 2021. "Development of New Rice (Oryza. sativa L.) Breeding Lines through Marker-Assisted Introgression and Pyramiding of Brown Planthopper, Blast, Bacterial Leaf Blight Resistance, and Aroma Genes" Agronomy 11, no. 12: 2525. https://doi.org/10.3390/agronomy11122525