Breast Cancer Aptamers: Current Sensing Targets, Available Aptamers, and Their Evaluation for Clinical Use in Diagnostics
Abstract
:Simple Summary
Abstract
1. Introduction
2. Breast Cancer Biomarkers and Existing Aptamers
2.1. Alpha Estrogen Receptor
2.2. EpCAM
2.3. Nucleolin
3. Serum Markers
3.1. MUC1
3.2. Carbohydrate/Cancer Antigen 15-3 (CA 15-3)
3.3. Periostin
3.4. Carcinoembryonic Antigens (CEA)
3.5. HER2
3.6. HER2 Whole Protein
3.7. HER2 Peptide
3.8. HER2 Extracellular Domain
3.9. VEGF
3.10. Progesterone Receptors
4. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- DeSantis, C.E.; Bray, F.; Ferlay, J.; Lortet-Tieulent, J.; Anderson, B.O.; Jemal, A. International Variation in Female Breast Cancer Incidence and Mortality Rates. Cancer Epidemiol. Biomark. Prev. 2015, 24, 1495–1506. [Google Scholar] [CrossRef] [Green Version]
- Weigelt, B.; Geyer, F.C.; Reis-Filho, J.S. Histological types of breast cancer: How special are they? Mol. Oncol. 2010, 4, 192–208. [Google Scholar] [CrossRef] [Green Version]
- Feng, Y.; Spezia, M.; Huang, S.; Yuan, C.; Zeng, Z.; Zhang, L.; Ji, X.; Liu, W.; Huang, B.; Luo, W.; et al. Breast cancer development and progression: Risk factors, cancer stem cells, signaling pathways, genomics, and molecular pathogenesis. Genes Dis. 2018, 5, 77–106. [Google Scholar] [CrossRef]
- Scully, O.J.; Bay, B.-H.; Yip, G.; Yu, Y. Breast Cancer Metastasis. Cancer Genom. Proteom. 2012, 9, 311–320. [Google Scholar]
- Vieira, R.A.D.C.; Biller, G.; Uemura, G.; Ruiz, C.A.; Curado, M.P. Breast cancer screening in developing countries. Clinics 2017, 72, 244–253. [Google Scholar] [CrossRef]
- Myers, E.R.; Moorman, P.G.; Gierisch, J.M.; Havrilesky, L.J.; Grimm, L.; Ghate, S.V.; Davidson, B.; Mongtomery, R.C.; Crowley, M.J.; McCrory, D.C.; et al. Benefits and Harms of Breast Cancer Screening. JAMA 2015, 314, 1615–1634. [Google Scholar] [CrossRef] [PubMed]
- Tfayli, A.; Temraz, S.; Mrad, R.A.; Shamseddine, A. Breast Cancer in Low- and Middle-Income Countries: An Emerging and Challenging Epidemic. J. Oncol. 2010, 2010, 490631. [Google Scholar] [CrossRef]
- Momenimovahed, Z.; Salehiniya, H. Epidemiological characteristics of and risk factors for breast cancer in the world. Breast Cancer Targets Ther. 2019, 11, 151–164. [Google Scholar] [CrossRef] [Green Version]
- Harbeck, N.; Penault-Llorca, F.; Cortes, J.; Gnant, M.; Houssami, N.; Poortmans, P.; Ruddy, K.; Tsang, J.; Cardoso, F. Breast cancer. Nat. Rev. Dis. Prim. 2019, 5, 1–31. [Google Scholar] [CrossRef]
- Kudela, E.; Samec, M.; Kubatka, P.; Nachajova, M.; Laucekova, Z.; Liskova, A.; Dokus, K.; Biringer, K.; Simova, D.; Gabonova, E.; et al. Breast Cancer in Young Women: Status Quo and Advanced Disease Management by a Predictive, Preventive, and Personalized Approach. Cancers 2019, 11, 1791. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Desreux, J.A. Breast cancer screening in young women. Eur. J. Obstet. Gynecol. Reprod. Biol. 2018, 230, 208–211. [Google Scholar] [CrossRef]
- Watkins, E.J. Overview of breast cancer. J. Am. Acad. Physician Assist. 2019, 32, 13–17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nelson, H.D.; Pappas, M.; Cantor, A.; Griffin, J.; Daeges, M.; Humphrey, L. Harms of Breast Cancer Screening: Systematic Review to Update the 2009 U.S. Preventive Services Task Force Recommendation. Ann. Intern. Med. 2016, 164, 256–267. [Google Scholar] [CrossRef] [Green Version]
- Britt, K.L.; Cuzick, J.; Phillips, K.-A. Key steps for effective breast cancer prevention. Nat. Rev. Cancer 2020, 20, 1–20. [Google Scholar] [CrossRef] [PubMed]
- Ginsburg, O.; Yip, C.; Brooks, A.; Cabanes, A.; Caleffi, M.; Yataco, J.A.D.; Gyawali, B.; McCormack, V.; de Anderson, M.M.; Mehrotra, R.; et al. Breast cancer early detection: A phased approach to implementation. Cancer 2020, 126, 2379–2393. [Google Scholar] [CrossRef] [PubMed]
- Keefe, A.D.; Pai, S.; Ellington, A. Aptamers as therapeutics. Nat. Rev. Drug Discov. 2010, 9, 537–550. [Google Scholar] [CrossRef] [PubMed]
- Hong, P.; Li, W.; Li, J. Applications of Aptasensors in Clinical Diagnostics. Sensors 2012, 12, 1181–1193. [Google Scholar] [CrossRef]
- Díaz-Fernández, A.; Lorenzo-Gómez, R.; Miranda-Castro, R.; De-Los-Santos-Álvarez, N.; Lobo-Castañón, M.J. Electrochemical aptasensors for cancer diagnosis in biological fluids—A review. Anal. Chim. Acta 2020, 1124, 1–19. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.S.; Wang, F.; Ge, Y.; Lo, P.K. Recent Developments in Aptasensors for Diagnostic Applications. ACS Appl. Mater. Interfaces 2020, 13, 9329–9358. [Google Scholar] [CrossRef] [PubMed]
- Ashrafuzzaman, M. Aptamers as Both Drugs and Drug-Carriers. BioMed Res. Int. 2014, 2014, 697923. [Google Scholar] [CrossRef] [Green Version]
- Zhou, J.; Rossi, J. Aptamers as targeted therapeutics: Current potential and challenges. Nat. Rev. Drug Discov. 2016, 16, 181–202. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ilgu, M.; Fazlioglu, R.; Ozturk, M.; Ozsurekci, Y.; Nilsen-Hamilton, Y.O.A.M. Aptamers for Diagnostics with Applications for Infectious Diseases. In Recent Advances in Analytical Chemistry; IntechOpen: London, UK, 2019. [Google Scholar] [CrossRef] [Green Version]
- Li, Z.; Mohamed, M.A.; Mohan, A.M.V.; Zhu, Z.; Sharma, V.; Mishra, G.K.; Mishra, R.K. Application of Electrochemical Aptasensors toward Clinical Diagnostics, Food, and Environmental Monitoring: Review. Sensors 2019, 19, 5435. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Citartan, M.; Tang, T.-H. Recent developments of aptasensors expedient for point-of-care (POC) diagnostics. Talanta 2019, 199, 556–566. [Google Scholar] [CrossRef] [PubMed]
- Lao, Y.-H.; Phua, K.K.; Leong, K. Aptamer Nanomedicine for Cancer Therapeutics: Barriers and Potential for Translation. ACS Nano 2015, 9, 2235–2254. [Google Scholar] [CrossRef]
- Catuogno, S.; Esposito, C.L. Aptamer Cell-Based Selection: Overview and Advances. Biomedicines 2017, 5, 49. [Google Scholar] [CrossRef] [Green Version]
- Komarova, N.; Kuznetsov, A. Inside the Black Box: What Makes SELEX Better? Molcules 2019, 24, 3598. [Google Scholar] [CrossRef] [Green Version]
- Liu, Q.; Zhang, W.; Chen, S.; Zhuang, Z.; Zhang, Y.; Jiang, L.; Lin, J.S. SELEX tool: A novel and convenient gel-based diffusion method for monitoring of aptamer-target binding. J. Biol. Eng. 2020, 14, 1–13. [Google Scholar] [CrossRef]
- Zhang, Y.; Lai, B.S.; Juhas, M. Recent Advances in Aptamer Discovery and Applications. Molecules 2019, 24, 941. [Google Scholar] [CrossRef] [Green Version]
- Wu, X.; Shaikh, A.B.; Yu, Y.; Li, Y.; Ni, S.; Lu, A.; Zhang, G. Potential Diagnostic and Therapeutic Applications of Oligonucleotide Aptamers in Breast Cancer. Int. J. Mol. Sci. 2017, 18, 1851. [Google Scholar] [CrossRef] [Green Version]
- Kim, G.-E.; Lee, J.S.; Park, M.H.; Yoon, J.H. Epithelial periostin expression is correlated with poor survival in patients with invasive breast carcinoma. PLoS ONE 2017, 12, e0187635. [Google Scholar] [CrossRef]
- Trzpis, M.; McLaughlin, P.M.; de Leij, L.M.; Harmsen, M.C. Epithelial Cell Adhesion Molecule: More than a Carcinoma Marker and Adhesion Molecule. Am. J. Pathol. 2007, 171, 386–395. [Google Scholar] [CrossRef] [Green Version]
- Cimino, A.; Halushka, M.; Illei, P.; Wu, X.; Sukumar, S.; Argani, P. Epithelial cell adhesion molecule (EpCAM) is overexpressed in breast cancer metastases. Breast Cancer Res. Treat. 2009, 123, 701–708. [Google Scholar] [CrossRef] [Green Version]
- Siersbæk, R.D.; Kumar, S.; Carroll, J. Signaling pathways and steroid receptors modulating estrogen receptor α function in breast cancer. Genes Dev. 2018, 32, 1141–1154. [Google Scholar] [CrossRef] [Green Version]
- Paterni, I.; Granchi, C.; Katzenellenbogen, J.A.; Minutolo, F. Estrogen receptors alpha (ERα) and beta (ERβ): Subtype-selective ligands and clinical potential. Steroids 2014, 90, 13–29. [Google Scholar] [CrossRef] [Green Version]
- Nassa, G.; Giurato, G.; Salvati, A.; Gigantino, V.; Pecoraro, G.; Lamberti, J.; Rizzo, F.; Nyman, T.A.; Tarallo, R.; Weisz, A. The RNA-mediated estrogen receptor α interactome of hormone-dependent human breast cancer cell nuclei. Sci. Data 2019, 6, 1–8. [Google Scholar] [CrossRef] [Green Version]
- Zattarin, E.; Leporati, R.; Ligorio, F.; Lobefaro, R.; Vingiani, A.; Pruneri, G.; Vernieri, C. Hormone Receptor Loss in Breast Cancer: Molecular Mechanisms, Clinical Settings, and Therapeutic Implications. Cells 2020, 9, 2644. [Google Scholar] [CrossRef] [PubMed]
- Jeselsohn, R.; Yelensky, R.; Buchwalter, G.; Frampton, G.; Meric-Bernstam, F.; Gonzalez-Angulo, A.M.; Ferrer-Lozano, J.; Perez-Fidalgo, J.A.; Cristofanilli, M.; Gomez, H.; et al. Emergence of Constitutively Active Estrogen Receptor-α Mutations in Pretreated Advanced Estrogen Receptor–Positive Breast Cancer. Clin. Cancer Res. 2014, 20, 1757–1767. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ahirwar, R.; Vellarikkal, S.K.; Sett, A.; Sivasubbu, S.; Scaria, V.; Bora, U.; Borthakur, B.B.; Kataki, A.C.; Sharma, J.D.; Nahar, P. Aptamer-Assisted Detection of the Altered Expression of Estrogen Receptor Alpha in Human Breast Cancer. PLoS ONE 2016, 11, e0153001. [Google Scholar] [CrossRef]
- Xiang, D.; Zheng, C.; Zhou, S.-F.; Qiao, S.; Tran, P.; Pu, C.; Li, Y.; Kong, L.; Kouzani, A.Z.; Lin, J.; et al. Superior Performance of Aptamer in Tumor Penetration over Antibody: Implication of Aptamer-Based Theranostics in Solid Tumors. Theranostics 2015, 5, 1083–1097. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ahirwar, R.; Dalal, A.; Sharma, J.G.; Yadav, B.K.; Nahar, P.; Kumar, A.; Kumar, S. An aptasensor for rapid and sensitive detection of estrogen receptor alpha in human breast cancer. Biotechnol. Bioeng. 2018, 116, 227–233. [Google Scholar] [CrossRef] [Green Version]
- Gires, O.; Pan, M.; Schinke, H.; Canis, M.; Baeuerle, P.A. Expression and function of epithelial cell adhesion molecule EpCAM: Where are we after 40 years? Cancer Metastasis Rev. 2020, 39, 969–987. [Google Scholar] [CrossRef] [PubMed]
- Zeng, L.; Zeng, L.; Deng, X.; Deng, X.; Zhong, J.; Zhong, J.; Yuan, L.; Yuan, L.; Tao, X.; Tao, X.; et al. Prognostic value of biomarkers EpCAM and αB-crystallin associated with lymphatic metastasis in breast cancer by iTRAQ analysis. BMC Cancer 2019, 19, 831. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Politaki, E.; Agelaki, S.; Apostolaki, S.; Hatzidaki, D.; Strati, A.; Koinis, F.; Perraki, M.; Saloustrou, G.; Stoupis, G.; Kallergi, G.; et al. A Comparison of Three Methods for the Detection of Circulating Tumor Cells in Patients with Early and Metastatic Breast Cancer. Cell. Physiol. Biochem. 2017, 44, 594–606. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- De Wit, S.; Van Dalum, G.; Lenferink, A.T.M.; Tibbe, A.G.J.; Hiltermann, T.J.N.; Groen, H.J.M.; van Rijn, C.; Terstappen, L.W.M.M. The detection of EpCAM+ and EpCAM– circulating tumor cells. Sci. Rep. 2015, 5, 12270. [Google Scholar] [CrossRef] [Green Version]
- Shigdar, S.; Lin, J.; Yu, Y.; Pastuovic, M.; Wei, M.; Duan, W. RNA aptamer against a cancer stem cell marker epithelial cell adhesion molecule. Cancer Sci. 2011, 102, 991–998. [Google Scholar] [CrossRef] [Green Version]
- Song, Y.; Zhu, Z.; An, Y.; Zhang, W.; Zhang, H.; Liu, D.; Yu, C.; Duan, W.; Yang, C.J. Selection of DNA Aptamers against Epithelial Cell Adhesion Molecule for Cancer Cell Imaging and Circulating Tumor Cell Capture. Anal. Chem. 2013, 85, 4141–4149. [Google Scholar] [CrossRef]
- Subramanian, N.; Kanwar, J.R.; Kanwar, R.K.; Sreemanthula, J.; Biswas, J.; Khetan, V.; Krishnakumar, S. EpCAM Aptamer-siRNA Chimera Targets and Regress Epithelial Cancer. PLoS ONE 2015, 10, e0132407. [Google Scholar] [CrossRef] [Green Version]
- Pei, Y.; Ge, Y.; Zhang, X.; Li, Y. Cathodic photoelectrochemical aptasensor based on NiO/BiOI/Au NP composite sensitized with CdSe for determination of exosomes. Microchim. Acta 2021, 188, 51. [Google Scholar] [CrossRef]
- Zhu, L.; Yang, B.; Qian, K.; Qiao, L.; Liu, Y.; Liu, B. Sensitive electrochemical aptasensor for detecting EpCAM with silica nanoparticles and quantum dots for signal amplification. J. Electroanal. Chem. 2020, 856, 113655. [Google Scholar] [CrossRef]
- Chen, Q.; Hu, W.; Shang, B.; Wei, J.; Chen, L.; Guo, X.; Ran, F.; Chen, W.; Ding, X.; Xu, Y.; et al. Ultrasensitive amperometric aptasensor for the epithelial cell adhesion molecule by using target-driven toehold-mediated DNA recycling amplification. Microchim. Acta 2018, 185, 202. [Google Scholar] [CrossRef]
- Hashkavayi, A.B.; Cha, B.S.; Hwang, S.H.; Kim, J.; Park, K.S. Highly sensitive electrochemical detection of circulating EpCAM-positive tumor cells using a dual signal amplification strategy. Sens. Actuators B Chem. 2021, 343, 130087. [Google Scholar] [CrossRef]
- De Wit, S.; Manicone, M.; Rossi, E.; Lampignano, R.; Yang, L.; Zill, B.; Rengel-Puertas, A.; Ouhlen, M.; Crespo, M.; Berghuis, A.M.S.; et al. EpCAMhigh and EpCAMlow circulating tumor cells in metastatic prostate and breast cancer patients. Oncotarget 2018, 9, 35705–35716. [Google Scholar] [CrossRef] [Green Version]
- Tajrishi, M.M.; Tuteja, R.; Tuteja, N. Nucleolin: The Most Abundant Multifunctional Phosphoprotein of Nucleolus. Commun. Integr. Biol. 2011, 4, 267–275. [Google Scholar] [CrossRef] [Green Version]
- Chen, Z.; Xu, X. Roles of nucleolin. Saudi Med. J. 2016, 37, 1312–1318. [Google Scholar] [CrossRef]
- Lin, Q.; Ma, X.; Hu, S.; Li, R.; Wei, X.; Han, B.; Ma, Y.; Liu, P.; Pang, Y. Overexpression of Nucleolin is a Potential Prognostic Marker in Endometrial Carcinoma. Cancer Manag. Res. 2021, 13, 1955–1965. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.; Yu, X.; Chen, Z.; Yang, T.; Yang, D.; Liu, Q.; Du, K.; Li, B.; Wang, Z.; Li, S.; et al. Aptamer selection and applications for breast cancer diagnostics and therapy. J. Nanobiotechnol. 2017, 15, 81. [Google Scholar] [CrossRef]
- Shafiei, F.; Saberi, R.S.; Mehrgardi, M.A. A label-free electrochemical aptasensor for breast cancer cell detection based on a reduced graphene oxide-chitosan-gold nanoparticle composite. Bioelectrochemistry 2021, 140, 107807. [Google Scholar] [CrossRef]
- Motaghi, H.; Ziyaee, S.; Mehrgardi, M.A.; Kajani, A.A.; Bordbar, A.-K. Electrochemiluminescence detection of human breast cancer cells using aptamer modified bipolar electrode mounted into 3D printed microchannel. Biosens. Bioelectron. 2018, 118, 217–223. [Google Scholar] [CrossRef] [PubMed]
- Zhang, R.; Gu, Y.; Wang, Z.; Li, Y.; Fan, Q.; Jia, Y. Aptamer cell sensor based on porous graphene oxide decorated ion-selective-electrode: Double sensing platform for cell and ion. Biosens. Bioelectron. 2018, 117, 303–311. [Google Scholar] [CrossRef] [PubMed]
- Ireson, C.R.; Kelland, L.R. Discovery and development of anticancer aptamers. Mol. Cancer Ther. 2006, 5, 2957–2962. [Google Scholar] [CrossRef] [Green Version]
- Bates, P.J.; Reyes-Reyes, E.; Malik, M.T.; Murphy, E.M.; O’Toole, M.G.; Trent, J.O. G-quadruplex oligonucleotide AS1411 as a cancer-targeting agent: Uses and mechanisms. Biochim. Biophys. Acta BBA Gen. Subj. 2017, 1861, 1414–1428. [Google Scholar] [CrossRef]
- Hu, S.; Wang, Z.; Gu, Y.; Li, Y.; Jia, Y. Clinical available circulating tumor cell assay based on tetra(4-aminophenyl) porphyrin mediated reduced graphene oxide field effect transistor. Electrochim. Acta 2019, 313, 415–422. [Google Scholar] [CrossRef]
- Bahreyni, A.; Ramezani, M.; Alibolandi, M.; Hassanzadeh, P.; Abnous, K.; Taghdisi, S.M. High affinity of AS1411 toward copper; its application in a sensitive aptasensor for copper detection. Anal. Biochem. 2019, 575, 1–9. [Google Scholar] [CrossRef]
- Kufe, D.W. MUC1-C oncoprotein as a target in breast cancer: Activation of signaling pathways and therapeutic approaches. Oncogene 2012, 32, 1073–1081. [Google Scholar] [CrossRef] [Green Version]
- Jing, X.; Liang, H.; Hao, C.; Yang, X.; Cui, X. Overexpression of MUC1 predicts poor prognosis in patients with breast cancer. Oncol. Rep. 2018, 41, 801–810. [Google Scholar] [CrossRef]
- Apostolopoulos, V.; Stojanovska, L.; Gargosky, S.E. MUC1 (CD227): A multi-tasked molecule. Cell. Mol. Life Sci. 2015, 72, 4475–4500. [Google Scholar] [CrossRef] [PubMed]
- Ferreira, C.S.M.; Papamichael, K.; Guilbault, G.; Schwarzacher, T.; Gariepy, J.; Missailidis, S. DNA aptamers against the MUC1 tumour marker: Design of aptamer–antibody sandwich ELISA for the early diagnosis of epithelial tumours. Anal. Bioanal. Chem. 2007, 390, 1039–1050. [Google Scholar] [CrossRef] [PubMed]
- Ferreira, C.; Matthews, C.; Missailidis, S. DNA Aptamers That Bind to MUC1 Tumour Marker: Design and Characterization of MUC1-Binding Single-Stranded DNA Aptamers. Tumor Biol. 2006, 27, 289–301. [Google Scholar] [CrossRef] [PubMed]
- Hu, Y.; Duan, J.; Zhan, Q.; Wang, F.; Lu, X.; Yang, X.-D. Novel MUC1 Aptamer Selectively Delivers Cytotoxic Agent to Cancer Cells In Vitro. PLoS ONE 2012, 7, e31970. [Google Scholar] [CrossRef] [Green Version]
- Gupta, P.; Bharti, A.; Kaur, N.; Singh, S.; Prabhakar, N. An electrochemical aptasensor based on gold nanoparticles and graphene oxide doped poly(3,4-ethylenedioxythiophene) nanocomposite for detection of MUC1. J. Electroanal. Chem. 2018, 813, 102–108. [Google Scholar] [CrossRef]
- Bharti, A.; Rana, S.; Dahiya, D.; Agnihotri, N.; Prabhakar, N. An electrochemical aptasensor for analysis of MUC1 using gold platinum bimetallic nanoparticles deposited carboxylated graphene oxide. Anal. Chim. Acta 2020, 1097, 186–195. [Google Scholar] [CrossRef]
- Shao, Y.; Sun, X.; He, Y.; Liu, C.; Liu, H. Elevated Levels of Serum Tumor Markers CEA and CA15-3 Are Prognostic Parameters for Different Molecular Subtypes of Breast Cancer. PLoS ONE 2015, 10, e0133830. [Google Scholar] [CrossRef] [PubMed]
- Mudduwa, L.K.; Wijayaratne, G.B.; Peiris, H.H.; Gunasekera, S.N.; Abeysiriwardhana, D.; Liyanage, N. Elevated pre-surgical CA15-3: Does it predict the short-term disease-free survival of breast cancer patients without distant metastasis? Int. J. Women Health 2018, 10, 329–335. [Google Scholar] [CrossRef] [Green Version]
- Serdarevic, N. The Comparison Between Different Immunoassays for Serum Carbohydrate Antigen (CA 19-9) Concentration Measurement. Acta Inform. Med. 2018, 26, 235–239. [Google Scholar] [CrossRef]
- Li, X.; Dai, D.; Chen, B.; Tang, H.; Xie, X.; Wei, W. Clinicopathological and Prognostic Significance of Cancer Antigen 15-3 and Carcinoembryonic Antigen in Breast Cancer: A Meta-Analysis including 12,993 Patients. Dis. Mark. 2018, 2018, 9863092. [Google Scholar] [CrossRef] [Green Version]
- Agnihotri, N.P.; Dubey, S.; Bhide, M. Design and Characterization of DNA Aptamer for Breast Tumor Marker by an Advantageous Method. Int. J. Innov. Res. Sci. Eng. Technol. 2014, 3, 16642–16648. [Google Scholar] [CrossRef]
- Shekari, Z.; Zare, H.R.; Falahati, A. Dual assaying of breast cancer biomarkers by using a sandwich–type electrochemical aptasensor based on a gold nanoparticles–3D graphene hydrogel nanocomposite and redox probes labeled aptamers. Sens. Actuators B Chem. 2021, 332, 129515. [Google Scholar] [CrossRef]
- Gomes, R.S.; Moreira, F.; Fernandes, R.; Sales, M.G.F. Sensing CA 15-3 in point-of-care by electropolymerizing O-phenylenediamine (oPDA) on Au-screen printed electrodes. PLoS ONE 2018, 13, e0196656. [Google Scholar] [CrossRef] [PubMed]
- Hasanzadeh, M.; Tagi, S.; Solhi, E.; Mokhtarzadeh, A.; Shadjou, N.; Eftekhari, A.; Mahboob, S. An innovative immunosensor for ultrasensitive detection of breast cancer specific carbohydrate (CA 15-3) in unprocessed human plasma and MCF-7 breast cancer cell lysates using gold nanospear electrochemically assembled onto thiolated graphene quantum dots. Int. J. Biol. Macromol. 2018, 114, 1008–1017. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Zhang, G.; Li, J.; Tao, Q.; Tang, W. The Expression Analysis of Periostin in Human Breast Cancer. J. Surg. Res. 2010, 160, 102–106. [Google Scholar] [CrossRef] [PubMed]
- Oo, K.K.; Kamolhan, T.; Soni, A.; Thongchot, S.; Mitrpant, C.; O-Charoenrat, P.; Thuwajit, C.; Thuwajit, P. Development of an engineered peptide antagonist against periostin to overcome doxorubicin resistance in breast cancer. BMC Cancer 2021, 21, 65. [Google Scholar] [CrossRef]
- Rachner, T.D.; Göbel, A.; Hoffmann, O.; Erdmann, K.; Kasimir-Bauer, S.; Breining, D.; Kimmig, R.; Hofbauer, L.C.; Bittner, A.-K. High serum levels of periostin are associated with a poor survival in breast cancer. Breast Cancer Res. Treat. 2020, 180, 515–524. [Google Scholar] [CrossRef]
- Palme, S.; Christenson, R.H.; Jortani, S.A.; Ostlund, R.E.; Kolm, R.; Kopal, G.; Laubender, R.P. Multicenter evaluation of analytical characteristics of the Elecsys® Periostin immunoassay. Clin. Biochem. 2017, 50, 139–144. [Google Scholar] [CrossRef]
- Liu, G.-X.; Xi, H.-Q.; Sun, X.-Y.; Wei, B. Role of periostin and its antagonist PNDA-3 in gastric cancer metastasis. World J. Gastroenterol. 2015, 21, 2605–2613. [Google Scholar] [CrossRef]
- Lee, Y.J.; Kim, I.S.; Park, S.-A.; Kim, Y.; Lee, J.E.; Noh, D.-Y.; Kim, K.-T.; Ryu, S.H.; Suh, P.-G. Periostin-binding DNA Aptamer Inhibits Breast Cancer Growth and Metastasis. Mol. Ther. 2013, 21, 1004–1013. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, W.; Xu, X.; Tian, B.; Wang, Y.; Du, L.; Sun, T.; Shi, Y.; Zhao, X.; Jing, J. The diagnostic value of serum tumor markers CEA, CA19-9, CA125, CA15-3, and TPS in metastatic breast cancer. Clin. Chim. Acta 2017, 470, 51–55. [Google Scholar] [CrossRef]
- Kabel, A.M. Tumor markers of breast cancer: New prospectives. J. Oncol. Sci. 2017, 3, 5–11. [Google Scholar] [CrossRef]
- Wang, L.; Liu, B.; Yin, H.; Wei, J.; Qian, X.; Yu, L. Selection of DNA aptamer that specific binding human carcinoembryonic antigen in vitro. J. Nanjing Med. Univ. 2007, 21, 277–281. [Google Scholar] [CrossRef]
- Shu, H.; Wen, W.; Xiong, H.; Zhang, X.; Wang, S. Novel electrochemical aptamer biosensor based on gold nanoparticles signal amplification for the detection of carcinoembryonic antigen. Electrochem. Commun. 2013, 37, 15–19. [Google Scholar] [CrossRef]
- Xiang, W.; Lv, Q.; Shi, H.; Xie, B.; Gao, L. Aptamer-based biosensor for detecting carcinoembryonic antigen. Talanta 2020, 214, 120716. [Google Scholar] [CrossRef] [PubMed]
- Zhou, X.; Xue, S.; Jing, P.; Xu, W. A sensitive impedimetric platform biosensing protein: Insoluble precipitates based on the biocatalysis of manganese(III) meso-tetrakis (4-N-methylpyridiniumyl)-porphyrinin in HCR-assisted dsDNA. Biosens. Bioelectron. 2016, 86, 656–663. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.J.; Han, S.R.; Kim, N.Y.; Lee, S.; Jeong, J.; Lee, S. An RNA Aptamer That Binds Carcinoembryonic Antigen Inhibits Hepatic Metastasis of Colon Cancer Cells in Mice. Gastroenterology 2012, 143, 155–165. [Google Scholar] [CrossRef]
- Pan, Q.; Law, C.O.K.; Yung, M.M.H.; Han, K.C.; Pon, Y.L.; Lau, T.C.K. Novel RNA aptamers targeting gastrointestinal cancer biomarkers CEA, CA50 and CA72-4 with superior affinity and specificity. PLoS ONE 2018, 13, e0198980. [Google Scholar] [CrossRef] [Green Version]
- Melo, M.; Correa, C.R.; Cunha, P.D.S.; de Góes, A.M.; Gomes, D.; de Andrade, A.S.R. DNA aptamers selection for carcinoembryonic antigen (CEA). Bioorg. Med. Chem. Lett. 2020, 30, 127278. [Google Scholar] [CrossRef]
- Lee-Hoeflich, S.T.; Crocker, L.; Yao, E.; Pham, T.; Munroe, X.; Hoeflich, K.P.; Sliwkowski, M.X.; Stern, H.M. A Central Role for HER3 in HER2-Amplified Breast Cancer: Implications for Targeted Therapy. Cancer Res. 2008, 68, 5878–5887. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Poturnayová, A.; Dzubinová, L.; Buríková, M.; Bízik, J.; Hianik, T. Detection of Breast Cancer Cells Using Acoustics Aptasensor Specific to HER2 Receptors. Biosensors 2019, 9, 72. [Google Scholar] [CrossRef] [Green Version]
- Fehm, T.; Becker, S.; Duerr-Stoerzer, S.; Sotlar, K.; Mueller, V.; Wallwiener, D.; Lane, N.; Solomayer, E.; Uhr, J. Determination of HER2 status using both serum HER2 levels and circulating tumor cells in patients with recurrent breast cancer whose primary tumor was HER2 negative or of unknown HER2 status. Breast Cancer Res. 2007, 9, R74. [Google Scholar] [CrossRef] [Green Version]
- Şahin, S.; Caglayan, M.O.; Üstündağ, Z. Recent advances in aptamer-based sensors for breast cancer diagnosis: Special cases for nanomaterial-based VEGF, HER2, and MUC1 aptasensors. Microchim. Acta 2020, 187, 1–27. [Google Scholar] [CrossRef]
- Cesca, M.G.; Vian, L.; Cristóvão-Ferreira, S.; Pondé, N.; de Azambuja, E. HER2-positive advanced breast cancer treatment in 2020. Cancer Treat. Rev. 2020, 88, 102033. [Google Scholar] [CrossRef]
- Dieci, M.V.; Miglietta, F.; Griguolo, G.; Guarneri, V. Biomarkers for HER2-positive metastatic breast cancer: Beyond hormone receptors. Cancer Treat. Rev. 2020, 88, 102064. [Google Scholar] [CrossRef]
- Terrenato, I.; Pennacchia, I.; Buglioni, S.; Mottolese, M.; Arena, V. HER2 Status Determination. Medicine 2015, 94, e645. [Google Scholar] [CrossRef]
- Gijs, M.; Penner, G.; Blackler, G.B.; Impens, N.R.; Baatout, S.; Luxen, A.; Aerts, A.M. Improved Aptamers for the Diagnosis and Potential Treatment of HER2-Positive Cancer. Pharmaceuticals 2016, 9, 29. [Google Scholar] [CrossRef] [Green Version]
- Niazi, J.H.; Verma, S.K.; Niazi, S.; Qureshi, A. In vitro HER2 protein-induced affinity dissociation of carbon nanotube-wrapped anti-HER2 aptamers for HER2 protein detection. Analyst 2014, 140, 243–249. [Google Scholar] [CrossRef]
- Moosavian, S.A.; Jaafari, M.R.; Taghdisi, S.M.; Mosaffa, F.; Badiee, A.; Abnous, K. Development of RNA aptamers as molecular probes for HER2+ breast cancer study using cell-SELEX. Iran. J. Basic Med. Sci. 2015, 18, 576–586. [Google Scholar]
- Kim, M.Y.; Jeong, S. In Vitro Selection of RNA Aptamer and Specific Targeting of ErbB2 in Breast Cancer Cells. Nucleic Acid Ther. 2011, 21, 173–178. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, Z.; Duan, J.-H.; Song, Y.-M.; Ma, J.; Wang, F.-D.; Lu, X.; Yang, X.-D. Novel HER2 Aptamer Selectively Delivers Cytotoxic Drug to HER2-positive Breast Cancer Cells in Vitro. J. Transl. Med. 2012, 10, 148. [Google Scholar] [CrossRef] [Green Version]
- Hu, Y.; Duan, J.; Cao, B.; Zhang, L.; Lu, X.; Wang, F.; Yao, F.; Zhu, Z.; Yuan, W.; Wang, C.; et al. Selection of a novel DNA thioaptamer against HER2 structure. Clin. Transl. Oncol. 2015, 17, 647–656. [Google Scholar] [CrossRef] [PubMed]
- Zhu, G.; Zhang, H.; Jacobson, O.; Wang, Z.; Chen, H.; Yang, X.; Niu, G.; Chen, X. Combinatorial Screening of DNA Aptamers for Molecular Imaging of HER2 in Cancer. Bioconjug. Chem. 2017, 28, 1068–1075. [Google Scholar] [CrossRef] [PubMed]
- Sett, A.; Borthakur, B.B.; Bora, U. Selection of DNA aptamers for extra cellular domain of human epidermal growth factor receptor 2 to detect HER2 positive carcinomas. Clin. Transl. Oncol. 2017, 19, 976–988. [Google Scholar] [CrossRef]
- Carr, M.; Leadbeater, B.S.C.; Hassan, R.; Nelson, M.; Baldauf, S.L. Molecular phylogeny of choanoflagellates, the sister group to Metazoa. Proc. Natl. Acad. Sci. USA 2008, 105, 16641–16646. [Google Scholar] [CrossRef] [Green Version]
- Ferrara, N. VEGF as a Therapeutic Target in Cancer. Oncology 2005, 69, 11–16. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Yan, J.; Liu, B. Targeting VEGF/VEGFR to Modulate Antitumor Immunity. Front. Immunol. 2018, 9, 978. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Banys-Paluchowski, M.; Witzel, I.; Riethdorf, S.; Pantel, K.; Rack, B.; Janni, W.; Fasching, P.A.; Aktas, B.; Kasimir-Bauer, S.; Hartkopf, A.; et al. The clinical relevance of serum vascular endothelial growth factor (VEGF) in correlation to circulating tumor cells and other serum biomarkers in patients with metastatic breast cancer. Breast Cancer Res. Treat. 2018, 172, 93–104. [Google Scholar] [CrossRef]
- Konecny, G.E.; Meng, Y.G.; Untch, M.; Wang, H.-J.; Bauerfeind, I.; Epstein, M.; Stieber, P.; Vernes, J.-M.; Gutierrez, J.; Hong, K.; et al. Association between HER-2/neu and Vascular Endothelial Growth Factor Expression Predicts Clinical Outcome in Primary Breast Cancer Patients. Clin. Cancer Res. 2004, 10, 1706–1716. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nonaka, Y.; Sode, K.; Ikebukuro, K. Screening and Improvement of an Anti-VEGF DNA Aptamer. Molecules 2010, 15, 215–225. [Google Scholar] [CrossRef] [PubMed]
- Edwards, S.L.; Poongavanam, V.; Kanwar, J.R.; Roy, K.; Hillman, K.M.; Prasad, N.; Leth-Larsen, R.; Petersen, M.; Marušič, M.; Plavec, J.; et al. Targeting VEGF with LNA-stabilized G-rich oligonucleotide for efficient breast cancer inhibition. Chem. Commun. 2015, 51, 9499–9502. [Google Scholar] [CrossRef]
- Braasch, D.A.; Corey, D.R. Locked nucleic acid (LNA): Fine-tuning the recognition of DNA and RNA. Chem. Biol. 2001, 8, 1–7. [Google Scholar] [CrossRef] [Green Version]
- Trujillo, C.A.; A Nery, A.; Alves, J.M.; Martins, A.H.; Ulrich, H. Development of the anti-VEGF aptamer to a therapeutic agent for clinical ophthalmology. Clin. Ophthalmol. 2007, 1, 393–402. [Google Scholar]
- Burmeister, P.E.; Lewis, S.D.; Silva, R.F.; Preiss, J.R.; Horwitz, L.R.; Pendergrast, P.S.; McCauley, T.G.; Kurz, J.C.; Epstein, D.M.; Wilson, C.; et al. Direct In Vitro Selection of a 2′-O-Methyl Aptamer to VEGF. Chem. Biol. 2005, 12, 25–33. [Google Scholar] [CrossRef] [Green Version]
- Ng, E.W.M.; Shima, D.T.; Calias, P.; Cunningham, E.T., Jr.; Guyer, D.R.; Adamis, A.P. Pegaptanib, a targeted anti-VEGF aptamer for ocular vascular disease. Nat. Rev. Drug Discov. 2006, 5, 123–132. [Google Scholar] [CrossRef]
- Ruckman, J.; Green, L.S.; Beeson, J.; Waugh, S.; Gillette, W.L.; Henninger, D.D.; Claesson-Welsh, L.; Janjic, N. 2′-Fluoropyrimidine RNA-based Aptamers to the 165-Amino Acid Form of Vascular Endothelial Growth Factor (VEGF165). J. Biol. Chem. 1998, 273, 20556–20567. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Meirson, T.; Gil-Henn, H. Targeting invadopodia for blocking breast cancer metastasis. Drug Resist. Updat. 2018, 39, 1–17. [Google Scholar] [CrossRef]
- Wuellner, U.; Gavrilyuk, J.I.; Barbas, C.F. Expanding the Concept of Chemically Programmable Antibodies to RNA Aptamers: Chemically Programmed Biotherapeutics. Angew. Chem. Int. Ed. 2010, 49, 5934–5937. [Google Scholar] [CrossRef] [Green Version]
- Ni, S.; Shen, Z.; Zhang, P.; Liu, G. Enhanced performance of an electrochemical aptasensor for real-time detection of vascular endothelial growth factor (VEGF) by nanofabrication and ratiometric measurement. Anal. Chim. Acta 2020, 1121, 74–82. [Google Scholar] [CrossRef]
- Lee, J.; Tatsumi, A.; Tsukakoshi, K.; Wilson, E.D.; Abe, K.; Sode, K.; Ikebukuro, K. Application of a Glucose Dehydrogenase-Fused with Zinc Finger Protein to Label DNA Aptamers for the Electrochemical Detection of VEGF. Sensors 2020, 20, 3878. [Google Scholar] [CrossRef]
- Feng, Y.; Xiao, S.; Xiong, X.; Wang, H.; Kong, F.; Li, Y.; Zhang, Y.; Chen, L. An Impedimetric Aptasensor Based on a Novel Line-Pad-Line Electrode for the Determination of VEGF 165. Electroanalysis 2020, 32, 1843–1849. [Google Scholar] [CrossRef]
- Fu, X.-M.; Liu, Z.-J.; Cai, S.-X.; Zhao, Y.-P.; Wu, D.-Z.; Li, C.-Y.; Chen, J.-H. Electrochemical aptasensor for the detection of vascular endothelial growth factor (VEGF) based on DNA-templated Ag/Pt bimetallic nanoclusters. Chin. Chem. Lett. 2016, 27, 920–926. [Google Scholar] [CrossRef] [Green Version]
- Hefti, M.M.; Hu, R.; Knoblauch, N.W.; Collins, L.C.; Haibe-Kains, B.; Tamimi, R.M.; Beck, A.H. Estrogen receptor negative/progesterone receptor positive breast cancer is not a reproducible subtype. Breast Cancer Res. 2013, 15, R68. [Google Scholar] [CrossRef] [Green Version]
- Taneja, P.; Maglic, D.; Kai, F.; Zhu, S.; Kendig, R.D.; Elizabeth, A.F.; Inoue, K. Classical and Novel Prognostic Markers for Breast Cancer and their Clinical Significance. Clin. Med. Insights Oncol. 2010, 4. [Google Scholar] [CrossRef] [Green Version]
- Stein, C.A.; Castanotto, D. FDA-Approved Oligonucleotide Therapies in 2017. Mol. Ther. 2017, 25, 1069–1075. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kulabhusan, P.K.; Hussain, B.; Yüce, M. Current Perspectives on Aptamers as Diagnostic Tools and Therapeutic Agents. Pharmaceutics 2020, 12, 646. [Google Scholar] [CrossRef] [PubMed]
- Prante, M.; Segal, E.; Scheper, T.; Bahnemann, J.; Walter, J. Aptasensors for Point-Of-Care Detection of Small Molecules. Biosensor 2020, 10, 108. [Google Scholar] [CrossRef] [PubMed]
Target | Location | Characteristics | Benefits for Targeting | Challenges of Use |
---|---|---|---|---|
Alpha estrogen receptor | Mammary glands | Ligand-inducible transcription factor. | Found in 75% of breast cancers. Responsive to targeted hormone therapies. | Resistance to hormone therapy easily developed, proper identification critical to effective therapy. |
Mucin 1 | Expressed on circulating tumor cells | Transmembrane glycoprotein. | Indicator of cancer remission status. Large number of aptamers already exist. Overexpressed in 90% of breast cancers. | Overexpressed in multiple epithelial cancers, not exclusive to breast cancer. |
Vascular endothelial growth factor | Endothelial cells | Secreted glycoproteins. Angiogenic factor—stimulates the growth of new blood vessels. Immunosuppressive. | Predictive factor for overall survival and response to antiangiogenic treatment. | Overexpressed in multiple solid cancers as well as rheumatoid arthritis. Not exclusive to breast cancer and cancers. |
Periostin | Secreted into the tumor microenvironment | Multimodular protein. | Found overexpressed in up to 83% of invasive breast carcinoma patients [31]. | Positive correlation between periostin levels and age; currently no normal range established. |
Epithelial cell adhesion molecule | Trans- and intermembrane domains on epithelial and cancer cells [32] | Transmembrane glycoprotein. Responsible for cell adhesion, proliferation, and migration. | High expression on rapidly proliferating cells. Overexpression is seen in roughly 82% of metastatic breast cancers [33]. | Higher expression seen in metastatic cancers. Poor viability for early cancer detection, thus shifting focus to late-stage cancer monitoring and drug targeting. |
Nucleolin | Found primarily in the nucleolus | Phosphoprotein with RNA recognition motifs. | Predictive factor for multiple cancers, particularly potent prognostic factor for BC. | Expressed in multiple cancers, not specific to breast. High levels indicate poor outcomes for breast cancer but positive outcomes for other cancers. |
Cancer antigen 15-3 | Found in serum | Soluble product of the MUC-1 gene. | Can be used to distinguish bone metastasis from other types of metastases. Predictive factor for overall and disease-free survival. Indicator of metastatic potential in active treatment. | Current antibody-based sensors already exist with low LOD and short processing times. |
Carcinoembryonic Antigen | Secreted into the tumor microenvironment | Secreted glycoproteins. | Elevated levels are indicative of cancer progression or recurrence. | Traditionally not recommended for screening due to low specificity. |
Human epidermal growth factor 2 | Transmembrane protein found overexpressed on breast cancer cells. | Transmembrane glycoprotein found in both tissue and circulating tumor cells | Overexpressed in 20–25% of breast cancers. Concentration exceeding 15 ng/mL in blood indicates HER2-positive breast cancer. HER2+ breast cancer is a more aggressive molecular subtype. Many aptamers already available. | Relatively low levels of expression. |
Target | Aptamer Name | Sequence 5′→3′ | Association Constant (Ka) | Dissociation Constant (KD) | ΔG (kcal/mol) |
---|---|---|---|---|---|
Alpha estrogen receptor | ERaptD4 | ATACCAGCTTATTCAATTCGTTGCATTTAGGTGCATTACGGGGGTTATCCGCTCTCTCAGATAGTATGTGCAATCA | 1.55 ± 0.29 × 108 M−1 | N/A | N/A |
Mucin 1 | 5TR1 | GAAGTGAAAATGACAGAACACAACA | 0.20 × 107 M−1s−1 | 47.3 nM | N/A |
S2.2 | GCAGTTGATCCTTTGGATACCCTGG | 0.401 × 107 M−1s−1 | 0.135 nM | N/A | |
MA3 | AACCGCCCAAATCCCTAAGAGTCGGACTGCAACCTATGCTATCGTTGATGTCTGTCCAAGCAACACAGACACACTACACACGCACA | N/A | 38.3 nM | N/A | |
Vascular endothelial growth factor | Vap7 | ATACCAGTCTATTCAATTGCACTCTGTGGGGGTGGACGGGCCGGGTAGATAGTATGTGCAATCA | N/A | 1.0 nM (121) and 20 nM (165) | N/A |
V7t1 | TGTGGGGGTGGACGGGCCGGGTAGA | N/A | 1.1 nM (121) and 1.4 nM (165) | N/A | |
RNV66 | TGTGGGGGTGGACGGGCCGGGTAGA | N/A | N/A | −9.34 28:28 10.34 (lowest listed) | |
Pegaptanib | CGGAAUCAGUGAAUGCUUAUACAUCCG | N/A | 49 pM | N/A | |
ARC247 | CGAUAUGCAGUUUGAGAAGUCGCGCAUUCG | N/A | 2 nM | N/A | |
Periostin | PNDA-3 | ACGAGYYGYCGCAYGYGCGGYYCAGYCYGGYCCYYCAGCACCGYACAACAA *Y, Benzyl-d(U)TP | N/A | 1.07 nM | N/A |
Epithelial cell adhesion molecule | SYL3 | AGCGTCGAATACCACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTGCTAATGGAGCTCGTGGTCAG | N/A | 87 ± 17 nM (MDA-MB-231) and 185 ± 22 nM (Kato III) | N/A |
EpDT3 | GCGACUGGUUACCCGGUCG | N/A | 12.0 ± 6.5 nM | N/A | |
EpApt-siEp | GCUGGCCCAUUGGUCAGC | N/A | N/A | N/A | |
Nucleolin | AS1411 | TTTGGTGGTGGTGGTTGTGGTGGTGGTGG | N/A | N/A | N/A |
Cancer antigen 15-3 | Clone 2 | GAAGTGAATATGACAGATCACAACT | N/A | 45.47 ± 3.415 nM | N/A |
Clone 4 | TACTGCATGCAGACCACATCAACTT | N/A | 67.1 ± 3.289 nM | N/A | |
Clone 5 | CATACAATCAATCACCAGTGCGGTG | N/A | 81.56 ± 4.198 nM | N/A | |
Carcinoembryonic antigen | Wang et al. (2007) | N/A | N/A | N/A | N/A |
CEAAp1 | TTAACTTATTCGACCATA | N/A | N/A | N/A | |
Apta 3 | GGGGGGTGTATCGTTGACGAGTTGCGCGTGCGTCTCGTG | N/A | 60.4 ± 5.7 nM | −18.69 | |
Apta 5 | GGAGCTACGTTTAGCGAGTCCGACGCTCGGTGCCTCTTC | N/A | 37.8 ± 5.8 nM | −13.06 kcal/mol | |
Human epidermal growth factor 2 | HeA2_1 | ATTAAGAACCATCACTCTTCCAAATGGATATACGACTGGG | N/A | 28.9 nM | −7.82 kcal/mol |
HeA2_3 | TCTAAAAGGATTCTTCCCAAGGGGATCCAATTCAAACAGC | N/A | 6.2 nM | −9.27 kcal/mol | |
H2 | GGGCCGTCGAACACGAGCATGGTGCGTGGACCTAGGATGACCTGAGTACTGTCC | N/A | 270 nM | −6.69 kcal/mol | |
TSA14 | GCUGGAGCAUUUAUGGAUGAACCUUGGACGGAA | N/A | 133.9 ± 12.78 nM | −9.68 | |
SE15-8 | AAAATACCAAATAAGGAAGCAAGGCAGAACGGGGCCTACTGTGTATATCATC | N/A | 10 nM | N/A | |
SE15-8 (mini) | AGCCGCGAGGGGAGGGAUAGGGUAGGGCGCGGCU | N/A | 3.49 ± 1.3 × 10 nM | N/A | |
HB5 | AACCGCCCAAATCCCTAAGAGTCTGCACTTGTCATTTTGTATATGTATTTGGTTTTTGGCTCTCACAGACACACTACACACGCACA | N/A | 18.9 nM (peptide) and 316 nM (ECD) | N/A | |
HY6 | TGCCCGTGTCCCGAGGAGGTGCCCTATTTTGCTTGATTATCTCTAAGGGATTTGGGCGG | N/A | 183 nM (peptide) and 172 nM (ECD) | N/A | |
Heraptamer1 | ACACCACATCCGTCTTACTCCCCAATTACA | N/A | 5.1 ± 5.3 | N/A | |
Heraptamer2 | TCCACCTTTCCGTCTAACTCCCCACTTTAT | N/A | 23.7 ± 11.2 | N/A | |
ECD_Apt1 | CCGCAACCACGACCGAAAGACAACGCAATCTGACACGTGG | N/A | 6.33 ± 0.86 nM | −3.24 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Varty, K.; O’Brien, C.; Ignaszak, A. Breast Cancer Aptamers: Current Sensing Targets, Available Aptamers, and Their Evaluation for Clinical Use in Diagnostics. Cancers 2021, 13, 3984. https://doi.org/10.3390/cancers13163984
Varty K, O’Brien C, Ignaszak A. Breast Cancer Aptamers: Current Sensing Targets, Available Aptamers, and Their Evaluation for Clinical Use in Diagnostics. Cancers. 2021; 13(16):3984. https://doi.org/10.3390/cancers13163984
Chicago/Turabian StyleVarty, Kathleen, Connor O’Brien, and Anna Ignaszak. 2021. "Breast Cancer Aptamers: Current Sensing Targets, Available Aptamers, and Their Evaluation for Clinical Use in Diagnostics" Cancers 13, no. 16: 3984. https://doi.org/10.3390/cancers13163984
APA StyleVarty, K., O’Brien, C., & Ignaszak, A. (2021). Breast Cancer Aptamers: Current Sensing Targets, Available Aptamers, and Their Evaluation for Clinical Use in Diagnostics. Cancers, 13(16), 3984. https://doi.org/10.3390/cancers13163984