Identification and Characterization of MortaparibPlus—A Novel Triazole Derivative That Targets Mortalin-p53 Interaction and Inhibits Cancer-Cell Proliferation by Wild-Type p53-Dependent and -Independent Mechanisms
Abstract
:Simple Summary
Abstract
1. Introduction
2. Results
2.1. Identification of MortaparibPlus as a Novel Anticancer Small Molecule That Disrupts Mortalin-p53 Interaction
2.2. MortaparibPlus Caused Downregulation of Mortalin
2.3. MortaparibPlus Caused Apoptosis and Cell-Cycle Arrest in DLD-1 (p53S241F) and HCT116 (p53WT) Cells through p53-Dependent and -Independent Manners
2.4. MortaparibPlus Activated p21WAF1/CIP1 in a p53-Independent Manner
2.5. MortaparibPlus Impaired DNA-Damage-Repair Signalling through Multiple Modalities
3. Discussion
4. Materials and Methods
4.1. Cell Culture and Reagents
4.2. Library Screening
4.3. Drug Preparation and Treatment
4.4. Cytotoxicity/Growth-Inhibition Assay
4.5. PG13-luc and pWWP-luc Luciferase-Reporter Assays
4.6. Immunoblotting
4.7. Immunocytochemistry
4.8. Immunoprecipitation
4.9. Apoptosis Assay
4.10. Cell-Cycle Analysis
4.11. Trapping Assay
4.12. Alignment Analysis
4.13. RNA Extraction
4.14. Quantitative Real-Time Polymerase Chain Reaction
4.15. Bioinformatics Analysis
4.16. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
ATM | Ataxia telangiectasia mutated |
ATR | Ataxia telangiectasia and Rad3 related |
BAX | Bcl-2-associated X protein |
Bcl-xL | B-cell lymphoma-extra large |
BRCA1/2 | Breast cancer gene 1/gene 2 |
CDK4 | Cyclin-dependent kinase 4 |
CDKN1A | Cyclin-dependent kinase inhibitor 1A |
CIP1 | Cyclin-dependent kinase inhibitor 1 |
CO2 | Carbon dioxide |
ddH2O | Double-distilled H2O |
DNA | Deoxyribonucleic acid |
E2F1 | E2F transcription factor 1 |
EDTA | Ethylenediaminetetraacetic acid |
EMT | Epithelial to mesenchymal transition |
FDA | Food and Drug Administration |
GRP75 | Glucose-regulated protein 75 |
HEPES | 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid |
HSPA9 | Heat-shock protein family A (Hsp70) member 9 |
HT-29 | Human colorectal adenocarcinoma cell line |
IgG | Immunoglobulin G |
KCL | Potassium chloride |
kDa | Kilodaltons |
LoVo | Human colon adenocarcinoma cell line |
LS123 | Human colon adenocarcinoma cell line |
MES | 2-(N-morpholino) ethanesulfonic acid |
MgCl2 | Magnesium chloride |
MRC5 | Medical Research Council cell strain 5 lung fibroblast |
mM | Millimeter |
mRNA | Messenger RNA |
Mthsp70 | Mitochondrial 70-kDa heat-shock protein |
NaOH | Sodium hydroxide |
NP-40 | Nonidet P-40 |
PBS | Phosphate-buffered saline |
PCR | Polymerase chain reaction |
PUMA | p53 up-regulated modulator of apoptosis |
RCSB | Research Collaboratory for Structural Bioinformatics. |
RIPA | Radioimmunoprecipitation assay |
RNA | Ribonucleic acid |
RT-qPCR | Quantitative reverse transcription PCR |
shRNA | Short hairpin ribonucleic acid |
TIG3 | Tokyo Institute of Gerontology-3 lung fibroblast |
μM | Micromolar |
References
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: GLOBOCAN estimates of inci-dence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rawla, P.; Sunkara, T.; Barsouk, A. Epidemiology of colorectal cancer: Incidence, mortality, survival, and risk factors. Gastroenterol. Rev. 2019, 14, 89–103. [Google Scholar] [CrossRef] [PubMed]
- Mitchell, D.; Puckett, Y.; Nguyen, Q.N. Literature Review of Current Management of Colorectal Liver Metastasis. Cureus 2019, 11, e3940. [Google Scholar] [CrossRef] [PubMed]
- Van Cutsem, E.; Cervantes, A.; Adam, R.; Sobero, A.; Van Krieken, J.H.; Aderka, D.; Aranda Aguilas, E.; Bardelli, A.; Benson, A.; Bodoky, G. Faculty ESMO consensus guidelines for the management of patients with metastatic colorectal cancer. Ann. Oncol. 2018, 27, 1386–1422. [Google Scholar] [CrossRef]
- Yoshino, T.; Arnold, D.; Taniguchi, H.; Pentheroudakis, G.; Yamazaki, K.; Xu, R.-H.; Kim, T.; Ismail, F.; Tan, I.; Yeh, K.-H.; et al. Pan-Asian adapted ESMO consensus guidelines for the management of patients with metastatic colorectal cancer: A JSMO–ESMO initiative endorsed by CSCO, KACO, MOS, SSO and TOS. Ann. Oncol. 2017, 29, 44–70. [Google Scholar] [CrossRef]
- Alcindor, T.; Beauger, N. Oxaliplatin: A review in the era of molecularly targeted therapy. Curr. Oncol. 2011, 18, 18–25. [Google Scholar] [CrossRef] [Green Version]
- Moradi-Marjaneh, R.; Paseban, M.; Marjaneh, M.M. Hsp70 inhibitors: Implications for the treatment of colorectal cancer. IUBMB Life 2019, 71, 1834–1845. [Google Scholar] [CrossRef]
- Wadhwa, R.; Takano, S.; Kaur, K.; Deocaris, C.C.; Pereira-Smith, O.M.; Reddel, R.R.; Kaul, S.C. Upregulation of mortalin/mthsp70/Grp75 contributes to human carcinogenesis. Int. J. Cancer 2006, 118, 2973–2980. [Google Scholar] [CrossRef]
- Dundas, S.R.; Lawrie, L.C.; Rooney, P.H.; Murray, G.I. Mortalin is over-expressed by colorectal adenocarcinomas and correlates with poor survival. J. Pathol. 2005, 205, 74–81. [Google Scholar] [CrossRef]
- Deocaris, C.C.; Lu, W.-J.; Kaul, S.C.; Wadhwa, R. Druggability of mortalin for cancer and neuro-degenerative disorders. Curr. Pharm. Des. 2013, 19, 418–429. [Google Scholar] [CrossRef]
- Cheng, F.; Li, W.; Wang, X.; Zhou, Y.; Wu, Z.; Shen, J.; Tang, Y. Adverse Drug Events: Database Construction and in Silico Prediction. J. Chem. Inf. Model. 2013, 53, 744–752. [Google Scholar] [CrossRef] [PubMed]
- Black, J.D.; Rezvani, K. Heat Shock Protein 70s as Potential Molecular Targets for Colon Cancer Therapeutics. Curr. Med. Chem. 2016, 23, 3171–3188. [Google Scholar] [CrossRef]
- Yun, C.-O.; Bhargava, P.; Na, Y.; Lee, J.-S.; Ryu, J.; Kaul, S.C.; Wadhwa, R. Relevance of mortalin to cancer cell stemness and cancer therapy. Sci. Rep. 2017, 7, srep42016. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kaul, S.C.; Yaguchi, T.; Taira, K.; Reddel, R.R.; Wadhwa, R. Overexpressed mortalin (mot-2)/mthsp70/GRP75 and hTERT cooperate to extend the in vitro lifespan of human fibroblasts. Exp. Cell Res. 2003, 286, 96–101. [Google Scholar] [CrossRef]
- Kaul, S.C.; Duncan, E.L.; Englezou, A.; Takano, S.; Reddel, R.R.; Mitsui, Y.; Wadhwa, R. Malignant transformation of NIH3T3 cells by overexpression of mot-2 protein. Oncogene 1998, 17, 907–911. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wadhwa, R.; Taira, K.; Kaul, S.C. Mortalin: A potential candidate for biotechnology and biomedicine. Histol. Histopathol. 2002, 17, 1173–1177. [Google Scholar] [PubMed]
- Wadhwa, R.; Taira, K.; Kaul, S.C. An Hsp70 family chaperone, mortalin/mthsp70/PBP74/Grp75: What, when, and where? Cell Stress Chaperones. 2002, 7, 309–316. [Google Scholar] [CrossRef]
- Wadhwa, R.; Sugihara, T.; Hasan, K.; Taira, K.; Reddel, R.R.; Kaul, S.C. A Major Functional Difference between the Mouse and Human ARF Tumor Suppressor Proteins. J. Biol. Chem. 2002, 277, 36665–36670. [Google Scholar] [CrossRef] [Green Version]
- Ryu, J.; Kaul, Z.; Yoon, A.R.; Liu, Y.; Yaguchi, T.; Na, Y.; Ahn, H.M.; Gao, R.; Choi, I.K.; Yun, C.O.; et al. Identification and functional char-acterization of nuclear mortalin in human carcinogenesis. J. Biol. Chem. 2014, 289, 24832–24844. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hu, Y.; Yang, L.; Yang, Y.; Han, Y.; Wang, Y.; Liu, W.; Zuo, J. Oncogenic role of mortalin contributes to ovarian tumorigenesis by activating the MAPK-ERK pathway. J. Cell Mol. Med. 2016, 20, 2111–2121. [Google Scholar] [CrossRef]
- Wadhwa, R.; Takano, S.; Taira, K.; Kaul, S.C. Reduction in mortalin level by its antisense expression causes senescence-like growth arrest in human immortalized cells. J. Gene Med. 2004, 6, 439–444. [Google Scholar] [CrossRef]
- Lu, W.-J.; Lee, N.P.; Kaul, S.C.; Lan, F.; Poon, R.T.P.; Wadhwa, R.; Luk, J.M. Mortalin–p53 interaction in cancer cells is stress dependent and constitutes a selective target for cancer therapy. Cell Death Differ. 2011, 18, 1046–1056. [Google Scholar] [CrossRef] [Green Version]
- Lu, W.-J.; Lee, N.P.; Kaul, S.C.; Lan, F.; Poon, R.T.; Wadhwa, R.; Luk, J.M. Induction of mutant p53-dependent apoptosis in human hepatocellular carcinoma by targeting stress protein mortalin. Int. J. Cancer 2011, 129, 1806–1814. [Google Scholar] [CrossRef] [PubMed]
- Londono, C.; Osorio, C.; Gama, V.; Alzate, O. Mortalin, Apoptosis, and Neurodegeneration. Biomolecules 2012, 2, 143–164. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, J.; Liu, W.-B.; Jia, W.-D.; Xu, G.-L.; Ma, J.-L.; Huang, M.; Deng, Y.-R.; Li, J.-S. Overexpression of Mortalin in hepatocellular carcinoma and its relationship with angiogenesis and epithelial to mesenchymal transition. Int. J. Oncol. 2013, 44, 247–255. [Google Scholar] [CrossRef] [Green Version]
- Na, Y.; Kaul, S.C.; Ryu, J.; Lee, J.-S.; Ahn, H.M.; Kaul, Z.; Kalra, R.S.; Li, L.; Widodo, N.; Yun, C.-O.; et al. Stress Chaperone Mortalin Contributes to Epithelial-to-Mesenchymal Transition and Cancer Metastasis. Cancer Res. 2016, 76, 2754–2765. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, L.; Li, H.; Jiang, Y.; Zuo, J.; Liu, W. Inhibition of mortalin expression reverses cisplatin resistance and attenuates growth of ovarian cancer cells. Cancer Lett. 2013, 336, 213–221. [Google Scholar] [CrossRef] [PubMed]
- Zuckerman, V.; Wolyniec, K.; Sionov, R.V.; Haupt, S.; Haupt, Y. Tumour suppression by p53: The importance of apoptosis and cellular senescence. J. Pathol. 2009, 219, 3–15. [Google Scholar] [CrossRef] [PubMed]
- Broustas, C.G.; Lieberman, H.B. DNA Damage Response Genes and the Development of Cancer Metastasis. Radiat. Res. 2014, 181, 111–130. [Google Scholar] [CrossRef] [Green Version]
- Soares, J.; Raimundo, L.; Pereira, N.A.; Monteiro, Â.; Gomes, S.; Bessa, C.; Pereira, C.; Queiroz, G.; Bisio, A.; Fernandes, J.; et al. Reactivation of wild-type and mutant p53 by tryptophanolderived oxazoloisoindolinone SLMP53-1, a novel anticancer small-molecule. Oncotarget 2016, 7, 4326–4343. [Google Scholar] [CrossRef] [PubMed]
- Widodo, N.; Takagi, Y.; Shrestha, B.G.; Ishii, T.; Kaul, S.C.; Wadhwa, R. Selective killing of cancer cells by leaf extract of Ashwagandha: Components, activity and pathway analyses. Cancer Lett. 2008, 262, 37–47. [Google Scholar] [CrossRef]
- Wadhwa, R.; Sugihara, T.; Yoshida, A.; Nomura, H.; Reddel, R.R.; Simpson, R.; Maruta, H.; Kaul, S.C. Selective toxicity of MKT-077 to cancer cells is mediated by its binding to the hsp70 family protein mot-2 and reactivation of p53 function. Cancer Res. 2000, 60, 6818–6821. [Google Scholar]
- Lu, M.; Miller, P.; Lü, X. Restoring the tumour suppressive function of p53 as a parallel strategy in melanoma therapy. FEBS Lett. 2014, 588, 2616–2621. [Google Scholar] [CrossRef] [Green Version]
- Yoo, J.Y.; Ryu, J.; Gao, R.; Yaguchi, T.; Kaul, S.C.; Wadhwa, R.; Yun, C.-O. Tumor suppression by apoptotic and anti-angiogenic effects of mortalin-targeting adeno-oncolytic virus. J. Gene Med. 2010, 12, 586–595. [Google Scholar] [CrossRef]
- Sundar, D.; Yu, Y.; Katiyar, S.P.; Putri, J.F.; Dhanjal, J.K.; Wang, J.; Sari, A.N.; Kolettas, E.; Kaul, S.C.; Wadhwa, R. Wild type p53 function in p53Y220C mutant harboring cells by treatment with Ashwagandha derived anticancer withanolides: Bioinformatics and experimental evidence. J. Exp. Clin. Cancer Res. 2019, 38, 103. [Google Scholar] [CrossRef] [Green Version]
- Wadhwa, R.; Takano, S.; Robert, M.; Yoshida, A.; Nomura, H.; Reddel, R.R.; Mitsui, Y.; Kaul, S.C. Inactivation of Tumor Suppressor p53 by Mot-2, a hsp70 Family Member. J. Biol. Chem. 1998, 273, 29586–29591. [Google Scholar] [CrossRef] [Green Version]
- Kaul, S.C.; Duncan, E.; Sugihara, T.; Reddel, R.R.; Mitsui, Y.; Wadhwa, R. Structurally and Functionally Distinct Mouse Hsp70 Family Members Mot-1 and Mot-2 Proteins are Encoded by Two Alleles. DNA Res. 2000, 7, 229–231. [Google Scholar] [CrossRef] [Green Version]
- Kaul, S.C.; Takano, S.; Reddel, R.R.; Mitsui, Y.; Wadhwa, R. Transcriptional Inactivation of p53 by Deletions and Single Amino Acid Changes in Mouse mot-1 Protein. Biochem. Biophys. Res. Commun. 2000, 279, 602–606. [Google Scholar] [CrossRef] [PubMed]
- Yaguchi, T.; Aida, S.; Kaul, S.C.; Wadhwa, R. Involvement of mortalin in cellular senescence from the perspective of its mito-chondrial import, chaperone, and oxidative stress management functions. Ann. N. Y. Acad. Sci. 2007, 1100, 306–311. [Google Scholar] [CrossRef] [PubMed]
- Kaul, S.C.; Reddel, R.R.; Mitsui, Y.; Wadhwa, R. An N-terminal Region of Mot-2 Binds to p53 In Vitro. Neoplasia 2001, 3, 110–114. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kaul, S.C.; Aida, S.; Yaguchi, T.; Kaur, K.; Wadhwa, R. Activation of Wild Type p53 Function by Its Mortalin-binding, Cytoplasmically Localizing Carboxyl Terminus Peptides. J. Biol. Chem. 2005, 280, 39373–39379. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Grover, A.; Singh, R.; Shandilya, A.; Priyandoko, D.; Agrawal, V.; Bisaria, V.S.; Wadhwa, R.; Kaul, S.C.; Sundar, D. Ashwagandha Derived Withanone Targets TPX2-Aurora A Complex: Computational and Experimental Evidence to its Anticancer Activity. PLoS ONE 2012, 7, e30890. [Google Scholar] [CrossRef] [PubMed]
- Sari, A.N.; Bhargava, P.; Dhanjal, J.K.; Putri, J.F.; Radhakrishnan, N.; Shefrin, S.; Ishida, Y.; Terao, K.; Sundar, D.; Kaul, S.C.; et al. Combi-nation of Withaferin-A and CAPE Provides Superior Anticancer Potency: Bioinformatics and Experimental Evidence to Their Molecular Targets and Mechanism of Action. Cancers 2020, 12, 1160. [Google Scholar] [CrossRef] [PubMed]
- Garg, S.; Afzal, S.; Elwakeel, A.; Sharma, D.; Radhakrishnan, N.; Dhanjal, J.K.; Sundar, D.; Kaul, S.C.; Wadhwa, R. Marine Carotenoid Fucoxanthin Possesses Anti-Metastasis Activity: Molecular Evidence. Mar. Drugs 2019, 17, 338. [Google Scholar] [CrossRef] [Green Version]
- Putri, J.F.; Bhargava, P.; Dhanjal, J.K.; Yaguchi, T.; Sundar, D.; Kaul, S.C.; Wadhwa, R. Mortaparib, a novel dual inhibitor of mortalin and PARP1, is a potential drug candidate for ovarian and cervical cancers. J. Exp. Clin. Cancer Res. 2019, 38, 499. [Google Scholar] [CrossRef]
- Sun, S.; Osterman, M.D.; Li, M. Tissue specificity of DNA damage response and tumorigenesis. Cancer Biol Med 2019, 16, 396–414. [Google Scholar]
- Solier, S.; Zhang, Y.-W.; Ballestrero, A.; Pommier, Y.; Zoppoli, G. DNA Damage Response Pathways and Cell Cycle Checkpoints in Colorectal Cancer: Current Concepts and Future Perspectives for Targeted Treatment. Curr. Cancer Drug Targets 2012, 12, 356–371. [Google Scholar] [CrossRef]
- Mauri, G.; Arena, S.; Siena, S.; Bardelli, A.; Sartore-Bianchi, A. The DNA damage response pathway as a land of therapeutic op-portunities for colorectal cancer. Ann. Oncol. 2020, 31, 1135–1147. [Google Scholar] [CrossRef]
- Liu, F.W.; Tewari, K.S. New Targeted Agents in Gynecologic Cancers: Synthetic Lethality, Homologous Recombination Deficiency, and PARP Inhibitors. Curr. Treat. Opt. Oncol. 2016, 17, 1–15. [Google Scholar] [CrossRef] [Green Version]
- Weil, M.K.; Chen, A.P. PARP Inhibitor Treatment in Ovarian and Breast Cancer. Curr. Probl. Cancer 2011, 35, 7–50. [Google Scholar] [CrossRef] [Green Version]
- Murray-Zmijewski, F.; Lane, D.P.; Bourdon, J.C. p53/p63/p73 isoforms: An orchestra of isoforms to harmonise cell differentiation and response to stress. Cell Death Differ. 2006, 13, 962–972. [Google Scholar] [CrossRef]
- Levrero, M.; De Laurenzi, V.; Costanzo, A.; Gong, J.; Wang, J.Y.; Melino, G. The p53/p63/p73 family of transcription factors: Over-lapping and distinct functions. J. Cell Sci. 2000, 113, 1661–1670. [Google Scholar] [PubMed]
- Omar, A.; Kalra, R.S.; Putri, J.; Elwakeel, A.; Kaul, S.C.; Wadhwa, R. Soyasapogenol-A targets CARF and results in suppression of tumor growth and metastasis in p53 compromised cancer cells. Sci. Rep. 2020, 10, 6323. [Google Scholar] [CrossRef] [PubMed]
- Reilly, N.M.; Novara, L.; Di Nicolantonio, F.; Bardelli, A. Exploiting DNA repair defects in colorectal cancer. Mol. Oncol. 2019, 13, 681–700. [Google Scholar] [CrossRef] [Green Version]
- Papeo, G.; Posteri, H.; Borghi, D.; Busel, A.A.; Caprera, F.; Casale, E.; Ciomei, M.; Cirla, A.; Corti, E.; D’Anello, M.; et al. Discovery of 2-[1-(4,4-Difluorocyclohexyl)piperidin-4-yl]-6-fluoro-3-oxo-2,3-dihydro-1H-isoind ole-4-carboxamide (NMS-P118): A potent, orally available, and highly selective PARP-1 inhibitor for cancer therapy. J. Med. Chem. 2015, 58, 6875–6898. [Google Scholar] [CrossRef] [PubMed]
- Dawicki-McKenna, J.M.; Langelier, M.-F.; DeNizio, J.E.; Riccio, A.A.; Cao, C.D.; Karch, K.R.; McCauley, M.; Steffen, J.D.; Black, B.E.; Pascal, J.M. PARP-1 Activation Requires Local Unfolding of an Autoinhibitory Domain. Mol. Cell 2015, 60, 755–768. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Thorsell, A.G.; Ekblad, T.; Karlberg, T.; Low, M.; Pinto, A.F.; Tresaugues, L.; Moche, M.; Cohen, M.S.; Schuler, H. Structural basis for po-tency and promiscuity in Poly(ADP-ribose) polymerase (PARP) and tankyrase inhibitors. J. Med. Chem. 2017, 60, 1262–1271. [Google Scholar] [CrossRef] [PubMed]
- Alemasova, E.E.; Lavrik, O.I. Poly(ADP-ribosyl)ation by PARP1: Reaction mechanism and regulatory proteins. Nucleic Acids Res. 2019, 47, 3811–3827. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gibbs-Seymour, I.; Fontana, P.; Rack, J.G.M.; Ahel, I. HPF1/C4orf27 Is a PARP-1-Interacting Protein that Regulates PARP-1 ADP-Ribosylation Activity. Mol. Cell 2016, 62, 432–442. [Google Scholar] [CrossRef]
- Ahel, D.; Hořejší, Z.; Wiechens, N.; Polo, S.E.; Garcia-Wilson, E.; Ahel, I.; Flynn, H.; Skehel, M.; West, S.C.; Jackson, S.P.; et al. Poly(ADP-ribose)-Dependent Regulation of DNA Repair by the Chromatin Remodeling Enzyme ALC1. Science 2009, 325, 1240–1243. [Google Scholar] [CrossRef] [Green Version]
- Dekker, E.; Tanis, P.J.; Vleugels, J.L.A.; Kasi, P.M.; Wallace, M.B. Colorectal cancer. Lancet 2019, 394, 1467–1480. [Google Scholar] [CrossRef]
- Nguyen, H.T.; Duong, H. The molecular characteristics of colorectal cancer: Implications for diagnosis and therapy (Review). Oncol. Lett. 2018, 16, 9–18. [Google Scholar] [CrossRef] [Green Version]
- Saxena, N.; Katiyar, S.P.; Liu, Y.; Grover, A.; Gao, R.; Sundar, D.; Kaul, S.C.; Wadhwa, R. Molecular interactions of Bcl-2 and Bcl-xL with mortalin: Identification and functional characterization. Biosci. Rep. 2013, 33, e00073. [Google Scholar] [CrossRef] [PubMed]
- Saar Ray, M.; Moskovich, O.; Iosefson, O.; Fishelson, Z. Mortalin/Grp75 binds to complement C9 and plays a role in resistance to complement-dependent cytotoxicity. J. Biol. Chem. 2014, 289, 15014–15022. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, P.-K.; Hong, S.-K.; Chen, W.; Becker, A.E.; Gundry, R.L.; Lin, C.-W.; Shao, H.; Gestwicki, J.E.; Park, J.-I. Mortalin (HSPA9) facilitates BRAF-mutant tumor cell survival by suppressing ANT3-mediated mitochondrial membrane permeability. Sci. Signal. 2020, 13, eaay1478. [Google Scholar] [CrossRef] [Green Version]
- Wadhwa, R.; Colgin, L.; Yaguchi, T.; Taira, K.; Reddel, R.R.; Kaul, S.C. Rhodacyanine dye MKT-077 inhibits in vitro telomerase assay but has no detectable effects on telomerase activity in vivo. Cancer Res. 2002, 62, 4434–4438. [Google Scholar] [PubMed]
- Benbrook, D.M.; Nammalwar, B.; Long, A.; Matsumoto, H.; Singh, A.; Bunce, R.A.; Berlin, K.D. SHetA2 interference with mortalin binding to p66shc and p53 identified using drug-conjugated magnetic microspheres. Investig. New Drugs 2014, 32, 412–423. [Google Scholar] [CrossRef] [Green Version]
- Shiota, M.; Ikeda, Y.; Kaul, Z.; Itadani, J.; Kaul, S.C.; Wadhwa, R. Internalizing Antibody-Based Targeted Gene Delivery for Human Cancer Cells. Hum. Gene Ther. 2007, 18, 1153–1160. [Google Scholar] [CrossRef] [PubMed]
- Wadhwa, R.; Ando, H.; Kawasaki, H.; Taira, K.; Kaul, S.C. Targeting mortalin using conventional and RNA-helicase-coupled hammerhead ribozymes. EMBO Rep. 2003, 4, 595–601. [Google Scholar] [CrossRef] [Green Version]
- Jubran, R.; Kocsis, J.; Garam, N.; Maláti, É.; Gombos, T.; Barabás, L.; Gráf, L.; Prohászka, Z.; Fishelson, Z. Circulating mitochondrial stress 70 protein/mortalin and cytosolic Hsp70 in blood: Risk indicators in colorectal cancer. Int. J. Cancer 2017, 141, 2329–2335. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gestl, E.E.; Böttger, S.A. Cytoplasmic sequestration of the tumor suppressor p53 by a heat shock protein 70 family member, mortalin, in human colorectal adenocarcinoma cell lines. Biochem. Biophys. Res. Commun. 2012, 423, 411–416. [Google Scholar] [CrossRef] [PubMed]
- Wu, P.K.; Hong, S.K.; Veeranki, S.; Karkhanis, M.; Starenki, D.; Plaza, J.A.; Park, J. A Mortalin/HSPA9-Mediated Switch in Tu-mor-Suppressive Signaling of Raf/MEK/Extracellular Signal-Regulated Kinase. Mol. Cell Biol. 2013, 33, 4051–4067. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Soldani, C.; Scovassi, A.I. Poly(ADP-ribose) polymerase-1 cleavage during apoptosis: An update. Apoptosis 2002, 7, 321–328. [Google Scholar] [CrossRef] [PubMed]
No. | Buffer Name | Composition |
---|---|---|
I | Hypotonic buffer | 100 mM MES-NaOH pH 6.4, 1 mM EDTA, 0.5 mM MgCl2, 30% sucrose in Mili-Q H2O |
II | Buffer A | 50 mM HEPES-NaOH pH 7.5, 100 mM KCl, 2.5 mM MgCl2, 0.05% Triton X-100 |
III | Buffer B | 50 mM HEPES-NaOH pH 7.5, 250 mM KCl, 2.5 mM MgCl2, 0.05% Triton X-100 |
IV | Buffer C | 50 mM HEPES-NaOH pH 7.5, 500 mM KCl, 2.5 mM MgCl2, 0.1% Triton X-100 |
V | Buffer D | Buffer A, 5 mM CaCl2, Micrococcal protease inhibitor three-unit (Roche Diagnostic GmbH, Mannheim, Germany) |
Gene (Human) | Primer Sequence (5′-3′) |
---|---|
p53 forward | GTTCCGAGAGCTGAATGAGG |
p53 reverse | TCTGAGTCAGGCCCTTCTGT |
Mortalin forward | AGCTGGAATGGCCTTAGTCAT |
Mortalin reverse | CAGGAGTTGGTAGTACCCAAATC |
CDKN1A (p21WAF1/CIP1) forward | GAGGCCGGGATGAGTTGGGAGGAG |
CDKN1A (p21WAFI/CIP1) reverse | CAGCCGGCGTTTGGAGTGGTAGAA |
18S forward | CAGGGTTCGATTCCGTAGAG |
18S reverse | CCTCCAGTGGATCCTCGTTA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sari, A.N.; Elwakeel, A.; Dhanjal, J.K.; Kumar, V.; Sundar, D.; Kaul, S.C.; Wadhwa, R. Identification and Characterization of MortaparibPlus—A Novel Triazole Derivative That Targets Mortalin-p53 Interaction and Inhibits Cancer-Cell Proliferation by Wild-Type p53-Dependent and -Independent Mechanisms. Cancers 2021, 13, 835. https://doi.org/10.3390/cancers13040835
Sari AN, Elwakeel A, Dhanjal JK, Kumar V, Sundar D, Kaul SC, Wadhwa R. Identification and Characterization of MortaparibPlus—A Novel Triazole Derivative That Targets Mortalin-p53 Interaction and Inhibits Cancer-Cell Proliferation by Wild-Type p53-Dependent and -Independent Mechanisms. Cancers. 2021; 13(4):835. https://doi.org/10.3390/cancers13040835
Chicago/Turabian StyleSari, Anissa Nofita, Ahmed Elwakeel, Jaspreet Kaur Dhanjal, Vipul Kumar, Durai Sundar, Sunil C. Kaul, and Renu Wadhwa. 2021. "Identification and Characterization of MortaparibPlus—A Novel Triazole Derivative That Targets Mortalin-p53 Interaction and Inhibits Cancer-Cell Proliferation by Wild-Type p53-Dependent and -Independent Mechanisms" Cancers 13, no. 4: 835. https://doi.org/10.3390/cancers13040835