Next Article in Journal
Cyanobacterial Neurotoxin BMAA and Mercury in Sharks
Previous Article in Journal
Identification of an Essential Region for Translocation of Clostridium difficile Toxin B
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Antifungal and Antiaflatoxigenic Methylenedioxy-Containing Compounds and Piperine-Like Synthetic Compounds

1
School of Applied Biosciences, Kyungpook National University, Daegu 41566, Korea
2
Department of Life Science and Biotechnology, Soonchunhyang University, Asan 31538, Korea
3
School of Urban and Environmental Engineering, Ulsan National Institute of Science and Technology, UNIST-gil 50, Ulsan 44919, Korea
4
Food Contaminants Division, National Institute of Food & Drug Safety Evaluation, Osong 28159, Korea
5
Advanced Food Safety Research Group, BK21 Plus, School of Food Science and Technology, Chung-Ang University, Anseong 17546, Korea
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this study as corresponding authors.
Toxins 2016, 8(8), 240; https://doi.org/10.3390/toxins8080240
Submission received: 20 June 2016 / Revised: 1 August 2016 / Accepted: 2 August 2016 / Published: 16 August 2016
(This article belongs to the Section Mycotoxins)

Abstract

:
Twelve methylenedioxy-containing compounds including piperine and 10 piperine-like synthetic compounds were assessed to determine their antifungal and antiaflatoxigenic activities against Aspergillus flavus ATCC 22546 in terms of their structure–activity relationships. Piperonal and 1,3-benzodioxole had inhibitory effects against A. flavus mycelial growth and aflatoxin B1 production up to a concentration of 1000 μg/mL. Ten piperine-like synthetic compounds were synthesized that differed in terms of the carbon length in the hydrocarbon backbone and the presence of the methylenedioxy moiety. In particular, 1-(2-methylpiperidin-1-yl)-3-phenylprop-2-en-1-one had potent antifungal and antiaflatoxigenic effects against A. flavus up to a concentration of 1 μg/mL. This synthetic compound was remarkable because the positive control thiabendazole had no inhibitory effect at this concentration. Reverse transcription-PCR analysis showed that five genes involved in aflatoxin biosynthesis pathways were down-regulated in A. flavus, i.e., aflD, aflK, aflQ, aflR, and aflS; therefore, the synthetic compound inhibited aflatoxin production by down-regulating these genes.

Graphical Abstract

1. Introduction

Fungal infections are widespread in cereal crops, and severe contamination by fungal toxins, including aflatoxins, causes trade issues between countries [1,2,3,4]. The regulations for aflatoxin in cereals vary between countries, and the new maximum aflatoxin levels in the EU for corn and rice are <2 μg/kg aflatoxin B1 and a total aflatoxin content of 4 μg/kg, except for unprocessed maize and rice, which are 5 and 10 μg/kg, respectively [5]. Other foodstuffs, including almonds, pistachios, and apricot kernels, are limited to 8 μg/kg of aflatoxin B1 and a total aflatoxin content of 10 μg/kg [5]. Therefore, methods for reducing aflatoxin contamination have been developed in many countries, especially those that conduct regular monitoring of aflatoxin contamination in cereals [6,7,8].
Detoxification and decomposition of aflatoxins with organic acids reduces the residual aflatoxin contents of foodstuffs, where this method includes heating the crop [8,9]. Detoxification methods using enzymes, such as laccase and manganese peroxidase, have also been suggested for reducing aflatoxin contamination [10,11]. Physical and chemical methods, such as ozone and gamma-irradiation, can also remove aflatoxins from contaminated foodstuffs in an efficient manner [12,13]. The microbiological detoxification of aflatoxins has been studied comprehensively using Rhodococcus strains and yeasts [14,15]. Growth inhibition of aflatoxin-producing fungi, such as Aspergillus flavus and A. parasiticus, by microbes has been demonstrated successfully as a method for reducing aflatoxin contamination [16,17]. However, for some products, the detoxification processes may enhance their toxicities compared with those of the parent structures. Therefore, toxicity tests need to be determined after various treatments with structural elucidation of products [18].
Chemical control using currently available fungicides is one of the most efficient ways of preventing mycotoxigenic fungal growth and reducing mycotoxin contamination [19]. However, resistance to fungicides is well-documented throughout the world, and it threatens food security and human health [20,21].
The rise of fungal resistance necessitates the development of new methods for controlling mycotoxigenic fungi, and naturally occurring compounds, including essential oils, have been highlighted as alternative fungicides for reducing aflatoxin production [22,23,24]. Some isolated natural compounds have also been used to treat A. flavus growth and reduce aflatoxin production [25]. Piperlongumine, piperine, pipernonaline, and piperoctadecalidine exhibit fungicidal activities against A. flavus WRRC 3-90-42, and piperonal has a specific inhibitory effect against aflatoxin B1 biosynthesis [25,26]. Methylenedioxy moiety-containing compounds are abundant in Piper fruits (black pepper) and they are known to be inhibitors of cytochrome P450s [27,28]. Newly synthesized compounds derived from naturally occurring chemicals have also been suggested as compounds that could be used to control Aspergillus spp [29].
In this study, two methylenedioxy-containing compounds identified from Piper nigrum, piperonal and piperine, were investigated to determine their antiaflatoxigenic effects on aflatoxin production by A. flavus. Piperine was then used as a lead compound to synthesize various compounds containing the methylenedioxy moiety, and 10 piperine-like synthetic compounds were evaluated in terms of their structure–inhibitory activity relationships.

2. Results and Discussion

Thiabendazole is generally used in agriculture to control fungal infections in crop plants. In this study, we used thiabendazole as a positive control for comparison with the test compounds. We found that 1,3-benzodioxole exhibited antifungal activity at 1000 μg/mL, and kept some fungicidal activity at 100 μg/mL against A. flavus (Table 1). Similarly, methylenedioxy-containing compounds exhibited antifungal activities at 1000 μg/mL, but they lost most of their fungicidal effects at 100 μg/mL, except for methylenedioxy phenylacetic acid (Table 1). Thiabendazole achieved ca. 95% mycelial growth inhibition at 5 μg/mL. Piperine had very weak antifungal activities against A. flavus at 1000 μg/mL, and piperonal and sesamol obtained moderate antifungal effects against A. flavus at 1000 μg/mL. As shown in Table 1, we also determined the rate of aflatoxin production inhibition. Thiabendazole strongly inhibited the production of aflatoxins B1, B2, and G2 at 5 μg/mL, but aflatoxin G1 production was not inhibited at the same concentration. This indicates that thiabendazole inhibits the mycelial growth of A. flavus and the production of aflatoxins B1, B2, and G2 at 5 μg/mL, but not G1. 1,3-Benzodioxole had different inhibitory patterns where it controlled the production of four different aflatoxins at 100 μg/mL (Table 1). Piperine had a concentration-dependent inhibitory effect on aflatoxin production where it strongly inhibited aflatoxins B1, B2, and G1 at 3000 μg/mL, whereas it inhibited aflatoxin G2 at 1000 μg/mL. This difference may be attributable to the various inhibitory effects of piperine on aflatoxin production in A. flavus. By contrast, sesamol enhanced aflatoxin B2 production. According to these results, sesamol could inhibit mycelial growth, but the living mycelium produced more aflatoxins compared with the control group.
We found that methylenedioxy-containing compounds, including piperonal and piperine, had moderate inhibitory effects on the growth of A. flavus mycelia and aflatoxin B1 production (Table 1). The structure of the methylenedioxy-containing compounds used in this study contained 1,3-benzodioxole and its antiaflatoxigenic activity was the strongest of the methylenedioxy-containing compounds that we tested. In sesamol, the hydrogen in the compound is replaced by a hydroxyl moiety on the 1,3-benzodioxole, which decreased the antiaflatoxigenic activity compared with 1,3-benzodioxole (Table 1). Other replacement reactions also decreased the antiaflatoxigenic activities.
Methylenedioxy functional group-containing compounds, such as piperonal and piperine, have been identified as compounds that could potentially control aflatoxin contamination in foodstuffs [25,27,30]. Piperine is a major alkaloid found in Piper plants [31,32] which has an inhibitory effect on aflatoxin B1 biosynthesis and the growth of A. flavus mycelia at a concentration of 0.7% (w/v) [25]. Recently, Park et al. [25] showed that piperonal, one of the major compounds in P. nigrum essential oil, inhibited aflatoxin B1 production and it diverted the aflatoxin B1 biosynthetic route to aflatoxin G2 production. These findings improve our understanding of the relationship between chemical inhibition and aflatoxin biosynthesis.
Among the 10 piperine-like synthetic compounds (Figure 1), we found that 1-(2-methylpiperidin-1-yl)-3-phenylprop-2-en-1-one (1) and 3-(benzo-1,3-dioxol-5-yl)-1-(2-methylpiperidin-1-yl)prop-2-en-1-one exhibited antifungal activities against A. flavus at the concentration of 1000 μg/mL (Table 2), these antifungal activities decreased dramatically ten times less concentration than the initial concentration. Interestingly, 1-(2-methylpiperidin-1-yl)-3-phenylprop-2-en-1-one had potent antiaflatoxigenic activity up to 1 μg/mL (Table 2, Figure 1).
Piperine is a piperidine alkaloid that contains the methylenedioxy moiety in its structure. When the methylenedioxy moiety and dienes were removed from the structure of piperine, 1-(2-methylpiperidin-1-yl)-3-phenylprop-2-en-1-one was produced, which had moderate antifungal activities against A. flavus, but it had a potent antiaflatoxigenic effect against aflatoxin B1 when the concentration was as low as 1 μg/mL (Table 2).
RT-PCR analyses showed that 1-(2-methylpiperidin-1-yl)-3-phenylprop-2-en-1-one had dose-dependent inhibitory effects on the expression of aflD, aflK, aflQ, aflR, and aflS (Figure 2). It is likely that this compound directly blocks the aflatoxin biosynthesis pathway by inhibiting the aflatoxin biosynthesis transcription factors aflR and aflS.
The inhibitory mode of action was determined using RT-PCR (Figure 2). Two transcription factors, aflR and aflS, are known to control aflatoxin biosynthesis [33]. Our results showed that 1-(2-methylpiperidin-1-yl)-3-phenylprop-2-en-1-one inhibited the expression of the aflR and aflS genes, and three other genes were also downregulated (Figure 2). Therefore, this compound may be a potential biopesticide that could control A. flavus and aflatoxin production. The toxicological properties and other fungicidal effects of these compounds on mycotoxin-producing fungi need to be studied in future research.

3. Materials and Methods

3.1. Chemicals

Aflatoxins B1, B2, G1, and G2, and the chemicals 1,3-benzodioxole, eugenol, and methyleugenol were obtained from Sigma-Aldrich (St. Louis, MO, USA). Piperonal and piperine were isolated from Piper nigrum fruits, where they were analyzed and confirmed based on a series of spectrometric analyses including gas chromatography-mass spectrometry, and 1H- and 13C-nuclear magnetic resonance spectroscopy. Piperonal and piperine were also purchased from Sigma-Aldrich and compared with the corresponding compounds isolated in our laboratory. Asarone, methylenedioxy aniline, methylenedioxy phenylacetic acid, methylenedioxycinnamic acid, methylenedioxyphenyl propionic acid, and piperonyl alcohol were also purchased from Sigma-Aldrich. Ten piperine-like synthetic compounds were synthesized by Prof. Won-Sik Choi (Soonchunhyang University, Asan, Korea): 3-phenyl-1-(piperidin-1-yl)-2-en-1-one, 3-(benzo-1,3-dioxol-5-yl)-1-(piperidin-1-yl)prop-2-en-1-one, 1-(4-methylpiperidin-1-yl)-3-phenylprop-2-en-1-one, 3-(benzo-1,3-dioxol-5-yl)-1-(4-methylpiperidin-1-yl)prop-2-en-1-one, 1-(3-methylpiperidin-1-yl)-3-phenylprop-2-en-1-one, 3-(benzo-1,3-dioxol-5-yl)-1-(3-methylpiperidin-1-yl)prop-2-en-1-one, 1-(2-methylpiperidin-1-yl)-3-phenylprop-2-en-1-one (1), 3-(benzo-1,3-dioxol-5-yl)-1-(2-methylpiperidin-1-yl)prop-2-en-1-one, 1-(2,6-dimethylpiperidin-1-yl)-3-phenylprop-2-en-1-one, and 3-(benzo-1,3-dioxol-5-yl)-1-(2,6-methylpiperidin-1-yl)prop-2-en-1-one. All of the other chemicals used in this study were of the highest analytical grade and the concentrations tested for each chemical against Aspergillus flavus ATCC 22546 were presented in Table S1.

3.2. Aflatoxin Analysis by High-Performance Liquid Chromatography (HPLC)

A. flavus spores equivalent to 106 were inoculated into 25 mL of potato dextrose broth (Difco, Sparks, MD, USA) liquid culture medium, before adding one of the test compounds. After the addition of fungal spores and the test compound, the culture was incubated with shaking for 5 days at 25 °C.
At least three replicates were performed for each concentration. After incubation for 5 days, the complete medium was used to determine the growth rates by measuring the mycelial and sclerotial dry weights using filter papers, and analyses of aflatoxin B and G type mycotoxin were performed using HPLC [25]. The arithmetic means were calculated based on three replicates. Dimethyl sulfoxide (DMSO) and thiabendazole were used as negative and positive control, respectively, for all experiments.

3.3. Total RNA Isolation and Quantitative Reverse Transcription-PCR (RT-qPCR)

A. flavus mycelia in liquid cultures were harvested carefully by filtering through a cell strainer (SPL Life Sciences Co. Ltd, Gyeonggi-do, Korea). The harvested mycelia were placed in a mortar and ground to a fine powder with an appropriate amount of liquid nitrogen. Total RNA was extracted from the A. flavus mycelia using QIAzol Lysis reagent (Qiagen Inc., Dusseldorf, Germany). The RNA extracts were quantified by determining the absorbance at both 260 and 280 nm using a μDropTM Plate system (Thermo Fisher Scientific Inc., Waltham, MA, USA) and the RNA was then evaluated qualitatively by agarose gel electrophoresis (1%) with ethidium bromide.
Complementary DNA (cDNA) was prepared using a Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific Inc., Waltham, MA, USA). The RNA extracts (2 μg) were used for compound synthesis. A Rotor-Gene SYBR Green PCR Kit (Qiagen Inc.) was used with 100 ng of cDNA for RT-qPCR analysis. Specific primers synthesized by Genotech (Daejeon, Korea) were used in this study to understand the relationship between aflatoxin biosynthesis and the chemicals tested, i.e., primers for yap, aflR, aflS, aflK, aflD, and aflQ 18S rRNA (Table 3). The amplification processes were performed as follows: denaturation at 95 °C for 30 s, annealing at 60 °C for 20 s, and elongation at 72 °C for 30 s. Forty rounds amplification were conducted according to the thermal cycling procedure with a postcycling step at 95 °C for 5 min. RT-qPCR was performed three times for each sample. Differences in gene expression after the addition of the test chemicals were calculated using the ΔCt method. The data were normalized against the 18S rRNA levels and the gene expression levels were compared.

3.4. Statistical Analysis

Experiments were performed three times and the data were expressed as the mean ± standard deviation. Statistically significant differences between experimental groups were determined by two-way ANOVA analysis with Tukey’s post-hoc test. Significant differences between experimental groups were accepted at p < 0.05. The statistical analyses were performed using Prism 6 software (GraphPad, San Diego, CA, USA).

Supplementary Materials

The following are available online at www.mdpi.com/2072-6651/8/8/240/s1, Table S1: All chemicals and their concentrations tested in this study.

Acknowledgments

This research was supported by a grant (15162MFDS044) from the Ministry of Food and Drug Safety in 2015.

Author Contributions

Young-Sun Moon, Eun-Sil Park, and In Kyung Bae conducted the experiments. Won-Sik Choi prepared the synthetic compounds. Sung-Deuk Choi, Ockjin Paek and Sheen-Hee Kim supported the experimental designs and provided comments on the results. Hyang Sook Chun and Sung-Eun Lee wrote this paper and reviewed it together.

Conflicts of Interest

The authors declare no competing financial interests.

References

  1. Wu, F.; Guclu, H. Aflatoxin regulations in a network of global maize trade. PLoS ONE 2012, 7, e45151. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Wu, F. Global impacts of aflatoxin in maize: Trade and human health. World Mycotoxin J. 2015, 8, 137–142. [Google Scholar] [CrossRef]
  3. Bui-Klimke, T.R.; Guclu, H.; Kensler, T.W.; Yuan, J.M.; Wu, F. Aflatoxin regulations and global pistachio trade: Insights from social network analysis. PLoS ONE 2014, 9, e92149. [Google Scholar]
  4. Pinotti, L.; Ottoboni, M.; Giromini, C.; Dell’Orto, V.; Cheli, F. Mycotoxin contmination in the EU feed supply chain: A focus on cereal byproducts. Toxins 2016, 8, 45. [Google Scholar] [CrossRef] [PubMed]
  5. Commission Regulation (EC) No 1881/2006 of 19 December 2006 setting maximum levels for certain contaminants in foodstuffs. Available online: http://eur-lex.europa.eu/legal-content/EN/TXT/?qid=1470985026757&uri=CELEX:32006R1881 (accessed on 26 July 2016).
  6. Baquião, A.C.; de Oliveira, M.M.; Reis, T.A.; Zorzete, P.; Atayde, D.D.; Corrêa, B. Monitoring and determination of fungi and mycotoxins in stored Brazil nuts. J. Food Prot. 2013, 76, 1414–1420. [Google Scholar] [CrossRef] [PubMed]
  7. Khan, M.A.; Asghar, M.A.; Iqbal, J.; Ahmed, A.; Shamsuddin, Z.A. Aflatoxins contamination and prevention in red chillies (Capsicum annuum L.) in Pakistan. Food Addit. Contam. Part B Surveill. 2014, 7, 1–6. [Google Scholar] [CrossRef]
  8. Lee, J.; Her, J.Y.; Lee, K.G. Reductions of aflatoxins (B1, B2, G1, and G2) in soybean-based model systems. Food Chem. 2015, 189, 45–51. [Google Scholar] [CrossRef] [PubMed]
  9. Aiko, V.; Edamana, P.; Mehta, A. Decomposition and detoxification of aflatoxin B1 by lactic acid. J. Sci. Food Agric. 2015. [Google Scholar] [CrossRef]
  10. Yehia, R.S. Aflatoxin detoxification by manganese peroxidase purified from Pleurotus ostreatus. Braz. J. Microbiol. 2014, 45, 127–133. [Google Scholar] [CrossRef] [PubMed]
  11. Zeinvand-Lorestani, H.; Sabzevari, O.; Setayesh, N.; Amini, M.; Nili-Ahmadabadi, A.; Faramarzi, M.A. Comparative study of in vitro prooxidative properties and genotoxicity induced by aflatoxin B1 and its laccase-mediated detoxification products. Chemosphere 2015, 135, 1–6. [Google Scholar] [CrossRef] [PubMed]
  12. Di Stefano, V.; Pitonzo, R.; Cicero, N.; D’Oca, M.C. Mycotoxin contamination of animal feeding stuff: detoxification by gamma-irradiation and reduction of aflatoxins and ochratoxin A concentration. Food Addit. Contam. Part A Chem. Anal. Expo. Risk Assess. 2014, 31, 2034–2039. [Google Scholar] [CrossRef]
  13. Luo, X.; Wang, R.; Wang, L.; Li, Y.; Wang, Y.; Chen, Z. Detoxification of aflatoxin in corn flour by ozone. J. Sci. Food Agric. 2014, 94, 2253–2258. [Google Scholar] [CrossRef] [PubMed]
  14. Guan, S.; Zhou, T.; Yin, Y.; Xie, M.; Ruan, Z.; Young, J.C. Microbial strategies to control aflatoxins in food and feed. World Mycotoxin J. 2011, 4, 413–424. [Google Scholar] [CrossRef]
  15. Shetty, P.H.; Jespersen, L. Saccharomyces cerevisiae and lactic acid bacteria as potential decontamination agents. Trends Food Sci. Technol. 2006, 17, 48–55. [Google Scholar] [CrossRef]
  16. Kachouri, F.; Ksontini, H.; Hamdi, M. Removal of aflatoxin B1 and inhibition of Aspergillus flavus growth by the use of Lactobacillus plantarum on olives. J. Food Prot. 2014, 77, 1760–1767. [Google Scholar] [CrossRef] [PubMed]
  17. Hua, S.S.; Hernlem, B.J.; Yokoyama, W.; Sarreal, S.B. Intracellular trehalose and sorbitol synergistically promoting cell viability of a biocontrol yeast, Pichia anomala, for aflatoxin reduction. World J. Microbiol. Biotechnol. 2015, 31, 729–734. [Google Scholar] [CrossRef] [PubMed]
  18. Diao, E.; Shan, C.; Hou, H.; Wang, S.; Li, M.; Dong, H. Structures of the ozonolysis products and ozonolysis pathway of aflatoxin B1 in acetonitrile solution. J. Agric. Food Chem. 2012, 60, 9364–9370. [Google Scholar] [CrossRef] [PubMed]
  19. D’Mello, J.P.; Macdonald, A.M.C.; Postel, D.; Dijksma, W.T.P.; Dujardin, A.; Placinta, C.M. Pesticide use and mycotoxin production in Fusarium and Aspergillus phytopathogens. Euro. J. Plant Pathol. 1998, 104, 741–751. [Google Scholar]
  20. Price, C.L.; Parker, J.E.; Warrilow, A.G.; Kelly, D.E.; Kelly, S.L. Azole fungicides-understanding resistance mechanisms in agricultural fungal pathogens. Pest. Manag. Sci. 2015, 71, 1054–1058. [Google Scholar] [CrossRef] [PubMed]
  21. Shao, W.; Zhang, Y.; Ren, W.; Chen, C. Physiological and biochemical characteristics of laboratory induced mutants of Botrytis cinerea with resistance to fluazinam. Pestic. Biochem. Physiol. 2015, 117, 19–23. [Google Scholar] [CrossRef] [PubMed]
  22. Kedia, A.; Prakash, B.; Mishra, P.K.; Dubey, N.K. Antifungal and antiaflatoxigenic properties of Cuminum cyminum (L.) seed essential oil and its efficacy as a preservative in stored commodities. Int. J. Food Microbiol. 2014, 168–169, 1–7. [Google Scholar] [CrossRef] [PubMed]
  23. Kazemi, M. Effect of Carum copticum essential oil on growth and aflatoxin formation by Aspergillus strains. Nat. Prod. Res. 2015, 29, 1065–1068. [Google Scholar] [CrossRef] [PubMed]
  24. Quiles, J.M.; Manyes, L.; Luciano, F.; Manes, J.; Meca, G. Influence of the antimicrobial compound allyl isothiocyanate against the Aspergillus parasiticus growth and its aflatoxin production in pizza crust. Food. Chem. Toxicol. 2015, 83, 222–228. [Google Scholar] [CrossRef] [PubMed]
  25. Lee, S.E.; Mahoney, N.; Campbell, B.C. Inhibition of aflatoxin B1 biosynthesis by piperlongumine isolated from Piper longum L. J. Microbiol. Biotechnol. 2002, 12, 679–682. [Google Scholar]
  26. Park, E.S.; Bae, I.K.; Kim, H.J.; Lee, S.E. Novel regulation of aflatoxin B1 biosynthesis in Aspergillus flavus by piperonal. Nat. Prod. Res. 2015. [Google Scholar] [CrossRef]
  27. Reen, R.K.; Singh, J. In vitro and in vivo inhibition of pulmonary cytochrome P450 activities by piperine, a major ingredient of piper species. Indian J. Exp. Biol. 1991, 29, 568–573. [Google Scholar] [PubMed]
  28. Dinger, J.; Meye, M.R.; Maurer, H.H. In vitro cytochrome P450 inhibition potential of methylene-derived designer drugs studied with a two-cocktail approach. Arch. Toxicol. 2014. [Google Scholar] [CrossRef]
  29. Guerra, F.Q.; de Araujo, R.S.; de Sousa, J.P.; Pereira Fde, O.; Mendonca-Junior, F.J.; Barbosa-Filho, J.M.; de Oliveira Lima, E. Evaluation of antifungal and mode of action of new coumarin derivative, 7-hydroxy-6-nitro-2H-1-benzopyran-2-one, against Aspergillus spp. Evid. Based Complement. Alternat. Med. 2015. [Google Scholar] [CrossRef] [PubMed]
  30. Madhyastha, M.S.; Bhat, R.V. Aspergillus parasiticus growth and aflatoxin production on black and white pepper and the inhibitory action of their chemical constituents. Appl. Environ. Microbiol. 1984, 48, 376–379. [Google Scholar] [PubMed]
  31. Liu, H.L.; Luo, R.; Chen, X.Q.; Ba, Y.Y.; Zheng, L.; Guo, W.W.; Wu, X. Identification and simultaneous quantification of five alkaloids in Piper longum L. by HPLC-ESI-MS(n) and UPLC-ESI-MS/MS and their application to Piper nigrum L. Food Chem. 2015, 177, 191–196. [Google Scholar] [CrossRef] [PubMed]
  32. Qu, H.; Lv, M.; Xu, H. Piperine: Bioactivities and structural modifications. Mini. Rev. Med. Chem. 2015, 15, 145–156. [Google Scholar] [CrossRef] [PubMed]
  33. Schmidt-Heydt, M.; Rufer, C.E.; Abdel-Hadi, A.; Magan, N.; Geisen, R. The production of aflatoxin B1 or G1 by Aspergillus parasiticus at various combinations of temperature and water activity is related to the ratio of aflS to aflR expression. Mycotoxin Res. 2010, 26, 241–246. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Figure 1. Piperine-like synthetic compounds used in this study.
Figure 1. Piperine-like synthetic compounds used in this study.
Toxins 08 00240 g001
Figure 2. RT-PCR results obtained for six genes involved in aflatoxin biosynthesis (aflD, aflK, aflQ, aflR, aflS, and yap), which were regulated by 1-(2-methylpiperidin-1-yl)-3-phenylprop-2-en-1-one (1). 1, Control; 2, 1000 μg/mL of 1; 3, 100 μg/mL of 1; 4, 10 μg/mL of 1.
Figure 2. RT-PCR results obtained for six genes involved in aflatoxin biosynthesis (aflD, aflK, aflQ, aflR, aflS, and yap), which were regulated by 1-(2-methylpiperidin-1-yl)-3-phenylprop-2-en-1-one (1). 1, Control; 2, 1000 μg/mL of 1; 3, 100 μg/mL of 1; 4, 10 μg/mL of 1.
Toxins 08 00240 g002
Table 1. Mycelial growth and aflatoxin (AF) production of Aspergillus flavus after treatment with various methylenedioxy-containing compounds.
Table 1. Mycelial growth and aflatoxin (AF) production of Aspergillus flavus after treatment with various methylenedioxy-containing compounds.
CompoundConcentration (μg/mL)Mycelial Growth Compared with the Control (%)Aflatoxin Production Compared with the Control (%)
AFB1AFB2AFG1AFG2
Thiabendazole (Positive control)101.3 ± 2.3- *---
56.90 ± 11.1ND **ND35.2 ± 2.60ND
1105 ± 26.1>150>150131 ± 65.7ND
1,3-Benzodioxole100017.0 ± 3.100.03 ± 0.050.2 ± 0.42.0 ± 1.70.8 ± 1.3
10084.6 ± 5.9025.2 ± 29.826.6 ± 17.90.4 ± 0.323.5 ± 13.9
Methylenedioxy phenylacetic acid10046.0 ± 19.7----
1078.8 ± 18.4----
Piperine3000133 ± 6.020.7 ± 0.11.6 ± 0.20.3 ± 0.655.2 ± 16.7
1000119 ± 6.7039.1 ± 3.10107 ± 27.121.6 ± 5.542.4 ± 0.053
Sesamol100034.9 ± 15.1140 ± 36.0>15038.4 ± 1.8340.1 ± 34.7
100114 ± 8.92----
Piperonal100034.8 ± 1.1710.5 ± 1.14100 ± 46.221.3 ± 1.22>150
100 *93.9 ± 5.0645.0 ± 47.110.5 ± 6.120.30 ± 0.3123.9 ± 19.8
* Not tested; ** ND, Not Detectable.
Table 2. Mycelial growth and aflatoxin (AF) production of Aspergillus flavus after treatment with piperine-like synthetic compounds.
Table 2. Mycelial growth and aflatoxin (AF) production of Aspergillus flavus after treatment with piperine-like synthetic compounds.
CompoundConcentration (μg/mL)Mycelial Growth Compared with the Control (%)Aflatoxin Production Compared with the Control (%)
AFB1AFB2AFG1AFG2
Thiabendazole (Positive control)101.3 ± 2.3- *---
56.90 ± 11.1ND **ND35.2 ± 2.64ND
1105 ± 26.1>150.0>150.0131 ± 65.7ND
1-(2-Methylpiperidin-1-yl)-3-phenylprop-2-en-1-one100010.3 ± 17.8NDND35.51ND
10064.3 ± 10.1NDND89.18ND
10-47.0 ± 2.4569.4 ± 5.8347.1 ± 6.08ND
1-38.0 ± 44.376.3 ± 55.9122 ± 72.2104 ± 58.0
3-(Benzo-1,3-dioxol-5-yl)-1-(2-methylpiperidin-1-yl)prop-2-en-1-one100027.5 ± 5.43NDND64.755.9
10084.9 ± 31.896.4 ± 75.376.2 ± 55.9122 ± 82.2104 ± 57.9
1087.6 ± 18.6>150>150.00>150.00>150.00
* Not tested; ** ND, Not detectable.
Table 3. Gene-specific primers used for RT-qPCR.
Table 3. Gene-specific primers used for RT-qPCR.
GeneSequence
yapForward5’ TGCAACCTCTCTACAAGCCG 3’
Reverse5’ CCGAAGTCTCGAGAAAGAGCC 3’
aflRForward5’ GCACCCTGTCTTCCCTAACA 3’
Reverse5’ ACGACCATGCTCAGCAAGTA 3’
aflSForward5’ GGAATGGGATGGAGATG 3’
Reverse5’ GGAATATGGCTGTAGGAAG 3’
aflKForward5’ GAACTGCTTCAGTTGCCGTG 3’
Reverse5’ ACGAGGGTTCGTTTCTGGAC 3’
aflDForward5’ TCCAGGCACACATGATGGTC 3’
Reverse5’ TGTGGATAACGAAGTGCCCC 3’
aflQForward5’ TTAAGGCAGCGGAATACAAG 3’
Reverse5’ GACGCCCAAAGCCGAACACAAA 3’
18S rRNAForward5’ ATGGCCGTTCTTAGTTGGTG 3’
Reverse5’ GTACAAAGGGCAGGGACGTA 3’

Share and Cite

MDPI and ACS Style

Moon, Y.-S.; Choi, W.-S.; Park, E.-S.; Bae, I.K.; Choi, S.-D.; Paek, O.; Kim, S.-H.; Chun, H.S.; Lee, S.-E. Antifungal and Antiaflatoxigenic Methylenedioxy-Containing Compounds and Piperine-Like Synthetic Compounds. Toxins 2016, 8, 240. https://doi.org/10.3390/toxins8080240

AMA Style

Moon Y-S, Choi W-S, Park E-S, Bae IK, Choi S-D, Paek O, Kim S-H, Chun HS, Lee S-E. Antifungal and Antiaflatoxigenic Methylenedioxy-Containing Compounds and Piperine-Like Synthetic Compounds. Toxins. 2016; 8(8):240. https://doi.org/10.3390/toxins8080240

Chicago/Turabian Style

Moon, Young-Sun, Won-Sik Choi, Eun-Sil Park, In Kyung Bae, Sung-Deuk Choi, Ockjin Paek, Sheen-Hee Kim, Hyang Sook Chun, and Sung-Eun Lee. 2016. "Antifungal and Antiaflatoxigenic Methylenedioxy-Containing Compounds and Piperine-Like Synthetic Compounds" Toxins 8, no. 8: 240. https://doi.org/10.3390/toxins8080240

APA Style

Moon, Y.-S., Choi, W.-S., Park, E.-S., Bae, I. K., Choi, S.-D., Paek, O., Kim, S.-H., Chun, H. S., & Lee, S.-E. (2016). Antifungal and Antiaflatoxigenic Methylenedioxy-Containing Compounds and Piperine-Like Synthetic Compounds. Toxins, 8(8), 240. https://doi.org/10.3390/toxins8080240

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop