Characterization of Lebanese Germplasm of Snake Melon (Cucumis melo subsp. melo var. flexuosus) Using Morphological Traits and SSR Markers
Abstract
1. Introduction
2. Materials and Methods
2.1. Collection of Landraces
2.2. Morphological Characterization
2.3. DNA Isolation
2.4. SSR Analysis
2.5. Statistical Analysis
3. Results
3.1. General Status of Collected Accessions
3.2. Morphological Characterization
3.3. Principal Component Analysis
3.4. Genetic Similarity
3.5. Cluster Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Paris, H.S.; Amar, Z.; Lev, E. Medieval emergence of sweet melons, Cucumis melo (Cucurbitaceae). Ann. Bot. 2012, 110, 23–33. [Google Scholar] [CrossRef] [PubMed]
- Walters, T.W.; Thieret, J.W. The snake melon (Cucumis melo; Cucurbitaceae). Econ. Bot. 1993, 47, 99–100. [Google Scholar] [CrossRef]
- Pandey, S.; Dhillon, N.P.S.; Sureja, A.K.; Singh, D.; Malik, A.A. Hybridization for increased yield and nutritional content of snake melon (Cucumis melo L. var. flexuosus). Plant Genet. Resour. 2010, 8, 127–131. [Google Scholar] [CrossRef]
- Pitrat, M.; Hanelt, P.; Hammer, K. Some comments on intraspecific classification of cultivars of melon. Acta Hortic. 2010, 510, 29–36. [Google Scholar]
- Ilahy, R.; Tlili, I.; Chikh Rrouhou, H.; R’Him, T.; Homa, F.; Hdider, C.; Lenucci, M.S. Functional quality traits of snake melon (Cucumis melo var. flexuosus L.) fruits as affected by genotypic differences. J. Postharvest Technol. 2019, 7, 1–10. [Google Scholar]
- Pitrat, M. Melon. In Vegetables I; Springer: New York, NY, USA, 2008; pp. 283–315. [Google Scholar]
- Pitrat, M.; Chauvet, M.; Foury, C. Diversity, history and production of cultivated cucurbits. Acta Hortic. 1997, 492, 21–28. [Google Scholar] [CrossRef]
- Branca, F.; La Malfa, G. Traditional vegetables of Sicily. Chron. Hortic. 2008, 48, 20–25. [Google Scholar]
- Ali-Shtayeh, M.S.; Jamous, R.M.; Shtaya, M.J.; Mallah, O.B.; Eid, I.S.; Abu Zaitoun, S.Y. Morphological characterization of snake melon (Cucumis melo var. flexuosus) populations from Palestine. Genet. Resour. Crop Evol. 2015, 64, 7–22. [Google Scholar] [CrossRef]
- Zaitoun, S.Y.A.; Jamous, R.M.; Shtaya, M.J.; Mallah, O.B.; Eid, I.S.; Ali-Shtayeh, M.S. Characterizing Palestinian snake melon (Cucumis melo var. flexuosus) germplasm diversity and structure using SNP and DArTseq markers. BMC Plant Biol. 2018, 18, 246. [Google Scholar] [CrossRef]
- Escribano, S.; Lazaro, A.; Staub, J.E.; Pitrat, M. Genetic diversity of Spanish melons (Cucumis melo) of the Madrid provenance. Fazio G, Staub JE, Chung SM Development and characterization of PCR markers in cucumber (Cucumis sativus L.). J. Am. Soc. Hortic. Sci. 2008, 127, 545–557. [Google Scholar]
- Soltani, F.; Akashi, Y.; Kashi, A.; Zamani, Z.; Mostofi, Y.; Kato, K. Characterization of Iranian melon landraces of Cucumis melo L. Groups Flexuosus and Dudaim by analysis of morphological characters and random amplified polymorphic DNA. Breed. Sci. 2010, 60, 34–45. [Google Scholar] [CrossRef][Green Version]
- Abdel-Ghani, A.H.; Mahadeen, A. Genetic variation in snake Melon (Cucumis melo var. flexuosus) populations from Jordan using morphological traits and RAPDs. Jordan J. Agri. Sci. 2014, 10, 96–119. [Google Scholar]
- Solmaz, I.; Aras, V.; Unlu, H.; Sarı, N. Türkiyénin farklı bölgelerinden toplanan acur (Cucumis melo var. flexuosus) genotiplerinde karakterizasyon. In Proceedings of the Turkiye V. Sebze Tarimi Sempozyumu Bildirileri, Canakkale, Turkey, 21–24 September 2004; pp. 75–81. (In Turkish). [Google Scholar]
- Solmaz, I.; Kacar, Y.A.; Simsek, O.; Sari, N. Genetic characterization of Turkish snake melon (Cucumis melo L. subsp. melo flexuosus Group) accessions revealed by SSR markers. Biochem. Genet. 2016, 54, 534–543. [Google Scholar] [CrossRef] [PubMed]
- Tzitzikas, N.E.; Monforte, A.J.; Fatihi, A.; Kypriotakis, Z.; Iacovides, T.A.; Ioannides, I.M.; Kalaitzis, P. Genetic diversity and population structure of traditional Greek and Cypriot melon cultigens (Cucumis melo L.) based on simple sequence repeat variability. HortScience 2009, 44, 1820–1824. [Google Scholar] [CrossRef]
- Yousif, M.T.; Elamin, T.M.; Baraka, A.F.M.; El-Jack, A.A.; Ahmed, E.A. Variability and correlation among morphological, vegetative, fruit and yield parameters of snake melon (Cucumis melo var. flexuosus). Cucurbit Genet. Coop. Rep. 2010, 35, 33–34. [Google Scholar]
- Henane, I.; Slimane, R.B.; Jebari, H. SSR-based genetic diversity analysis of Tunisian varieties of melon (Cucumis melo L.) and Fakous (Cucumis melo var. flexuosus). Int. J. Adv. Res. 2010, 3, 727–734. [Google Scholar]
- Kacar, Y.A.; Simsek, O.; Solmaz, I.; Sari, N.; Mendi, Y.Y. Genetic diversity among melon accessions (Cucumis melo) from Turkey based on SSR markers. Genet. Mol. Res. 2012, 11, 622–4631. [Google Scholar] [CrossRef] [PubMed]
- Ning, X.; Xiong, L.; Wang, X.; Gao, X.; Zhang, Z.; Zhong, L.; Li, G. Genetic diversity among Chinese Hami melon and its relationship with melon germplasm of diverse origins revealed by microsatellite markers. Biochem. Syst. Ecol. 2014, 57, 432–438. [Google Scholar] [CrossRef]
- Chalak, L. National Strategy for Conservation and Management of Plant Genetic Resources for Food and Agriculture in Lebanon; Food and Agriculture Organization of the United Nations: Beirut, Lebanon, 2015; pp. 1–38. [Google Scholar]
- Lebanese Ministry of Agriculture. Available online: agriculture.gov.lb (accessed on 22 June 2020).
- Chalak, L. Proposed Regulations on Access and Benefit-sharing for Biological and Genetic Resources of Lebanon. In International Workshop on Access and Benefit-sharing for Genetic Resources for Food and Agriculture; Food and Agriculture Organization of the United Nations: Rome, Italy, 2016; pp. 86–98. [Google Scholar]
- Chalak, L.; Baydoun, S.A.; Jaradat, A.A. Genetic resources of fruit trees in the Fertile Crescent: A hotspot heritage. In International Symposium on Survey of Uses of Plant Genetic Resources to the Benefit of Local Populations; 1267; ISHS: Leuven, Belgium, 2017; pp. 77–84. [Google Scholar]
- International Plant Genetic Resources Institute (IPGRI). Descriptors for Melon (Cucumis melo L.); IPGRI: Rome, Italy, 2003; ISBN 92-9043-597-7. [Google Scholar]
- Stepansky, A.; Kovalski, I.; Perl-Treves, R. Intraspecific classification of melons (Cucumis melo L.) in view of their phenotypic and molecular variation. Plant Syst. Evol. 1999, 217, 313–333. [Google Scholar] [CrossRef]
- Danin-Poleg, Y.; Reis, N.; Tzuri, G.; Katzir, N. Development and characterization of microsatellite markers in Cucumis. Theor. Appl. Genet. 2001, 102, 61–72. [Google Scholar] [CrossRef]
- Gonzalo, M.J.; Oliver, M.; Garcia-Mas, J.; Monforte, A.; Dolcet-Sanjuan, R.; Katzir, N.; Arús, P. Development of a consensus map of melon (Cucumis melo L.) based on high-quality markers (RFLPs and SSRs) using F2 and double-haploid line populations. Theor. Appl. Genet. 2005, 110, 802–811. [Google Scholar] [CrossRef] [PubMed]
- Zhu, H.; Guo, L.; Song, P.; Luan, F.; Hu, J.; Sun, X.; Yang, L. Development of genome-wide SSR markers in melon with their cross-species transferability analysis and utilization in genetic diversity study. Mol. Breed. 2016, 36, 153. [Google Scholar] [CrossRef]
- Targońska, M.; Bolibok-Brągoszewska, H.; Rakoczy-Trojanowska, M. Assessment of genetic diversity in Secale cereale based on SSR markers. Plant Mol. Biol. Rep. 2016, 34, 37–51. [Google Scholar] [CrossRef]
- Branca, F.; Chiarenza, G.L.; Cavallaro, C.; Gu, H.; Zhao, Z.; Tribulato, A. Diversity of Sicilian broccoli (Brassica oleracea var. italica) and cauliflower (Brassica oleracea var. botrytis) landraces and their distinctive bio-morphological, antioxidant, and genetic traits. Genet. Resour. Crop Evol. 2018, 65, 485–502. [Google Scholar] [CrossRef]
- Zar, J.H. Biodiversity calculations based on the formulae developed by Hutcheson and others in. In Biostatistical Analysis, 3rd ed.; Prentice-Hall: Englewood Cliffs, NJ, USA, 1996. [Google Scholar]
- Hutchenson, K. A test for comparing diversities based on the Shannon formula. J. Theor. Biol. 1970, 29, 151–154. [Google Scholar] [CrossRef]
- Jaccard, P. Nouvelles sur la distribution florale. Bull. Soc. Vaud. Sci. Nat. 1908, 44, 223–270. [Google Scholar]
- Rohlf, F.J. NTSYS-PC, Numerical Taxonomy and Multivariate Analysis System; Version 2.11; Exeter Software: New York, NY, USA, 2000. [Google Scholar]
- Smith, J.S.C.; Chin, E.C.L.; Shu, H.; Smith, O.S.; Wall, S.J.; Senior, M.L.; Mitchel, S.E.; Kresorich, S.; Tiegle, J. An evaluation of the utility of SSR loci as molecular markers in maize (Zea mays L.): Comparisons with data from RFLPs and pedigree. Theor. Appl. Genet. 1997, 95, 163–173. [Google Scholar] [CrossRef]
- Trimech, R.; Zaouali, Y.; Boulila, A.; Chabchoub, L.; Ghezal, I.; Boussaid, M. Genetic variation in Tunisian melon (Cucumis melo L.) germplasm as assessed by morphological traits. Genet. Resour. Crop Evol. 2013, 60, 1621–1628. [Google Scholar] [CrossRef]
- Monforte, A.J.; Garcia-Mas, J.; Arus, P. Genetic variability in melon based on microsatellite variation. Plant Breed. 2003, 122, 153–157. [Google Scholar] [CrossRef]
- Martinez, P.F.; Pospisilova, J. Environmental Constraints in Protected Cultivation: Possibilities for New Growing Techniques and Crops. Biol. Plant. 1996, 38, 38. [Google Scholar]
- La Malfa, G.; Noto, G.; Branca, F.; Leonardi, C.; Romano, D. Optimization of Protected Cultivation by Introducing New Crops or by Modifying some Growing Techniques; Final report on activities carried out within in ECC Research Project 8001-CT-90-0015; University of Catania: Catania, Italy, 1996; pp. 1–11. [Google Scholar]
Code | VN 1 | Area | Province 2 | Source | Code | VN 1 | Area | Province 2 | Source |
---|---|---|---|---|---|---|---|---|---|
ML1 | Akhdar | Aley | ML | Store | SL36 | Akhdar | Bint Jbeil | SL | Store |
ML2 | Akhdar | Mecherfeh | ML | Farmer | SL37 | Abyad | Bint Jbeil | SL | Store |
ML3 | Abyad | Aley | ML | Store | SL38 | Akhdar | Saida | SL | Store |
ML4 | Abyad | Aley | ML | Store | ML39 | Abyad | Dekweneh | ML | Store |
B5 | Abyad | Kherbet Kanafar | B | Farmer | SL40 | Abyad | Tebnine | SL | Store |
B6 | Abyad | Terbol | B | Farmer | B41 | Abyad | Kaa | B | Farmer |
B7 | Abyad | Deir el Ahmar | B | Farmer | ML42 | Akhdar | Mrouj | ML | Store |
SL8 | Azrak | Tebnine | SL | Store | ML43 | Akhdar | Mrouj | ML | Store |
B9 | Abyad | Hermel | B | Farmer | NL44 | Akhdar | Aabrine | NL | Farmer |
B10 | Abyad | Hermel | B | Farmer | NL45 | Mdalaa | Kfifan | NL | Farmer |
B11 | Abyad | Jeb Jenin | B | Store | NL46 | Akhdar | Bechmezzine | NL | Farmer |
ML12 | Abyad | Jounieh | ML | Store | NL47 | Akhdar | Bechmezzine | NL | Farmer |
B13 | Abyad | Temnine el Foka | B | Farmer | NL48 | Akhdar | Bechmezzine | NL | Farmer |
B14 | Abyad | Hermel | B | Farmer | NL49 | Akhdar | Bteram | NL | Farmer |
SL15 | Akhdar | Houmin | SL | Farmer | NL50 | Akhdar | Amyoun | NL | Farmer |
SL16 | Abyad | Zefta | SL | Farmer | NL51 | Akhdar | Kfar Habou | NL | Store |
SL17 | Abyad | Khiyam | SL | Store | NL52 | Akhdar | Aalma | NL | Store |
B18 | Abyad | Baalbak | B | Farmer | ML53 | Akhdar | Baakleen | ML | Farmer |
ML19 | Chikawi | Jbeil | ML | Farmer | ML54 | Akhdar | Laqlouq | ML | Farmer |
ML20 | Akhdar | Jbeil | ML | Store | A55 | Abyad | Halba | A | Store |
NL21 | Akhdar | Bechmezzine | NL | Farmer | A56 | Abyad | Halba | A | Store |
SL22 | Abyad | Hasbaya | SL | Store | A57 | Hayye | Halba | A | Store |
SL23 | Abyad | Hasbaya | SL | Farmer | A58 | Akhdar | Borj | A | Farmer |
SL24 | Akhdar | Qlayaa | SL | Store | ML59 | Mshakal | Amchit | ML | Farmer |
B25 | Abyad | Rachaya | B | Store | A60 | Akhdar | Beino | A | Farmer |
B26 | Tawile | Saad Nayel | B | Farmer | B61 | Abyad | Hrbata | B | Store |
B27 | Abyad | Rachaya | B | Farmer | B62 | Abyad | Deir el Ahmar | B | Store |
B28 | Azrak | Rachaya | B | Store | B63 | Abyad | Nabi Othman | B | Store |
B29 | Abyad | Rachaya | B | Store | B64 | Abyad | Kaa | B | Store |
B30 | Abyad | Niha | B | Store | B65 | Abyad | Jabouleh | B | Farmer |
B31 | Abyad | Jeb Jenin | B | Store | B66 | Abyad | Labweh | B | Store |
B32 | Mshakal | Ghaze | B | Store | B67 | Abyad | Sariin | B | Farmer |
B33 | Abyad | Hosh el Harim | B | Store | A68 | Abyad | Qoubayat | A | Store |
B34 | Abyad | Sariin | B | Farmer | A69 | Abyad | Qoubayat | A | Store |
B35 | Abyad | Aanjar | B | Store | B70 | Abyad | Kab Elias | B | Store |
No | Trait Code | Trait and Descriptive Value | Reference |
---|---|---|---|
1 | ST | Sex type: 1 = monoecious; 2 = andromonoecious | [26] |
2 | PSEP | Pedicel separation from fruit: 1 = easy; 2 = hard | [25] |
3 | PLEN | Pedicel length: 1 ≤ 5.7 cm; 2 = 5.71–9 cm; 3 ≥ 9.01 cm | [25] |
4 | PC | Primary fruit skin color: 1 = white; 2 = green | [25] |
5 | SC | Secondary skin fruit color: 1 = white; 2 = green; 3 = dark green | [25] |
6 | PAT | Secondary skin color pattern: 1 = absent; 2 = striped | [25] |
7 | FSH | Fruit shape: 1 = elongate; 2 = semi curved; 3 = curved | [17] |
8 | FGLO | Fruit glossiness: 1 = dull; 2 = glossy | [25] |
9 | FTEX | Fruit texture: 1 = smooth; 2 = wrinkled; 3 = ribbed | [26] |
10 | FH | Fruit hair: 1 = absent; 2 = present | [25] |
11 | FHC | Fruit hair consistency: 1 = absent; 2 = few; 3 = many | [25] |
12 | FRIB | Fruit ribs appearance: 1 = absent; 2 = weak; 3 = strong | [17] |
13 | FRNO | Fruit number of ribs: 1 ≤ 13; 2 = 13–23; 3 ≥ 23 | [17] |
14 | FC | Fruit flesh color: 1 = white; 2 = green | [25] |
15 | FSWT | Fruit sweetness (Brix): 1 ≤ 4; 2 = 4.01–7.5; 3 ≥ 7.51 | [25] |
16 | FSZ | Fruit size: 1 ≤ 20 g; 2 = 20.01–40 g; 3 ≥ 40.01 g | [25] |
17 | FLEN | Fruit length/width ratio: 1 ≤ 6; 2 = 6.01–10.5; 3 ≥ 10.51 | [25] |
18 | SW | Seed weight: 1 ≤ 0.3 g; 2 = 0.31–0.45 g; 3 ≥ 0.46 g | [26] |
Trait | Min Value | s.d. | Mean | Max Value | CV% | Frequency of Distribution | H′ | ||
---|---|---|---|---|---|---|---|---|---|
Small | Medium | Large | |||||||
Pedicel length | 3.73 | 1.65 | 7.31 | 11.2 | 22.58 | 0.19 | 0.56 | 0.25 | 0.99 |
Fruit number of ribs | 14 | 4.88 | 18.24 | 25 | 26.80 | 0.10 | 0.84 | 0.05 | 0.51 |
Fruit sweetness | 2.5 | 1.67 | 5.781 | 10.5 | 29.05 | 0.13 | 0.71 | 0.15 | 0.80 |
Fruit size | 10.83 | 9.97 | 30.89 | 55.5 | 32.31 | 0.15 | 0.63 | 0.21 | 0.91 |
Fruit length/width ratio | 3.13 | 2.27 | 8.31 | 18.52 | 27.34 | 0.15 | 0.71 | 0.13 | 0.80 |
Seed weight | 0.15 | 0.07 | 0.366 | 0.61 | 21.19 | 0.16 | 0.66 | 0.16 | 0.88 |
Component 1 | Component 2 | Component 3 | |
---|---|---|---|
Explained proportion of variance (%) | 28.39 | 12.42 | 10.69 |
Cumulative proportion of variance (%) | 28.39 | 40.81 | 51.51 |
Traits | Eigenvectors | ||
Pedicel separation from fruit | 0.2910 | 0.1171 | −0.3832 |
Pedicel length | 0.3567 | 0.0542 | 0.3998 |
Primary fruit skin color | 0.6631 * | 0.0246 | 0.0432 |
Secondary fruit skin color | 0.5993 * | 0.1416 | 0.1692 |
Secondary skin color pattern | 0.7588 * | 0.0541 | 0.0347 |
Fruit shape | −0.0321 | 0.3429 | 0.6926 * |
Fruit hair | 0.8944 * | 0.1879 | 0.1046 |
Fruit hair consistency | 0.9142 * | 0.1458 | 0.0691 |
Fruit ribs appearance | −0.7467 * | 0.3932 | −0.0715 |
Number of ribs | −0.4288 | 0.2586 | 0.3954 |
Flesh color | 0.1603 | −0.5997 * | 0.2261 |
Fruit sweetness | −0.2974 | −0.1822 | 0.6126 * |
Fruit size | 0.1177 | 0.8438 * | 0.0340 |
Fruit length/width ratio | −0.0809 | 0.5125 * | −0.3574 |
Seed mass | 0.3997 | −0.2435 | −0.2325 |
Primer | Sequences | Size (bp) | Total Allele Number | Major Allele Frequency | PIC | Ref |
---|---|---|---|---|---|---|
CMCTT144 | CAAAAGGTTTCGATTGGTGGG AAATGGTGGGGGTTGAATAGG | 215, 195,192, 187, 183 | 5 | 0.68 | 0.29 | [27] |
GMAGN68 | GGAAGGAAATTAGCATGCAC GCCACTCTGTCTTTCTTCC | 192, 190, 187, 184, 180, 170, 168 | 7 | 0.51 | 0.37 | [28] |
GMGS2-3 | CTCTTTTGCATTATAATAATTAACC GGGGCCAACGAAATCCAGTCATAGA | 320, 315 | 2 | 0.95 | 0.06 | [28] |
GMAGN73 | ATCCAACTCGACCAAGAAAC CAGCTCTACAACAACATCTC | 82, 78, 72, 66, 63, 59 | 6 | 0.5 | 0.31 | [28] |
CMTCN9 | CCCCCATATTCATCAAAACT CTTCCTTTTTTTCACACCCT | 240, 225, 213, 209, 205 | 5 | 0.68 | 0.15 | [28] |
TJ24 | AAACACGGGCTTGAAGAAAA CCCAGAAGGTGAGAGAGACCT | 178, 170, 165, 160, 140, 137 | 6 | 0.56 | 0.24 | [28] |
CMTCN41 | CCCCAAGATTCGTATTAATC TGGTAGTAGAGATGATATAC | 80, 76, 73 | 3 | 0.79 | 0.34 | [28] |
CMAGN79 | CTTCACTAAAACTACAAGAG TTCCAACTTATTCATCCCAC | 192, 190, 173, 170, 165, 156, 152 | 6 | 0.47 | 0.69 | [28] |
CMTA134a | ACGTGCTTCAGTAAACATG CCGACATTGAAAACCAACTTC | 150, 146, 142, 138, 128, 125, 117, 105, 98, 90, 78 | 11 | 0.24 | 0.84 | [27] |
CMSSR08180 | TATGTCCTCTCTTGGTCGCC AGTCGATTGGCAAATTACCG | 340, 300, 298, 290 | 4 | 0.56 | 0.59 | [29] |
Total | - | - | 56 | - | - | - |
Mean | - | - | 5.6 | 0.59 | 0.38 | - |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Merheb, J.; Pawełkowicz, M.; Branca, F.; Bolibok-Brągoszewska, H.; Skarzyńska, A.; Pląder, W.; Chalak, L. Characterization of Lebanese Germplasm of Snake Melon (Cucumis melo subsp. melo var. flexuosus) Using Morphological Traits and SSR Markers. Agronomy 2020, 10, 1293. https://doi.org/10.3390/agronomy10091293
Merheb J, Pawełkowicz M, Branca F, Bolibok-Brągoszewska H, Skarzyńska A, Pląder W, Chalak L. Characterization of Lebanese Germplasm of Snake Melon (Cucumis melo subsp. melo var. flexuosus) Using Morphological Traits and SSR Markers. Agronomy. 2020; 10(9):1293. https://doi.org/10.3390/agronomy10091293
Chicago/Turabian StyleMerheb, Joe, Magdalena Pawełkowicz, Ferdinando Branca, Hanna Bolibok-Brągoszewska, Agnieszka Skarzyńska, Wojciech Pląder, and Lamis Chalak. 2020. "Characterization of Lebanese Germplasm of Snake Melon (Cucumis melo subsp. melo var. flexuosus) Using Morphological Traits and SSR Markers" Agronomy 10, no. 9: 1293. https://doi.org/10.3390/agronomy10091293
APA StyleMerheb, J., Pawełkowicz, M., Branca, F., Bolibok-Brągoszewska, H., Skarzyńska, A., Pląder, W., & Chalak, L. (2020). Characterization of Lebanese Germplasm of Snake Melon (Cucumis melo subsp. melo var. flexuosus) Using Morphological Traits and SSR Markers. Agronomy, 10(9), 1293. https://doi.org/10.3390/agronomy10091293