Epigenetic Targeting of Mcl-1 Is Synthetically Lethal with Bcl-xL/Bcl-2 Inhibition in Model Systems of Glioblastoma
Abstract
1. Introduction
2. Results
2.1. Identification of a Super-Enhancer at the Mcl-1 Locus in Glioblastoma Tissues and Cells
2.2. Pharmacological Inhibition of Super-Enhancers Suppresses Mcl-1 mRNA and Protein Levels
2.3. The Super-Enhancer Blocker, THZ1, Sensitizes GBM Cells to the Cytotoxic Effects of BH3-Mimetics, and Attenuates ABT263 Mediated Up-Regulation of Mcl-1
2.4. The Combination Treatment of ABT263 and THZ1 Elicits Enhanced Activation of a Cell Death with Features of Apoptosis
2.5. Suppression of Mcl-1 by THZ1 Is Sufficient and Necessary to Sensitize GBM Cells for BH3-Mimetic-Mediated Cell Death
2.6. The Combination Treatment of ABT263 and THZ1 Exerts Enhanced Anti-Glioma Activity in Patient-Derived Xenograft In Vivo without Significant Organ Toxicity
3. Discussion
4. Materials and Methods
4.1. Cell Cultures and Growth Conditions
4.2. Reagents
4.3. Real-Time PCR Analysis
4.4. Chromatin Immunoprecipitation (CHIP) Sequencing
4.5. Computational Analysis of CHIP Sequencing Data
4.6. Cell Viability Assays
4.7. Flow Cytometry
4.8. Transfections of siRNAs and cDNA Plasmid Constructs
4.9. Western Blot Analysis
4.10. Subcutaneous Xenograft Model
4.11. TUNEL and Ki67 Staining
4.12. Statistical Analysis
4.13. Study Approval
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Wang, X.; Yang, K.; Wu, Q.; Kim, L.J.Y.; Morton, A.R.; Gimple, R.C.; Prager, B.C.; Shi, Y.; Zhou, W.; Bhargava, S.; et al. Targeting pyrimidine synthesis accentuates molecular therapy response in glioblastoma stem cells. Sci. Transl. Med. 2019, 11. [Google Scholar] [CrossRef] [Scilit]
- Neftel, C.; Laffy, J.; Filbin, M.G.; Hara, T.; Shore, M.E.; Rahme, G.J.; Richman, A.R.; Silverbush, D.; Shaw, M.L.; Hebert, C.M.; et al. An Integrative Model of Cellular States, Plasticity, and Genetics for Glioblastoma. Cell 2019, 178, 835–849 e821. [Google Scholar] [CrossRef] [Scilit]
- Darmanis, S.; Sloan, S.A.; Croote, D.; Mignardi, M.; Chernikova, S.; Samghababi, P.; Zhang, Y.; Neff, N.; Kowarsky, M.; Caneda, C.; et al. Single-Cell RNA-Seq Analysis of Infiltrating Neoplastic Cells at the Migrating Front of Human Glioblastoma. Cell Rep. 2017, 21, 1399–1410. [Google Scholar] [CrossRef] [Scilit]
- Boedicker, C.; Hussong, M.; Grimm, C.; Dolgikh, N.; Meister, M.T.; Enssle, J.C.; Wanior, M.; Knapp, S.; Schweiger, M.R.; Fulda, S. Co-inhibition of BET proteins and PI3Kalpha triggers mitochondrial apoptosis in rhabdomyosarcoma cells. Oncogene 2020, 39, 3837–3852. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Unterkircher, T.; Cristofanon, S.; Vellanki, S.H.; Nonnenmacher, L.; Karpel-Massler, G.; Wirtz, C.R.; Debatin, K.M.; Fulda, S. Bortezomib primes glioblastoma, including glioblastoma stem cells, for TRAIL by increasing tBid stability and mitochondrial apoptosis. Clin. Cancer Res. 2011, 17, 4019–4030. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ramirez-Peinado, S.; Alcazar-Limones, F.; Lagares-Tena, L.; El Mjiyad, N.; Caro-Maldonado, A.; Tirado, O.M.; Munoz-Pinedo, C. 2-deoxyglucose induces Noxa-dependent apoptosis in alveolar rhabdomyosarcoma. Cancer Res. 2011, 71, 6796–6806. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Karpel-Massler, G.; Ishida, C.T.; Bianchetti, E.; Shu, C.; Perez-Lorenzo, R.; Horst, B.; Banu, M.; Roth, K.A.; Bruce, J.N.; Canoll, P.; et al. Inhibition of Mitochondrial Matrix Chaperones and Antiapoptotic Bcl-2 Family Proteins Empower Antitumor Therapeutic Responses. Cancer Res. 2017, 77, 3513–3526. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Souers, A.J.; Leverson, J.D.; Boghaert, E.R.; Ackler, S.L.; Catron, N.D.; Chen, J.; Dayton, B.D.; Ding, H.; Enschede, S.H.; Fairbrother, W.J.; et al. ABT-199, a potent and selective BCL-2 inhibitor, achieves antitumor activity while sparing platelets. Nat. Med. 2013, 19, 202–208. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tse, C.; Shoemaker, A.R.; Adickes, J.; Anderson, M.G.; Chen, J.; Jin, S.; Johnson, E.F.; Marsh, K.C.; Mitten, M.J.; Nimmer, P.; et al. ABT-263: A potent and orally bioavailable Bcl-2 family inhibitor. Cancer Res. 2008, 68, 3421–3428. [Google Scholar] [CrossRef] [Scilit]
- Albershardt, T.C.; Salerni, B.L.; Soderquist, R.S.; Bates, D.J.; Pletnev, A.A.; Kisselev, A.F.; Eastman, A. Multiple BH3 mimetics antagonize antiapoptotic MCL1 protein by inducing the endoplasmic reticulum stress response and up-regulating BH3-only protein NOXA. J. Biol. Chem. 2011, 286, 24882–24895. [Google Scholar] [CrossRef] [Scilit]
- Halatsch, M.E.; Kast, R.E.; Dwucet, A.; Hlavac, M.; Heiland, T.; Westhoff, M.A.; Debatin, K.M.; Wirtz, C.R.; Siegelin, M.D.; Karpel-Massler, G. Bcl-2/Bcl-xL inhibition predominantly synergistically enhances the anti-neoplastic activity of a low-dose CUSP9 repurposed drug regime against glioblastoma. Br. J. Pharmacol. 2019, 176, 3681–3694. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Strik, H.; Deininger, M.; Streffer, J.; Grote, E.; Wickboldt, J.; Dichgans, J.; Weller, M.; Meyermann, R. BCL-2 family protein expression in initial and recurrent glioblastomas: Modulation by radiochemotherapy. J. Neurol. Neurosurg. Psychiatry 1999, 67, 763–768. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oltersdorf, T.; Elmore, S.W.; Shoemaker, A.R.; Armstrong, R.C.; Augeri, D.J.; Belli, B.A.; Bruncko, M.; Deckwerth, T.L.; Dinges, J.; Hajduk, P.J.; et al. An inhibitor of Bcl-2 family proteins induces regression of solid tumours. Nature 2005, 435, 677–681. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Raffeld, M.; Wright, J.J.; Lipford, E.; Cossman, J.; Longo, D.L.; Bakhshi, A.; Korsmeyer, S.J. Clonal evolution of t(14;18) follicular lymphomas demonstrated by immunoglobulin genes and the 18q21 major breakpoint region. Cancer Res. 1987, 47, 2537–2542. [Google Scholar]
- Pegoraro, L.; Palumbo, A.; Erikson, J.; Falda, M.; Giovanazzo, B.; Emanuel, B.S.; Rovera, G.; Nowell, P.C.; Croce, C.M. A 14;18 and an 8;14 chromosome translocation in a cell line derived from an acute B-cell leukemia. Proc. Natl. Acad. Sci. USA 1984, 81, 7166–7170. [Google Scholar] [CrossRef] [Scilit]
- Tron, A.E.; Belmonte, M.A.; Adam, A.; Aquila, B.M.; Boise, L.H.; Chiarparin, E.; Cidado, J.; Embrey, K.J.; Gangl, E.; Gibbons, F.D.; et al. Discovery of Mcl-1-specific inhibitor AZD5991 and preclinical activity in multiple myeloma and acute myeloid leukemia. Nat. Commun. 2018, 9, 5341. [Google Scholar] [CrossRef] [Scilit]
- Nangia, V.; Siddiqui, F.M.; Caenepeel, S.; Timonina, D.; Bilton, S.J.; Phan, N.; Gomez-Caraballo, M.; Archibald, H.L.; Li, C.; Fraser, C.; et al. Exploiting MCL1 Dependency with Combination MEK + MCL1 Inhibitors Leads to Induction of Apoptosis and Tumor Regression in KRAS-Mutant Non-Small Cell Lung Cancer. Cancer Discov. 2018, 8, 1598–1613. [Google Scholar] [CrossRef] [Scilit]
- Randall, E.C.; Lopez, B.G.C.; Peng, S.; Regan, M.S.; Abdelmoula, W.M.; Basu, S.S.; Santagata, S.; Yoon, H.; Haigis, M.C.; Agar, J.N.; et al. Localized Metabolomic Gradients in Patient-Derived Xenograft Models of Glioblastoma. Cancer Res. 2020, 80, 1258–1267. [Google Scholar] [CrossRef] [Scilit]
- Randall, E.C.; Emdal, K.B.; Laramy, J.K.; Kim, M.; Roos, A.; Calligaris, D.; Regan, M.S.; Gupta, S.K.; Mladek, A.C.; Carlson, B.L.; et al. Integrated mapping of pharmacokinetics and pharmacodynamics in a patient-derived xenograft model of glioblastoma. Nat. Commun. 2018, 9, 4904. [Google Scholar] [CrossRef] [Scilit]
- Whyte, W.A.; Orlando, D.A.; Hnisz, D.; Abraham, B.J.; Lin, C.Y.; Kagey, M.H.; Rahl, P.B.; Lee, T.I.; Young, R.A. Master transcription factors and mediator establish super-enhancers at key cell identity genes. Cell 2013, 153, 307–319. [Google Scholar] [CrossRef] [Scilit]
- Kwiatkowski, N.; Zhang, T.; Rahl, P.B.; Abraham, B.J.; Reddy, J.; Ficarro, S.B.; Dastur, A.; Amzallag, A.; Ramaswamy, S.; Tesar, B.; et al. Targeting transcription regulation in cancer with a covalent CDK7 inhibitor. Nature 2014, 511, 616–620. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chipumuro, E.; Marco, E.; Christensen, C.L.; Kwiatkowski, N.; Zhang, T.; Hatheway, C.M.; Abraham, B.J.; Sharma, B.; Yeung, C.; Altabef, A.; et al. CDK7 inhibition suppresses super-enhancer-linked oncogenic transcription in MYCN-driven cancer. Cell 2014, 159, 1126–1139. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meng, W.; Wang, J.; Wang, B.; Liu, F.; Li, M.; Zhao, Y.; Zhang, C.; Li, Q.; Chen, J.; Zhang, L.; et al. CDK7 inhibition is a novel therapeutic strategy against GBM both in vitro and in vivo. Cancer Manag. Res. 2018, 10, 5747–5758. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Karpel-Massler, G.; Shu, C.; Chau, L.; Banu, M.; Halatsch, M.E.; Westhoff, M.A.; Ramirez, Y.; Ross, A.H.; Bruce, J.N.; Canoll, P.; et al. Combined inhibition of Bcl-2/Bcl-xL and Usp9X/Bag3 overcomes apoptotic resistance in glioblastoma in vitro and in vivo. Oncotarget 2015, 6, 14507–14521. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lessene, G.; Czabotar, P.E.; Sleebs, B.E.; Zobel, K.; Lowes, K.N.; Adams, J.M.; Baell, J.B.; Colman, P.M.; Deshayes, K.; Fairbrother, W.J.; et al. Structure-guided design of a selective BCL-X(L) inhibitor. Nat. Chem. Biol. 2013, 9, 390–397. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Citron, F.; Fabris, L. Targeting Epigenetic Dependencies in Solid Tumors: Evolutionary Landscape Beyond Germ Layers Origin. Cancers 2020, 12, 682. [Google Scholar] [CrossRef] [Scilit]
- Park, J.W.; Turcan, S. Epigenetic Reprogramming for Targeting IDH-Mutant Malignant Gliomas. Cancers 2019, 11, 1616. [Google Scholar] [CrossRef] [Scilit]
- Michealraj, K.A.; Kumar, S.A.; Kim, L.J.Y.; Cavalli, F.M.G.; Przelicki, D.; Wojcik, J.B.; Delaidelli, A.; Bajic, A.; Saulnier, O.; MacLeod, G.; et al. Metabolic Regulation of the Epigenome Drives Lethal Infantile Ependymoma. Cell 2020. [Google Scholar] [CrossRef] [Scilit]
- Carrer, A.; Trefely, S.; Zhao, S.; Campbell, S.L.; Norgard, R.J.; Schultz, K.C.; Sidoli, S.; Parris, J.L.D.; Affronti, H.C.; Sivanand, S.; et al. Acetyl-CoA Metabolism Supports Multistep Pancreatic Tumorigenesis. Cancer Discov. 2019, 9, 416–435. [Google Scholar] [CrossRef] [Scilit]
- Arabzade, A.; Stuckert, A.J.; Bertrand, K.C.; Mack, S.C. Invited Review: The role and contribution of transcriptional enhancers in brain cancer. Neuropathol. Appl. Neurobiol. 2020, 46, 48–56. [Google Scholar] [CrossRef] [Scilit]
- Nguyen, T.; Zhang, Y.; Shang, E.; Shu, C.; Torrini, C.; Zhao, J.; Bianchetti, E.; Mela, A.; Humala, N.; Mahajan, A.; et al. HDAC inhibitors elicit metabolic reprogramming by targeting super-enhancers in glioblastoma models. J. Clin. Investig. 2020. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wong, M.; Sun, Y.; Xi, Z.; Milazzo, G.; Poulos, R.C.; Bartenhagen, C.; Bell, J.L.; Mayoh, C.; Ho, N.; Tee, A.E.; et al. JMJD6 is a tumorigenic factor and therapeutic target in neuroblastoma. Nat. Commun. 2019, 10, 3319. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rusan, M.; Li, K.; Li, Y.; Christensen, C.L.; Abraham, B.J.; Kwiatkowski, N.; Buczkowski, K.A.; Bockorny, B.; Chen, T.; Li, S.; et al. Suppression of Adaptive Responses to Targeted Cancer Therapy by Transcriptional Repression. Cancer Discov. 2018, 8, 59–73. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sharifnia, T.; Wawer, M.J.; Chen, T.; Huang, Q.Y.; Weir, B.A.; Sizemore, A.; Lawlor, M.A.; Goodale, A.; Cowley, G.S.; Vazquez, F.; et al. Small-molecule targeting of brachyury transcription factor addiction in chordoma. Nat. Med. 2019, 25, 292–300. [Google Scholar] [CrossRef] [Scilit]
- Xu, Y.; Wu, Y.; Zhang, S.; Ma, P.; Jin, X.; Wang, Z.; Yao, M.; Zhang, E.; Tao, B.; Qin, Y.; et al. A Tumor-Specific Super-Enhancer Drives Immune Evasion by Guiding Synchronous Expression of PD-L1 and PD-L2. Cell Rep. 2019, 29, 3435–3447 e3434. [Google Scholar] [CrossRef] [Scilit]
- Zhang, H.; Christensen, C.L.; Dries, R.; Oser, M.G.; Deng, J.; Diskin, B.; Li, F.; Pan, Y.; Zhang, X.; Yin, Y.; et al. CDK7 Inhibition Potentiates Genome Instability Triggering Anti-tumor Immunity in Small Cell Lung Cancer. Cancer Cell 2020, 37, 37–54 e39. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Zhou, L.; Bandyopadhyay, D.; Sharma, K.; Allen, A.J.; Kmieciak, M.; Grant, S. The Covalent CDK7 Inhibitor THZ1 Potently Induces Apoptosis in Multiple Myeloma Cells In Vitro and In Vivo. Clin Cancer Res. 2019, 25, 6195–6205. [Google Scholar] [CrossRef] [Scilit]
- Cayrol, F.; Praditsuktavorn, P.; Fernando, T.M.; Kwiatkowski, N.; Marullo, R.; Calvo-Vidal, M.N.; Phillip, J.; Pera, B.; Yang, S.N.; Takpradit, K.; et al. THZ1 targeting CDK7 suppresses STAT transcriptional activity and sensitizes T-cell lymphomas to BCL2 inhibitors. Nat. Commun. 2017, 8, 14290. [Google Scholar] [CrossRef] [Scilit]
- Stewart, D.P.; Koss, B.; Bathina, M.; Perciavalle, R.M.; Bisanz, K.; Opferman, J.T. Ubiquitin-independent degradation of antiapoptotic MCL-1. Mol. Cell. Biol. 2010, 30, 3099–3110. [Google Scholar] [CrossRef] [Scilit]
- Karpel-Massler, G.; Ishida, C.T.; Zhang, Y.; Halatsch, M.E.; Westhoff, M.A.; Siegelin, M.D. Targeting intrinsic apoptosis and other forms of cell death by BH3-mimetics in glioblastoma. Expert Opin. Drug Discov. 2017, 12, 1031–1040. [Google Scholar] [CrossRef] [Scilit]
- Karpel-Massler, G.; Ishida, C.T.; Bianchetti, E.; Zhang, Y.; Shu, C.; Tsujiuchi, T.; Banu, M.A.; Garcia, F.; Roth, K.A.; Bruce, J.N.; et al. Induction of synthetic lethality in IDH1-mutated gliomas through inhibition of Bcl-xL. Nat. Commun. 2017, 8, 1067. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nguyen, T.T.T.; Ishida, C.T.; Shang, E.; Shu, C.; Torrini, C.; Zhang, Y.; Bianchetti, E.; Sanchez-Quintero, M.J.; Kleiner, G.; Quinzii, C.M.; et al. Activation of LXRbeta inhibits tumor respiration and is synthetically lethal with Bcl-xL inhibition. EMBO Mol. Med. 2019, 11, e10769. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.; Ishida, C.T.; Shu, C.; Kleiner, G.; Sanchez-Quintero, M.J.; Bianchetti, E.; Quinzii, C.M.; Westhoff, M.A.; Karpel-Massler, G.; Siegelin, M.D. Inhibition of Bcl-2/Bcl-xL and c-MET causes synthetic lethality in model systems of glioblastoma. Sci. Rep. 2018, 8, 7373. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Karpel-Massler, G.; Ramani, D.; Shu, C.; Halatsch, M.E.; Westhoff, M.A.; Bruce, J.N.; Canoll, P.; Siegelin, M.D. Metabolic reprogramming of glioblastoma cells by L-asparaginase sensitizes for apoptosis in vitro and in vivo. Oncotarget 2016, 7, 33512–33528. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Karpel-Massler, G.; Horst, B.A.; Shu, C.; Chau, L.; Tsujiuchi, T.; Bruce, J.N.; Canoll, P.; Greene, L.A.; Angelastro, J.M.; Siegelin, M.D. A Synthetic Cell-Penetrating Dominant-Negative ATF5 Peptide Exerts Anticancer Activity against a Broad Spectrum of Treatment-Resistant Cancers. Clin. Cancer Res. 2016, 22, 4698–4711. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ishida, C.T.; Bianchetti, E.; Shu, C.; Halatsch, M.E.; Westhoff, M.A.; Karpel-Massler, G.; Siegelin, M.D. BH3-mimetics and BET-inhibitors elicit enhanced lethality in malignant glioma. Oncotarget 2017, 8, 29558–29573. [Google Scholar] [CrossRef] [Scilit]
- Huang, T.; Ding, X.; Xu, G.; Chen, G.; Cao, Y.; Peng, C.; Shen, S.; Lv, Y.; Wang, L.; Zou, X. CDK7 inhibitor THZ1 inhibits MCL1 synthesis and drives cholangiocarcinoma apoptosis in combination with BCL2/BCL-XL inhibitor ABT-263. Cell Death Dis. 2019, 10, 602. [Google Scholar] [CrossRef] [Scilit]
- Gupta, S.K.; Kizilbash, S.H.; Carlson, B.L.; Mladek, A.C.; Boakye-Agyeman, F.; Bakken, K.K.; Pokorny, J.L.; Schroeder, M.A.; Decker, P.A.; Cen, L.; et al. Delineation of MGMT Hypermethylation as a Biomarker for Veliparib-Mediated Temozolomide-Sensitizing Therapy of Glioblastoma. J. Natl. Cancer Inst. 2016, 108. [Google Scholar] [CrossRef] [Scilit]
- Sarkaria, J.N.; Carlson, B.L.; Schroeder, M.A.; Grogan, P.; Brown, P.D.; Giannini, C.; Ballman, K.V.; Kitange, G.J.; Guha, A.; Pandita, A.; et al. Use of an orthotopic xenograft model for assessing the effect of epidermal growth factor receptor amplification on glioblastoma radiation response. Clin. Cancer Res. 2006, 12, 2264–2271. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Liu, T.; Meyer, C.A.; Eeckhoute, J.; Johnson, D.S.; Bernstein, B.E.; Nusbaum, C.; Myers, R.M.; Brown, M.; Li, W.; et al. Model-based analysis of ChIP-Seq (MACS). Genome Biol. 2008, 9, R137. [Google Scholar] [CrossRef] [Scilit]
- Ramirez, F.; Ryan, D.P.; Gruning, B.; Bhardwaj, V.; Kilpert, F.; Richter, A.S.; Heyne, S.; Dundar, F.; Manke, T. deepTools2: A next generation web server for deep-sequencing data analysis. Nucleic Acids Res. 2016, 44, W160–W165. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heinz, S.; Benner, C.; Spann, N.; Bertolino, E.; Lin, Y.C.; Laslo, P.; Cheng, J.X.; Murre, C.; Singh, H.; Glass, C.K. Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Mol. Cell 2010, 38, 576–589. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chou, T.C. Drug combination studies and their synergy quantification using the Chou-Talalay method. Cancer Res. 2010, 70, 440–446. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Gene | Forward Sequence | Reverse Sequence |
|---|---|---|
| 18S | AGTCCCTGCCCTTTGTACACA | GATCCGAGGGCCTCACTAAAC |
| Mcl1 | CCAAGAAAGCTGCATCGAACCAT | CAGCACATTCCTGATGCCACCT |
| ChIP-Mcl1-R1 | ATGTCGCCCGAAGAGGAGCTGGACG | CAGCGACTGCCGGTACAACTCGTCC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shang, E.; Nguyen, T.T.T.; Shu, C.; Westhoff, M.-A.; Karpel-Massler, G.; Siegelin, M.D. Epigenetic Targeting of Mcl-1 Is Synthetically Lethal with Bcl-xL/Bcl-2 Inhibition in Model Systems of Glioblastoma. Cancers 2020, 12, 2137. https://doi.org/10.3390/cancers12082137
Shang E, Nguyen TTT, Shu C, Westhoff M-A, Karpel-Massler G, Siegelin MD. Epigenetic Targeting of Mcl-1 Is Synthetically Lethal with Bcl-xL/Bcl-2 Inhibition in Model Systems of Glioblastoma. Cancers. 2020; 12(8):2137. https://doi.org/10.3390/cancers12082137
Chicago/Turabian StyleShang, Enyuan, Trang T. T. Nguyen, Chang Shu, Mike-Andrew Westhoff, Georg Karpel-Massler, and Markus D. Siegelin. 2020. "Epigenetic Targeting of Mcl-1 Is Synthetically Lethal with Bcl-xL/Bcl-2 Inhibition in Model Systems of Glioblastoma" Cancers 12, no. 8: 2137. https://doi.org/10.3390/cancers12082137
APA StyleShang, E., Nguyen, T. T. T., Shu, C., Westhoff, M.-A., Karpel-Massler, G., & Siegelin, M. D. (2020). Epigenetic Targeting of Mcl-1 Is Synthetically Lethal with Bcl-xL/Bcl-2 Inhibition in Model Systems of Glioblastoma. Cancers, 12(8), 2137. https://doi.org/10.3390/cancers12082137

