A 3D Heterotypic Breast Cancer Model Demonstrates a Role for Mesenchymal Stem Cells in Driving a Proliferative and Invasive Phenotype
Abstract
1. Introduction
2. Results
2.1. MSCs Promote Proliferation in MCF-7 Breast Cancer Cells in Spheroid Co-Cultures
2.2. MSCs Promote Invasion in Noninvasive BC Cell Line MCF-7
2.3. MSCs Induce Proliferation and Promote Invasion in Estrogen Receptor (ER)/Progesterone Receptor (PR)-Negative PDXs in Spheroid Co-Culture
2.4. MSCs Promote Nuclear Clearance of SnON and Promote β-Catenin Activation in MCF-7 in Spheroid Co-Culture
3. Discussion
4. Materials and Methods
4.1. Cell Culture Conditions
4.2. Patient-Derived Xenografts
4.3. Establishing Spheroid Mono and Co-Culture
4.4. Live/Dead Cell Staining in Spheroid Culture
4.5. AlamarBlue Assay
4.6. CellTrace Violet Assay
4.7. Spheroid Invasion Assay
4.8. Phalloidin Staining in Spheroid Mono and Co-Culture
4.9. RNA Extraction from FACS-Sorted MCF-7td Tomato in Spheroid Co-Culture and qRT-PCR
4.10. Preparation and Immunostaining (IHC and IF) Analysis of Spheroid Microarray
4.11. Image Analysis
4.12. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Martin, F.T.; Dwyer, R.M.; Kelly, J.; Khan, S.; Murphy, J.M.; Curran, C.; Miller, N.; Hennessy, E.; Dockery, P.; Barry, F.P.; et al. Potential role of mesenchymal stem cells (MSCs) in the breast tumour microenvironment: Stimulation of epithelial to mesenchymal transition (EMT). Breast Cancer Res. Treat. 2010, 124, 317–326. [Google Scholar] [CrossRef]
- Casey, T.; Bond, J.; Tighe, S.; Hunter, T.; Lintault, L.; Patel, O.; Eneman, J.; Crocker, A.; White, J.; Tessitore, J.; et al. Molecular signatures suggest a major role for stromal cells in development of invasive breast cancer. Breast Cancer Res. Treat. 2009, 114, 47–62. [Google Scholar] [CrossRef]
- Shimoda, M.; Mellody, K.T.; Orimo, A. Carcinoma-associated fibroblasts are a rate-limiting determinant for tumour progression. Semin. Cell Dev. Biol. 2010, 21, 19–25. [Google Scholar] [CrossRef]
- Balkwill, F.R.; Capasso, M.; Hagemann, T. The tumor microenvironment at a glance. J. Cell Sci. 2012, 125, 5591. [Google Scholar] [CrossRef]
- Soysal, S.D.; Tzankov, A.; Muenst, S.E. Role of the Tumor Microenvironment in Breast Cancer. Pathobiology 2015, 82, 142–152. [Google Scholar] [CrossRef]
- LeBleu, V.S.; Kalluri, R. A peek into cancer-associated fibroblasts: Origins, functions and translational impact. Dis. Models Mech. 2018, 11, dmm029447. [Google Scholar] [CrossRef]
- Barcellos-Hoff, M.H.; Medina, D. New highlights on stroma-epithelial interactions in breast cancer. Breast Cancer Res. 2005, 7, 33–36. [Google Scholar] [CrossRef]
- Cuiffo, B.G.; Karnoub, A.E. Mesenchymal stem cells in tumor development: Emerging roles and concepts. Cell Adhes. Migr. 2012, 6, 220–230. [Google Scholar] [CrossRef]
- Lappano, R.; Rigiracciolo, D.C.; Belfiore, A.; Maggiolini, M.; De Francesco, E.M. Cancer associated fibroblasts: Role in breast cancer and potential as therapeutic targets. Expert Opin. Ther. Targets 2020, 24, 559–572. [Google Scholar] [CrossRef]
- Erdogan, B.; Webb, D.J. Cancer-associated fibroblasts modulate growth factor signaling and extracellular matrix remodeling to regulate tumor metastasis. Biochem. Soc. Trans. 2017, 45, 229–236. [Google Scholar] [CrossRef]
- Xie, F.; Ling, L.; van Dam, H.; Zhou, F.; Zhang, L. TGF-β signaling in cancer metastasis. Acta Biochim. Biophys. Sin. 2017, 50, 121–132. [Google Scholar] [CrossRef]
- Frantz, C.; Stewart, K.M.; Weaver, V.M. The extracellular matrix at a glance. J. Cell Sci. 2010, 123, 4195. [Google Scholar] [CrossRef] [PubMed]
- Pellegrini, L.; Burke, D.F.; von Delft, F.; Mulloy, B.; Blundell, T.L. Crystal structure of fibroblast growth factor receptor ectodomain bound to ligand and heparin. Nature 2000, 407, 1029–1034. [Google Scholar] [CrossRef] [PubMed]
- Holder, J.W.; Elmore, E.; Barrett, J.C. Gap junction function and cancer. Cancer Res. 1993, 53, 3475–3485. [Google Scholar]
- Visonneau, S.; Cesano, A.; Torosian, M.H.; Miller, E.J.; Santoli, D. Growth characteristics and metastatic properties of human breast cancer xenografts in immunodeficient mice. Am. J. Pathol. 1998, 152, 1299–1311. [Google Scholar] [PubMed]
- Morton, J.J.; Bird, G.; Refaeli, Y.; Jimeno, A. Humanized Mouse Xenograft Models: Narrowing the Tumor–Microenvironment Gap. Cancer Res. 2016, 76, 6153. [Google Scholar] [CrossRef]
- Tchoryk, A.; Taresco, V.; Argent, R.H.; Ashford, M.; Gellert, P.R.; Stolnik, S.; Grabowska, A.; Tchoryk, A.; Garnett, M.C. Penetration and Uptake of Nanoparticles in 3D Tumor Spheroids. Bioconjugate Chem. 2019, 30, 1371–1384. [Google Scholar] [CrossRef]
- Vinci, M.; Gowan, S.; Boxall, F.; Patterson, L.; Zimmermann, M.; Court, W.; Lomas, C.; Mendiola, M.; Hardisson, D.; Eccles, S. Advances in establishment and analysis of three-dimensional tumor spheroid-based functional assays for target validation and drug evaluation. BMC Biol. 2012, 10, 29. [Google Scholar] [CrossRef]
- Li, Q.; Chen, C.Y.; Kapadia, A.; Zhou, Q.O.; Harper, M.K.; Schaack, J.; Labarbera, D.V. 3D Models of Epithelial-Mesenchymal Transition in Breast Cancer Metastasis: High-Throughput Screening Assay Development, Validation, and Pilot Screen. J. Biomol. Screen. 2011, 16, 141–154. [Google Scholar] [CrossRef]
- Ivanov, D.P.; Grabowska, A.M.; Garnett, M.C. High-Throughput Spheroid Screens Using Volume, Resazurin Reduction, and Acid Phosphatase Activity. In Cell Viability Assays: Methods and Protocols; Gilbert, D.F., Friedrich, O., Eds.; Springer: New York, NY, USA, 2017; pp. 43–59. [Google Scholar]
- Edmondson, R.; Broglie, J.J.; Adcock, A.F.; Yang, L. Three-dimensional cell culture systems and their applications in drug discovery and cell-based biosensors. Assay Drug Dev. Technol. 2014, 12, 207–218. [Google Scholar] [CrossRef]
- Katt, M.E.; Placone, A.L.; Wong, A.D.; Xu, Z.S.; Searson, P.C. In Vitro Tumor Models: Advantages, Disadvantages, Variables, and Selecting the Right Platform. Front. Bioeng. Biotechnol. 2016, 4, 12. [Google Scholar] [CrossRef]
- Roeke, T.; Sobral-Leite, M.; Dekker, T.J.A.; Wesseling, J.; Smit, V.T.H.B.M.; Tollenaar, R.A.E.M.; Schmidt, M.K.; Mesker, W.E. The prognostic value of the tumour-stroma ratio in primary operable invasive cancer of the breast: A validation study. Breast Cancer Res. Treat. 2017, 166, 435–445. [Google Scholar] [CrossRef]
- van Diest, P.J.; Brugal, G.; Baak, J.P. Proliferation markers in tumours: Interpretation and clinical value. J. Clin. Pathol. 1998, 51, 716–724. [Google Scholar] [CrossRef]
- Hanahan, D.; Weinberg, R.A. Hallmarks of Cancer: The Next Generation. Cell 2011, 144, 646–674. [Google Scholar] [CrossRef]
- Liu, F.; Gu, L.N.; Shan, B.E.; Geng, C.Z.; Sang, M.X. Biomarkers for EMT and MET in breast cancer: An update. Oncol. Lett. 2016, 12, 4869–4876. [Google Scholar] [CrossRef]
- Lu, H.; Clauser, K.R.; Tam, W.L.; Fröse, J.; Ye, X.; Eaton, E.N.; Reinhardt, F.; Donnenberg, V.S.; Bhargava, R.; Carr, S.A.; et al. A breast cancer stem cell niche supported by juxtacrine signalling from monocytes and macrophages. Nature Cell Biol. 2014, 16, 1105–1117. [Google Scholar] [CrossRef]
- Meurette, O.; Mehlen, P. Notch Signaling in the Tumor Microenvironment. Cancer Cell 2018, 34, 536–548. [Google Scholar] [CrossRef]
- Clevers, H. Wnt/beta-catenin signaling in development and disease. Cell 2006, 127, 469–480. [Google Scholar] [CrossRef]
- Fang, D.; Hawke, D.; Zheng, Y.; Xia, Y.; Meisenhelder, J.; Nika, H.; Mills, G.B.; Kobayashi, R.; Hunter, T.; Lu, Z. Phosphorylation of beta-catenin by AKT promotes beta-catenin transcriptional activity. J. Biol. Chem. 2007, 282, 11221–11229. [Google Scholar] [CrossRef]
- Chen, K.; Liu, Q.; Tsang, L.L.; Ye, Q.; Chan, H.C.; Sun, Y.; Jiang, X. Human MSCs promotes colorectal cancer epithelial-mesenchymal transition and progression via CCL5/β-catenin/Slug pathway. Cell Death Dis. 2017, 8, e2819. [Google Scholar] [CrossRef]
- Shang, S.; Hua, F.; Hu, Z.-W. The regulation of β-catenin activity and function in cancer: Therapeutic opportunities. Oncotarget 2017, 8, 33972–33989. [Google Scholar] [CrossRef]
- Mbom, B.C.; Nelson, W.J.; Barth, A. β-catenin at the centrosome: Discrete pools of β-catenin communicate during mitosis and may co-ordinate centrosome functions and cell cycle progression. BioEssays 2013, 35, 804–809. [Google Scholar] [CrossRef]
- Shtutman, M.; Zhurinsky, J.; Simcha, I.; Albanese, C.; D’Amico, M.; Pestell, R.; Ben-Ze’ev, A. The cyclin D1 gene is a target of the β-catenin/LEF-1 pathway. Proc. Natl. Acad. Sci. USA 1999, 96, 5522–5527. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; Lamouille, S.; Derynck, R. TGF-beta-induced epithelial to mesenchymal transition. Cell Res. 2009, 19, 156–172. [Google Scholar] [CrossRef] [PubMed]
- Sun, N.; Taguchi, A.; Hanash, S. Switching Roles of TGF-β in Cancer Development: Implications for Therapeutic Target and Biomarker Studies. J. Clin. Med. 2016, 5, 109. [Google Scholar] [CrossRef] [PubMed]
- Deheuninck, J.; Luo, K. Ski and SnoN potent negative regulators of TGF-beta signaling. Cell Res. 2009, 19, 47–57. [Google Scholar] [CrossRef]
- Wang, Z.; Zhang, H.; Hou, J.; Niu, J.; Ma, Z.; Zhao, H.; Liu, C. Clinical implications of β-catenin protein expression in breast cancer. Int. J. Clin. Exp. Pathol. 2015, 8, 14989–14994. [Google Scholar]
- Zhu, Q.; Krakowski, A.R.; Dunham, E.E.; Wang, L.; Bandyopadhyay, A.; Berdeaux, R.; Martin, G.S.; Sun, L.; Luo, K. Dual role of SnoN in mammalian tumorigenesis. Mol. Cell. Biol. 2007, 27, 324–339. [Google Scholar] [CrossRef]
- Filby, A.; Begum, J.; Jalal, M.; Day, W. Appraising the suitability of succinimidyl and lipophilic fluorescent dyes to track proliferation in non-quiescent cells by dye dilution. Methods 2015, 82, 29–37. [Google Scholar] [CrossRef]
- Miller, I.; Min, M.; Yang, C.; Tian, C.; Gookin, S.; Carter, D.; Spencer, S.L. Ki67 is a Graded Rather than a Binary Marker of Proliferation versus Quiescence. Cell Rep. 2018, 24, 1105–1112.e5. [Google Scholar] [CrossRef]
- Haynes, J.; Srivastava, J.; Madson, N.; Wittmann, T.; Barber, D.L. Dynamic actin remodeling during epithelial-mesenchymal transition depends on increased moesin expression. Mol. Biol. Cell 2011, 22, 4750–4764. [Google Scholar] [CrossRef] [PubMed]
- Scheel, C.; Eaton, E.N.; Li, S.H.-J.; Chaffer, C.L.; Reinhardt, F.; Kah, K.-J.; Bell, G.; Guo, W.; Rubin, J.; Richardson, A.L.; et al. Paracrine and Autocrine Signals Induce and Maintain Mesenchymal and Stem Cell States in the Breast. Cell 2011, 145, 926–940. [Google Scholar] [CrossRef] [PubMed]
- Tecalco-Cruz, A.C.; Ríos-López, D.G.; Vázquez-Victorio, G.; Rosales-Alvarez, R.E.; Macías-Silva, M. Transcriptional cofactors Ski and SnoN are major regulators of the TGF-β/Smad signaling pathway in health and disease. Signal Transduct. Target. Ther. 2018, 3, 15. [Google Scholar] [CrossRef] [PubMed]
- Zhang, F.; Lundin, M.; Ristimäki, A.; Heikkilä, P.; Lundin, J.; Isola, J.; Joensuu, H.; Laiho, M. Ski-related novel protein N (SnoN), a negative controller of transforming growth factor-beta signaling, is a prognostic marker in estrogen receptor-positive breast carcinomas. Cancer Res. 2003, 63, 5005–5010. [Google Scholar] [PubMed]
- Hwang, S.-Y.; Deng, X.; Byun, S.; Lee, C.; Lee, S.-J.; Suh, H.; Zhang, J.; Kang, Q.; Zhang, T.; Westover, K.D.; et al. Direct Targeting of β-Catenin by a Small Molecule Stimulates Proteasomal Degradation and Suppresses Oncogenic Wnt/β-Catenin Signaling. Cell Rep. 2016, 16, 28–36. [Google Scholar] [CrossRef]
- Sirenko, O.; Mitlo, T.; Hesley, J.; Luke, S.; Owens, W.; Cromwell, E.F. High-content assays for characterizing the viability and morphology of 3D cancer spheroid cultures. Assay Drug Dev. Technol. 2015, 13, 402–414. [Google Scholar] [CrossRef]
- Kim, S.-A.; Lee, E.K.; Kuh, H.-J. Co-culture of 3D tumor spheroids with fibroblasts as a model for epithelial–mesenchymal transition in vitro. Exp. Cell Res. 2015, 335, 187–196. [Google Scholar] [CrossRef]
- Lamouille, S.; Xu, J.; Derynck, R. Molecular mechanisms of epithelial-mesenchymal transition. Nat. Rev. Mol. Cell Biol. 2014, 15, 178–196. [Google Scholar] [CrossRef]
- Copple, B.L. Hypoxia stimulates hepatocyte epithelial to mesenchymal transition by hypoxia-inducible factor and transforming growth factor-β-dependent mechanisms. Liver Int. 2010, 30, 669–682. [Google Scholar] [CrossRef]
- Moody, S.E.; Perez, D.; Pan, T.-C.; Sarkisian, C.J.; Portocarrero, C.P.; Sterner, C.J.; Notorfrancesco, K.L.; Cardiff, R.D.; Chodosh, L.A. The transcriptional repressor Snail promotes mammary tumor recurrence. Cancer Cell 2005, 8, 197–209. [Google Scholar] [CrossRef]
- Zheng, H.; Kang, Y. Multilayer control of the EMT master regulators. Oncogene 2014, 33, 1755–1763. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Mani, S.A.; Donaher, J.L.; Ramaswamy, S.; Itzykson, R.A.; Come, C.; Savagner, P.; Gitelman, I.; Richardson, A.; Weinberg, R.A. Twist, a Master Regulator of Morphogenesis, Plays an Essential Role in Tumor Metastasis. Cell 2004, 117, 927–939. [Google Scholar] [CrossRef] [PubMed]
- Saitoh, M. Involvement of partial EMT in cancer progression. J. Biochem. 2018, 164, 257–264. [Google Scholar] [CrossRef] [PubMed]
- Lambert, A.W.; Pattabiraman, D.R.; Weinberg, R.A. Emerging Biological Principles of Metastasis. Cell 2017, 168, 670–691. [Google Scholar] [CrossRef]
- Sethi, J.K.; Vidal-Puig, A. Wnt signalling and the control of cellular metabolism. Biochem. J. 2010, 42, 1–17. [Google Scholar] [CrossRef]
- Zucchini-Pascal, N.; Peyre, L.; Rahmani, R. Crosstalk between beta-catenin and snail in the induction of epithelial to mesenchymal transition in hepatocarcinoma: Role of the ERK1/2 pathway. Int. J. Mol. Sci. 2013, 14, 20768–20792. [Google Scholar] [CrossRef]
- Zhou, B.; Liu, Y.; Kahn, M.; Ann, D.K.; Han, A.; Wang, H.; Nguyen, C.; Flodby, P.; Zhong, Q.; Krishnaveni, M.S.; et al. Interactions Between β-Catenin and Transforming Growth Factor-β Signaling Pathways Mediate Epithelial-Mesenchymal Transition and Are Dependent on the Transcriptional Co-activator cAMP-response Element-binding Protein (CREB)-binding Protein (CBP). J. Biol. Chem. 2012, 287, 7026–7038. [Google Scholar] [CrossRef]
- Onion, D.; Argent, R.H.; Reece-Smith, A.M.; Craze, M.L.; Pineda, R.G.; Clarke, P.A.; Ratan, H.L.; Parsons, S.L.; Lobo, D.N.; Duffy, J.P.; et al. 3-Dimensional Patient-Derived Lung Cancer Assays Reveal Resistance to Standards-of-Care Promoted by Stromal Cells but Sensitivity to Histone Deacetylase Inhibitors. Mol. Cancer Ther. 2016, 15, 753–763. [Google Scholar] [CrossRef]
- Geraldo, S.; Simon, A.; Vignjevic, D.M. Revealing the cytoskeletal organization of invasive cancer cells in 3D. J. Vis. Exp. 2013. [Google Scholar] [CrossRef]
- Ivanov, D.P.; Grabowska, A.M. Spheroid arrays for high-throughput single-cell analysis of spatial patterns and biomarker expression in 3D. Sci. Rep. 2017, 7, 41160. [Google Scholar] [CrossRef]
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An open-source platform for biological-image analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
HPRT | ATTATGCTGAGGATTTGGAAAGGG | GCCTCCCATCTCCTTCATCAC |
Vimentin | AAAACACCCTGCAATCTTTCAGA | CACTTTGCGTTCAAGGTCAAGAC |
Twist | CAAGCTGAGCAAGATTCAGACCC | AGACCGAGAAGGCGTAGCTGA |
Snail | CCCCAATCGGAAGCCTAACT | GGTCGTAGGGCTGCTGCTGGAA |
E-cadherin | GAACAGCACGTACACAGCCCT | GCAGAAGTGTCCCTGTTCCAG |
Zeb1 | GAAAGGAAGGGCAAGAAATCCT | TGCATCTGACTCGCATTCATC |
Antibodies | Dilution | Source |
---|---|---|
Monoclonal mouse (Mse) anti-Ki67 Ab (MIB-1) | 1:40 | DAKO |
Monoclonal Mse anti-E-cadherin Ab (Clone NCH-38) | 1:50 | DAKO |
Monoclonal mse anti-SnON (Clone OTI1A6) | 1:150 | LS Biosciences |
β-catenin (D10A8) XP® rabbit monoclonal Ab | 1:100 | Cell Signalling Technology |
Mse IgG1, Negative control | 1:50 | DAKO |
Rabbit IgG1, Negative control | 1:100 | DAKO |
Polyclonal rabbit anti-mouse IgG-Biotinylated | 1:300 | DAKO |
SignalStain® Boost Detection Reagent (HRP, Rabbit) | neat | Cell Signalling Technology |
Chicken anti-Rabbit IgG, Alexa Fluor 488 | 1:300 | Thermo Fisher Scientific |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pal, A.; Ashworth, J.C.; Collier, P.; Probert, C.; Jones, S.; Leza, E.P.; Meakin, M.L.; A. Ritchie, A.; Onion, D.; Clarke, P.A.; et al. A 3D Heterotypic Breast Cancer Model Demonstrates a Role for Mesenchymal Stem Cells in Driving a Proliferative and Invasive Phenotype. Cancers 2020, 12, 2290. https://doi.org/10.3390/cancers12082290
Pal A, Ashworth JC, Collier P, Probert C, Jones S, Leza EP, Meakin ML, A. Ritchie A, Onion D, Clarke PA, et al. A 3D Heterotypic Breast Cancer Model Demonstrates a Role for Mesenchymal Stem Cells in Driving a Proliferative and Invasive Phenotype. Cancers. 2020; 12(8):2290. https://doi.org/10.3390/cancers12082290
Chicago/Turabian StylePal, Amarnath, Jennifer C. Ashworth, Pamela Collier, Catherine Probert, Sal Jones, Eduardo Pernaut Leza, Marian L. Meakin, Alison A. Ritchie, David Onion, Philip A Clarke, and et al. 2020. "A 3D Heterotypic Breast Cancer Model Demonstrates a Role for Mesenchymal Stem Cells in Driving a Proliferative and Invasive Phenotype" Cancers 12, no. 8: 2290. https://doi.org/10.3390/cancers12082290
APA StylePal, A., Ashworth, J. C., Collier, P., Probert, C., Jones, S., Leza, E. P., Meakin, M. L., A. Ritchie, A., Onion, D., Clarke, P. A., Allegrucci, C., & Grabowska, A. M. (2020). A 3D Heterotypic Breast Cancer Model Demonstrates a Role for Mesenchymal Stem Cells in Driving a Proliferative and Invasive Phenotype. Cancers, 12(8), 2290. https://doi.org/10.3390/cancers12082290