Next Article in Journal
The Response of Selected Triticum spp. Genotypes with Different Ploidy Levels to Head Blight Caused by Fusarium culmorum (W.G.Smith) Sacc.
Next Article in Special Issue
Toxin-Antitoxin Systems of Staphylococcus aureus
Previous Article in Journal
Ochratoxin A: Molecular Interactions, Mechanisms of Toxicity and Prevention at the Molecular Level
Previous Article in Special Issue
ADAM10 Cell Surface Expression but Not Activity Is Critical for Staphylococcus aureus α-Hemolysin-Mediated Activation of the NLRP3 Inflammasome in Human Monocytes
 
 
Due to scheduled maintenance work on our servers, there may be short service disruptions on this website between 11:00 and 12:00 CEST on March 28th.
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Detection of Enterotoxigenic Potential and Determination of Clonal Profile in Staphylococcus aureus and Coagulase-Negative Staphylococci Isolated from Bovine Subclinical Mastitis in Different Brazilian States

by
Priscila Luiza Mello
1,
Danilo Flávio Moraes Riboli
1,
Luiza Pinheiro
1,2,
Lisiane De Almeida Martins
3,
Maria Aparecida Vasconcelos Paiva Brito
4 and
Maria De Lourdes Ribeiro de Souza da Cunha
1,*
1
Department of Microbiology and Immunology, Institute of Biosciences of Botucatu, UNESP-Univ Estadual Paulista, Botucatu 18618-970, Brazil
2
Department of Anatomic Pathology, Instituto Lauro de Souza Lima, Bauru 17034-971, Brazil
3
Universidade Paranaense-UNIPAR, Umuarama 87502-210, Brazil
4
Embrapa Dairy Cattle, Juiz de Fora 36038-330, Brazil
*
Author to whom correspondence should be addressed.
Toxins 2016, 8(4), 104; https://doi.org/10.3390/toxins8040104
Submission received: 6 October 2015 / Revised: 15 January 2016 / Accepted: 20 January 2016 / Published: 15 April 2016
(This article belongs to the Collection Staphylococcus aureus Toxins)

Abstract

:
Epidemiological studies have identified Staphylococcus aureus as the most common agent involved in food poisoning. However, current research highlights the importance of toxigenic coagulase-negative staphylococci (CoNS) isolated from food. The aim of this study was to characterize Staphylococcus spp. isolated from cows with bovine subclinical mastitis regarding the presence of genes responsible for the production of staphylococcal enterotoxins and of the tst-1 gene encoding toxic shock syndrome toxin 1, and to determine the clonal profile of the isolates carrying any of the genes studied. A total of 181 strains isolated in different Brazilian states, including the South, Southeast, and Northeast regions, were analyzed. The sea gene was the most frequent, which was detected in 18.2% of the isolates, followed by seb in 7.7%, sec in 14.9%, sed in 0.5%, see in 8.2%, seg in 1.6%, seh in 25.4%, sei in 6.6%, and ser in 1.6%. The sej, ses, set, and tst-1 genes were not detected in any of the isolates. The typing of the isolates by pulsed-field gel electrophoresis revealed important S. aureus and S. epidermidis clusters in different areas and the presence of enterotoxin genes in lineages isolated from animals that belong to herds located geographically close to each other.

Graphical Abstract

1. Introduction

Several microorganisms are involved in mammary gland infections in production animals. National and international epidemiological studies have demonstrated the presence of the genus Staphylococcus in approximately 50% of bovine mastitis cases, highlighting the role of this group as the main causative agent of this infection [1]. Although Staphylococcus aureus is the most common agent involved in subclinical mastitis, coagulase-negative staphylococci (CoNS) have gained importance as causative agents of intramammary infections. In a study conducted in Brazil, Rall et al. [2] found a prevalence of these microorganisms of 27.4%, while 28.6% of the isolates were S. aureus in a study conducted in Turkey [3].
Studies [4,5] have emphasized the importance of toxigenic CoNS isolated from food. Therefore, although S. aureus is the most common agent involved in food poisoning, there is current concern in the scientific community regarding CoNS, which have been recognized as opportunistic pathogens in human and animal infections, allied to risks of toxigenic lineages in cases of food poisoning in humans [5].
The staphylococcal enterotoxins (SE) type A (sea), B (seb), C (sec), D (sed), and E (see) are the classical staphylococcal toxins. These toxins have emetic activity and are usually associated with outbreaks of food poisoning [6]. In addition, recently described enterotoxins (ses and set), enterotoxin-like (SE-like) toxins that do exert emetic activity, and toxic shock syndrome toxin 1 (tst-1) are known [6,7]. The staphylococcal enterotoxin R (ser) was first described as an enterotoxin-like toxin by Omoe et al. [6], but experimental studies later proved its emetic activity [8].
The objective of this study was to characterize the enterotoxigenic potential of Staphylococcus spp. isolated from cattle with subclinical mastitis in six Brazilian states: Paraná (PR), Santa Catarina (SC), Rio Grande do Sul (RS), São Paulo (SP), Minas Gerais (MG), and Pernambuco (PE). Additionally, we determined the clonal profile and geographic distribution of the S. aureus and S. epidermidis strains that carried any of these genes.

2. Results

2.1. Identification of the Strains

Among the 181 strains studied, 82 (45.3%) were identified as S. aureus and 99 (54.7%) as CoNS, including 27 (14.9%) S. chromogenes, 26 (14.4%) S. epidermidis, 17 (9.4%) S. saprophyticus, 6 (3.3%) S. warneri, 6 (3.3%) S. simulans, 6 (3.3%) S. haemolyticus, 5 (2.8%) S. hyicus, 4 (2.2%) S. hominis, and 2 (1.1%) S. xylosus.

2.2. Detection of Enterotoxin and tst-1 Genes

Seventy-six (41.9%) of the 181 strains were positive for at least one of the genes studied. The sea gene was detected in 33 (18.2%) of the isolates, seb in 14 (7.7%), sec in 27 (14.9%), sed in 1 (0.5%), see in 15 (8.2%), seg in 3 (1.6%), seh in 46 (25.4%), sei in 12 (6.6%), and ser in 3 (1.6%). The sej, ses, set, and tst-1 genes were not detected in any of the strains studied (Table 1). Figure 1 shows the comparison of toxin gene detection in the Staphylococcus aureus and CoNS isolates.

2.3. Distribution of Staphylococcal Enterotoxin Genes According to the Region Studied

Figure 2 shows the geographic distribution of enterotoxin gene-positive Staphylococcus spp. isolates. The sea and seb genes were found to coexist with the other genes studied and were detected in Staphylococcus spp. isolates from all Brazilian states, except for the state of Minas Gerais where only isolates carrying the sec gene were detected.
The sei and ser genes were only detected in Staphylococcus spp. from the southern states (PR, SC, and RS).

2.4. Determination of Clonal Profile

Molecular typing by Pulsed-field gel electrophoresis (PFGE) was performed only on the S. aureus and S. epidermidis isolates that in which any enterotoxin genes had been detected. Therefore, among the 181 strains included in the study, 27 S. aureus isolates and 15 S. epidermidis isolates were analyzed, corresponding to the species with the highest prevalence of strains carrying enterotoxin genes.
Analysis permitted the identification of three S. aureus clusters that simultaneously included ≥3 isolates with similarity ≥80% (Figure 3, Table 2). Similarity was 100% in all groups. Cluster A, consisting of seven strains, contained a larger number of isolates with enterotoxigenic potential. This cluster comprised six isolates from Paraná and one isolate from São Paulo. The other clusters (B and C) also contained isolates from the South region, but from the state of Santa Catarina (Table 2). Cluster B comprised isolates originating from different states (SC and RS).
When the profile of S. epidermidis was analyzed, two clusters (A and B) were found. Each cluster contained three isolates from the South region (PR and SC, respectively) (Figure 4).

3. Discussion

The sea gene, which exhibited the highest prevalence in this study (18.2%) and was detected in S. aureus and CoNS strains, is carried by a prophage [9] and can be easily disseminated among Staphylococcus spp. strains. Its product, enterotoxin A, is frequently associated with food poisoning since it is toxic at low concentrations [10,11]. Enterotoxin A is produced at the beginning of the exponential phase and its expression is not regulated by the accessory gene regulator (agr), different from enterotoxins B, C, and D, which depend on the agr system for maximum expression [11,12]. The sec gene is located on pathogenicity islands and can be divided into three subtypes (sec1, sec2, and sec3) based on antigenic differences and on the animal host with which it is associated. Some studies suggest that the heterogeneity of enterotoxin C is related to selection for modified sec sequences that facilitate the survival of S. aureus in their respective hosts [11,13]. In the present study, sec was the second most common classical enterotoxin after sea.
The sed gene was detected in only 0.5% of the strains studied, in an S. epidermidis isolate. This gene was not detected by Calsolari et al. [3] in toxigenic CoNS isolates, with only one S. aureus strain being positive. The sed gene is located on plasmid pIB485 [14] and enterotoxin D is the second most common toxin associated with food poisoning [11]. A small amount of this enterotoxin is able to cause illness, mainly in children and the elderly [15,16]. Nonetheless, the near absence of sed in the strains studied here suggests that it is scarcely related with Staphylococcus spp. isolates from mastitis cases in these regions of Brazil and consequently with possible events of food poisoning.
The data of a study on isolates from dairy products responsible for food poisoning in the state of Minas Gerais [16] are consistent with studies demonstrating that sea and seb are the most prevalent among the toxins identified [5]. The same study [16] showed the production of staphylococcal enterotoxins by CoNS using immunological assays.
The see gene was also detected in a small percentage (8.2%) and was not found in the study of Srinivasan et al. [17] who investigated S. aureus strains isolated from milk of cows with mastitis in the region of Tennessee, USA. None of the 78 isolates was positive for that gene. The see gene is carried by a prophage and studies have shown that the see, sed, and sea genes are closely related, with 81% sequence homology between see and sea [11,18].
Although the sei gene was only detected in a small percentage (6.6%), it was present in CoNS strains, which is an important fact rarely described in the literature. In contrast, in the study of Srinivasan et al. [17], 47 (60.3%) of the 78 S. aureus isolates studied carried the gene.
The ser gene was detected in three S. aureus isolates, all from the South regions. This gene was found to coexist with some other enterotoxins since two strains from SC carried the combination ser + sea or ser + sec, while in the third isolate from RS, ser was associated with the enterotoxin I gene (sei). These data highlight the importance of knowledge on movable genetic elements that can transfer these genes among Staphylococcus spp. The same has been described by Lawrynowicz-Paciorek et al. [19] who also evaluated the frequency of coexisting genes.
Regarding the clonal profile, several epidemiological studies on S. aureus in cattle have demonstrated the involvement of a large number of molecular profiles in the etiology of mastitis in the world. However, certain profiles tend to predominate in different geographic regions [19,20]. In the present study, a large number of S. aureus strains grouped with ≥80% similarity were observed, even when the region studied included two different states, such as clusters A and B. In both cases, the source of one isolate differed from that of the others. This similarity among isolates obtained from animals that belong to herds from different states can be explained by the trade of animals between farms.
According to Buzolla et al. [21], strains with identical genotypes may possess characteristics that convey advantages for their survival in the environment, to colonize the udder, and/or to cause diseases. This fact was proven in the present study of enterotoxin genes, which demonstrated the presence of clusters with the same profile in different locations. Mechanical milking machines are important sources of transmission of staphylococci in dairy herds since they can be contaminated with microorganisms derived from the animal’s skin and milk, or even from the hands of the operators [22].
Taken together, the results of clonal profile analysis showed the existence of important genetic similarity among the isolates, particularly among S. aureus isolated from intramammary infections of herds from different Brazilian states. Furthermore, PFGE was found to be an excellent technique to detect these clones, permitting the establishment of emergency control measures to prevent subsequent dissemination of virulent strains.

4. Experimental Section

4.1. Origin and Identification of the Strains

The 181 Staphylococcus spp. strains isolated from cows with bovine subclinical mastitis were provided by Embrapa Dairy Cattle. The strains were isolated in six Brazilian states: Paraná (PR), Santa Catarina (SC), and Rio Grande do Sul (RS); São Paulo (SP) and Minas Gerais (MG); and Pernambuco (PE), corresponding to the South, Southeast, and Northeast regions of Brazil, respectively.
The phenotypic and genotypic identification of these strains was performed for confirmation of the genus and correct identification of the species. The genus Staphylococcus was identified as described by Koneman et al. [23] using coagulase and sugar (trehalose, maltose, and mannitol) fermentation tests. Strains belonging to the CoNS group were submitted to biochemical tests as proposed by Cunha et al. [24] for phenotypic identification of the species. Total DNA was extracted using the illustra® kit (GE Healthcare, Little Chalfont, Buckinghamshire, UK). Genotypic identification of CoNS was performed using primers targeting conserved sequences adjacent to the 16S and 23S genes by the internal transcribed spacer-polymerase chain reaction (ITS-PCR) described by Barry et al. [25] and Couto et al. [26], using primers G1 and L1. PCR using the Staur-4 and Staur-6 primers developed by Straub et al. [27] was used for S. aureus. The S. aureus ATCC 33591 reference strain was used as the positive control. The amplification efficiency was monitored by 2% agarose gel electrophoresis stained with Saber Safe DNA Gel Strain® (São Paulo, SP, Brazil) viewed under a UV transilluminator.
The reference strains used for ITS were: S. chromogenes (ATCC 43764), S. epidermidis (ATCC 12228), S. saprophyticus (ATCC 15305), S. xylosus (ATCC 29979), S. hyicus (ATCC 11249), S. hominis (ATCC 27844), S. warneri (ATCC 10209), S. simulans (ATCC 27851), and S. haemolyticus (ATCC 29970).

4.2. Detection of Enterotoxin and tst-1 Genes

PCR for the detection of the enterotoxin and tst-1 genes was performed according to the parameters described by Johnson et al. [28] and Cunha et al. [5].
The following toxigenic S. aureus reference strains were used as positive control: ATCC 13565 (sea; ser), ATCC 14458 (seb), ATCC 19095 (sec), ATCC 23235 (sed), ATCC 27664 (see), S. aureus Food Research Institute-FRI 361 (sei), and ATCC 51650 (tst). Staphylococcus xylosus ATCC 29971 was used as the negative control. The primer sequences are shown in Table 3.

4.3. Analysis by Pulsed-Field Gel Electrophoresis

The Staphylococcus spp. isolates that were positive for the enterotoxins by PCR were submitted to clonal profile analysis by pulsed-field gel electrophoresis (PFGE) according to the modified protocol of McDougal et al. [33].
The BioNumerics software (Version 7.0, Applied Maths, Sint-Martens-Latem, Belgium, 2015) was used for similarity analysis. Dice correlation coefficients were calculated and a dendrogram was generated using the UPGMA method (unweighted pair group method using arithmetic averages). Band position tolerance and optimization were set at 1.25% and 1%, respectively. A similarity coefficient of 80% was chosen for the definition of clusters.

4.4. Spatial Distribution of Staphylococcal Enterotoxin Genes in Different Regions of Brazil

The addresses of all isolates were geocoded and added to the BioNumerics program (Version 7.0, Applied Maths, Sint-Martens-Latem, Belgium, 2015). Only strains carrying some staphylococcal enterotoxin genes or toxic shock syndrome were adopted as inclusion criteria on the map.

5. Conclusions

The enterotoxin A gene exhibited the highest prevalence in the present study, suggesting its easy dissemination among Staphylococcus spp. strains, since it was widespread in the georeferencing study. The recently described enterotoxin R gene is already found in isolates from some of the regions in Brazil and coexists with previously described enterotoxins. This fact poses a risk for the dissemination of this new type of enterotoxin among cattle herds. A limitation of the present study was the fact that we did not perform gene expression analysis since the simple presence of enterotoxin genes in Staphylococcus spp. isolates does not imply the occurrence of food poisoning. However, the present results contribute to the understanding of the enterotoxigenic profile of isolates from cows with bovine subclinical mastitis in different Brazilian herds, especially when considering that they are one of the most common microorganisms involved in intramammary infections in cattle and that milk is an excellent growth medium for Staphylococcus spp. The study also identified important S. aureus and S. epidermidis clusters in different regions and the presence of enterotoxin genes in lineages isolated from animals that belong to herds located geographically close to each other.

Acknowledgments

Financial support: Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP; Grants 2012/24135-0 and 2015/01401-4) and CNPq (Grant 578430/2008-8).

Author Contributions

Priscila Luiza Mello: Designed and conducted the study, collected part of the strains, performed the laboratory and molecular experiments, analyzed the data, and wrote the manuscript; Danilo Flávio Moraes Riboli: Participated in the laboratory experiments, performed the pulsed-field analysis, and contributed to the analysis of the georeferenced data; Luiza Pinheiro: Contributed to the molecular experiments and to the analysis of the georeferenced data; Lisiane de Almeida Martins: Participated in the design of the study and in sending part of the strains; Maria Aparecida Vasconcelos Paiva Brito: Participated in the design of the study and coordinated the main project that allowed the isolation of strains from different Brazilian states; Maria de Lourdes Ribeiro de Souza da Cunha: Coordinated the study, participated in the design of the study, and revised the manuscript. All authors have read and approved the final version of the manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Radostitis, O.M.; Gay, C.C.; Hinchcliff, K.W.; Constable, P.D. Veterinary medicine. In A Textbook of the Disease of Cattle, Horses, Sheep, Pigs and Goats, 10th ed.; Saunders Elsevier: Philadelphia, PA, USA, 2007; p. 2156. [Google Scholar]
  2. Rall, V.L.; Miranda, E.S.; Castilho, I.G.; Camargo, C.H.; Langoni, H.; Guimarães, F.F.; Júnior, J.P.A.; Júnior, A.F. Diversity of Staphylococcus species and prevalence of enterotoxin genes isolated from milk of healthy cows and cows with subclinical mastitis. J. Dairy Sci. 2014, 97, 829–837. [Google Scholar] [CrossRef] [PubMed]
  3. Karahan, M.N.; Açik, B. Çetinkaya investigation of toxin genes by polymerase chain reaction in Staphylococcus aureus strains isolated from bovine mastitis in Turkey. Foodborne Pathog. Dis. 2009, 6, 1029–1035. [Google Scholar] [CrossRef] [PubMed]
  4. Calsolari, R.A.O.; Pereira, V.C.P.; Júnior, J.P.A.; Cunha, M.L.R.S. Determination of toxigenic capacity by RT-PCR in coagulase-negative staphylococci and Staphylococcus aureus isolated from newborns in Brazil. Microbiol. Immunol. 2011, 55, 394–407. [Google Scholar] [CrossRef] [PubMed]
  5. Cunha, M.L.R.S.; Peresi, E.; Calsolari, R.A.O.; Júnior, J.P.A. Detection of enterotoxins genes on coagulase-negative staphylococci isolated from foods. Braz. J. Microbiol. 2006, 37, 70–74. [Google Scholar] [CrossRef]
  6. Omoe, K.; Imanishi, K.; Hu, D.L.; Kato, H.; Takahashi-Omoe, H.; Nakane, A.; Uchiyama, T.; Shinagawa, K. Biological properties of staphylococcal enterotoxin-like toxin type R. Infect. Immun. 2004, 72, 3664–3667. [Google Scholar] [CrossRef] [PubMed]
  7. List of Prokaryotic Names with Standing in Nomenclature—Genus Staphylococcus. Available online: http://www.bacterio.net/ (accessed on 6 September 2015).
  8. Ono, H.K.; Omoe, K.; Imanishi, K.; Iwakabe, Y.; Hu, D.L.; Kato, H.; Saito, N.; Nakane, A.; Uchiyama, T.; Shinagawa, K. Identification and characterization of two novel staphylococcal enterotoxins, types S and T. Infect. Immun. 2008, 76, 4999–5005. [Google Scholar] [CrossRef] [PubMed]
  9. Borst, D.W.; Betley, M.J. Phage-associated differences in staphylococcal enterotoxin A gene (sea) expression correlate with sea allele class. Infect. Immun. 1994, 62, 113–118. [Google Scholar] [PubMed]
  10. Evenson, M.L.; Hinds, M.W.; Bernstein, R.S.; Bergdoll, M.S. Estimation of human dose of staphylococcal enterotoxin A from a large outbreak of staphylococcal food poisoning involving chocolate milk. Int. J. Food Microbiol. 1988, 7, 311–316. [Google Scholar] [PubMed]
  11. Balaban, N.; Rasooly, A. Staphylococcal enterotoxins. Int. J. Food Microbiol. 2000, 61, 1–10. [Google Scholar] [CrossRef]
  12. Tremaine, M.T.; Brockman, D.K.; Betley, M.J. Staphylococcal enterotoxin A gene (sea) expression is not affected by the accessory gene regulator (agr). Infect. Immun. 1993, 61, 56–359. [Google Scholar]
  13. Marr, J.C.; Lyon, J.D.; Roberson, J.R.; Lupher, M.; Davis, W.C.; Bohach, G.A. Characterization of novel type C staphylococcal enterotoxins: Biological and evolutionary implications. Infect. Immun. 1993, 61, 4254–4262. [Google Scholar] [PubMed]
  14. Bayles, K.W.; Iandolo, J.J. Genetic and molecular analyses of the gene encoding staphylococcal enterotoxin D. J. Bacteriol. 1989, 171, 4799–4806. [Google Scholar] [PubMed]
  15. Kokan, N.P.; Bergdoll, M.S. Detection of low-enterotoxin-producing Staphylococcus aureus strains. Appl. Environ. Microbiol. 1987, 53, 2675–2676. [Google Scholar] [PubMed]
  16. Veras, J.F.; Simeão, L.C.; Lawrence, C.T.; Jefrey, W.S.; Christiano, C.; Santos, D.A.; Cerqueira, M.M.O.P.; Cantini, A.; Nicoli, J.R.; Jett, M. A study of the enterotoxigenicity of coagulase-negative and coagulase-positive staphylococcal isolates from food poisoning outbreaks in Minas Gerais, Brazil. Int. J. Infect. Dis. 2008, 12, 410–415. [Google Scholar] [CrossRef] [PubMed]
  17. Srinivasan, V.; Sawant, A.A.; Gillespie, B.E.; Headrick, S.J.; Ceasaris, L.; Oliver, S.P. Prevalence of enterotoxin and toxic shock syndrome toxin genes in Staphylococcus aureus isolated from milk of cows with mastitis. Foodborne Pathog. Dis. 2006, 3, 274–283. [Google Scholar] [CrossRef] [PubMed]
  18. Van den Bussche, R.A.; Lyon, J.D.; Bohach, G.A. Molecular evolution of the staphylococcal and streptococcal pyrogenic toxin gene family. Mol. Phylogenet. 1993, 2, 281–292. [Google Scholar] [CrossRef] [PubMed]
  19. Lawrynowicz-Paciorek, M.; Kochman, M.; Grochowska, A.; Windyga, B. The distribution of enterotoxin and enterotoxin-like genes in Staphylococcus aureus strains isolated from nasal carriers and food samples. Int. J. Food Microbiol. 2007, 117, 319–332. [Google Scholar] [CrossRef] [PubMed]
  20. Akineden, Ö.; Annemüller, C.; Hassan, A.A.; Lämmler, C.; Wolter, W.; Zschöck, M. Toxin genes and other characteristics of Staphylococcus aureus isolates from milk of cows with mastitis. Clin. Diagn. Lab. Immun. 2001, 8, 959–964. [Google Scholar] [CrossRef] [PubMed]
  21. Buzzola, F.R.; Quelle, L.; Gomez, M.I.; Catalano, M.; Steele-Moore, L.; Berg, D.; Gentilini, E.; Denamiel, G.; Sordelli, D.O. Genotypic analysis of Staphylococcus aureus from milk of dairy cows with mastitis in Argentina. Epidemiol. Infect. 2001, 126, 445–452. [Google Scholar] [CrossRef] [PubMed]
  22. Almeida, L.M.D.; Mamizuka, E.M.; Cunha, M.L.R.S.C.; Zafalon, L.F. Fatores de Virulência e Genes Regulatórios agr de Staphylococcus aureus e Outras Espécies Coagulase Positivas Isoladas de Mastites Bovina e Ovina; Universidade de São Paulo: São Paulo, Brazil, 2009. (In Portuguese) [Google Scholar]
  23. Koneman, E.W.; Allen, S.D.; Janda, W.M.; Schreckenberger, P.C.; Winn, W.C., Jr. Color Atlas and Textbook of Diagnostic Microbiology, 5th ed.; Lippincott: Philadelphia, PA, USA, 1997. [Google Scholar]
  24. Cunha, M.L.R.S.; Sinzato, Y.K.; Silveira, L.V.A. Comparision of methods for identification of Coagulase-negative Staphylococci. Mem. Inst. Oswaldo Cruz 2004, 99, 855–860. [Google Scholar] [CrossRef]
  25. Barry, T.; Colleran, G.; Glennon, M.; Dunican, L.K.; Gannon, F. The 16S/23S ribosomal spacer region as a target for DNA probes to identify eubacteria. PCR Methods Appl. 1991, 1, 51–56. [Google Scholar] [CrossRef] [PubMed]
  26. Couto, I.; Pereira, S.; Miragaia, M.; Sanches, I.S.; Lencastre, H. Identification of clinical staphylococcal isolates from humans by Internal Transcribed Spacer PCR. J. Clin. Microbiol. 2001, 39, 3099–3103. [Google Scholar] [CrossRef]
  27. Straub, J.A.; HerteL, C.; Hammes, W.P. A 23S rDNA-targeted polymerase chain reaction-based system for detection of Staphylococcus aureus in meat starter cultures and dairy products. J. Food Prot. 1999, 62, 1150–1156. [Google Scholar] [PubMed]
  28. Johnson, W.M.; Tyler, S.D.; Ewan, E.P.; Ashton, F.E.; Pollard, D.R.; Rozee, K.R. Detection of genes for enterotoxins, exfoliative toxins, and toxic shock syndrome toxin 1 in Staphylococcus aureus by the polymerase chain reaction. J. Clin. Microbiol. 1991, 29, 426–430. [Google Scholar] [PubMed]
  29. Jarraud, S.; Cozon, G.; Vandenesch, F.; Bes, M.; Etienne, J.; Lina, G. Involvement of enterotoxins G and I in staphylococcal toxic shock syndrome and staphylococcal scarlet fever. J. Clin. Microbiol. 1999, 37, 2446–2449. [Google Scholar] [PubMed]
  30. Jarraud, S.; Mougel, C.; Thioulouse, J.; Lina, G.; Meugnier, H.; Forey, F. Relationships between Staphylococcus genetic background, virulence factors, agr groups (alleles), and human disease. Infect. Imunn. 2002, 70, 631–641. [Google Scholar] [CrossRef]
  31. Monday, S.R.; Bohach, G.A. Use of multiplex PCR to detect classical and newly described pyrogenic toxin genes in staphylococcal isolates. J. Clin. Microbiol. 1999, 37, 3411–3414. [Google Scholar] [PubMed]
  32. Chiang, Y.C.; Liao, W.W.; Fan, C.M.; Pai, W.Y.; Chiou, C.S.; Tsen, H.Y. PCR detection of staphylococcal enterotoxins (SEs) N, O, P, Q, R, U, and survey of SE types in Staphylococcus aureus isolates from food-poisoning cases in Taiwan. Int. J. Food Microbiol. 2008, 121, 66–73. [Google Scholar] [CrossRef] [PubMed]
  33. McDougal, L.K.; Steward, C.D.; Killgore, G.E.; Chaitram, J.M.; McAllister, S.K.; Tenover, F.C. Pulsed-field gel electrophoresis typing of oxacillin-resistant Staphylococcus aureus isolates from the United States: establishing a national database. J. Clin. Microbiol. 2003, 41, 5113–5120. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Detection of staphylococcal enterotoxins in Staphylococcus aureus and Coagulase-negative Staphylococci (CoNS) isolated from cows with bovine subclinical mastitis.
Figure 1. Detection of staphylococcal enterotoxins in Staphylococcus aureus and Coagulase-negative Staphylococci (CoNS) isolated from cows with bovine subclinical mastitis.
Toxins 08 00104 g001
Figure 2. Geographic distribution of enterotoxin gene-positive Staphylococcus spp. strains isolated from cows with bovine subclinical mastitis in different Brazilian states.
Figure 2. Geographic distribution of enterotoxin gene-positive Staphylococcus spp. strains isolated from cows with bovine subclinical mastitis in different Brazilian states.
Toxins 08 00104 g002
Figure 3. Determination of the clonal profile of Staphylococcus aureus strains carrying staphylococcal enterotoxin genes. The highlighted strain is interesting because of its similarity to isolates with origin in different states of Brazil (cluster A). The red lines highlight the division of the clusters and the red boxes highlight samples from different states within the cluster. Dendrogram generated by Dice/Unweighted pair group method using arithmetic averages (UPGMA) analysis (BioNumerics, Applied Maths). PR: Paraná; SP: São Paulo; SC: Santa Catarina; RS: Rio Grande do Sul.
Figure 3. Determination of the clonal profile of Staphylococcus aureus strains carrying staphylococcal enterotoxin genes. The highlighted strain is interesting because of its similarity to isolates with origin in different states of Brazil (cluster A). The red lines highlight the division of the clusters and the red boxes highlight samples from different states within the cluster. Dendrogram generated by Dice/Unweighted pair group method using arithmetic averages (UPGMA) analysis (BioNumerics, Applied Maths). PR: Paraná; SP: São Paulo; SC: Santa Catarina; RS: Rio Grande do Sul.
Toxins 08 00104 g003
Figure 4. Determination of the clonal profile of Staphylococcus epidermidis strains carrying staphylococcal enterotoxin genes. Dendrogram generated by Dice/UPGMA analysis (BioNumerics, Applied Maths). The red lines highlight the division of the clusters.
Figure 4. Determination of the clonal profile of Staphylococcus epidermidis strains carrying staphylococcal enterotoxin genes. Dendrogram generated by Dice/UPGMA analysis (BioNumerics, Applied Maths). The red lines highlight the division of the clusters.
Toxins 08 00104 g004
Table 1. Number of strains evaluated (n) and detection of enterotoxin genes in Staphylococcus species isolated from cows with bovine subclinical mastitis in different Brazilian states.
Table 1. Number of strains evaluated (n) and detection of enterotoxin genes in Staphylococcus species isolated from cows with bovine subclinical mastitis in different Brazilian states.
Species(n)seasebsecsedseesegsehseisejsersessettst-1
S. aureus(82)159604121903000
S. chromogenes(27)50501010100000
S. epidermidis(26)3281416000000
S. saprophyticus(17)5110204000000
S. haemolyticus(6)1120100000000
S. simulans(6)1010101000000
S. warneri(6)0020102100000
S. hyicus(5)2110111100000
S. hominis(4)0000001000000
S. xylosus(2)1010000000000
Total1813314271153461203000
sea: staphylococcal enterotoxin A gene; seb: staphylococcal enterotoxin B gene; sec: staphylococcal enterotoxin C gene; sed: staphylococcal enterotoxin D gene; see: staphylococcal enterotoxin E gene; seg: staphylococcal enterotoxin G gene; seh: staphylococcal enterotoxin H gene; sei: staphylococcal enterotoxin I gene; sej: staphylococcal enterotoxin toxin J gene; ser: staphylococcal enterotoxin R gene; ses: staphylococcal enterotoxin S gene; ser: staphylococcal enterotoxin R gene; set: staphylococcal enterotoxin T gene; tst: toxic shock syndrome toxin 1 gene.
Table 2. Detection of enterotoxin genes in Staphylococcus aureus and Staphylococcus epidermidis clusters according to the region studied (PR: Paraná; SP: São Paulo; SC: Santa Catarina; RS: Rio Grande do Sul).
Table 2. Detection of enterotoxin genes in Staphylococcus aureus and Staphylococcus epidermidis clusters according to the region studied (PR: Paraná; SP: São Paulo; SC: Santa Catarina; RS: Rio Grande do Sul).
SpeciesClusterNo. of IsolatesEnterotoxin GenesOrigin of Isolates
S. aureusA7sea (7); seb (7); sec (1); seh (5); sei (2)PR; SP
B4sea (2); seb (1); sec (1); see (1); seg (1); seh (1); sei (1)SC; RS
C3sea (1); see (1); seh (1); sei (1)SC
S. epidermidisA3sea (2); seb (1); sec (2); see (1); seh (2)SC
B3seb (1); sec (1); see (2)PR
Table 3. Sequence of the primers used and amplicon size.
Table 3. Sequence of the primers used and amplicon size.
NameProduct5′ to 3′ Nucleotide SequenceReferenceAmplicon Size (bp)
sea1Enterotoxin ATTGGAAACGGTTAAAACGAA[28]120
sea2GAACCTTCCCATCAAAAACA
seb1Enterotoxin BTCGCATCAAACTGACAAACG[28]478
seb2GCAGGTACTCTATAAGTGCC
sec1Enterotoxin CGACATAAAAGCTAGGAATTT[28]257
sec2AAATCGGATTAACATTATCC
sed1Enterotoxin DCTAGTTTGGTAATATCTCCT[28]317
sed2TAATGCTATATCTTATAGGG
see1Enterotoxin ECAAAGAAATGCTTTAAGCAATCTTAGGCCAC[29]170
see2CTTACCGCCAAAGCTG
seg1Enterotoxin GAATTATGTGAATGCTCAACCCGATC[29]642
seg2AAACTTATATGGAACAAAAGGTACTAGTTC
seh1Enterotoxin HCAATCACATCATATGCGAAAGCAG[30]375
seh2CATCTACCCAAACATTAGCACC
sei1Enterotoxin ICTCAAGGTGATATTGGTGTAGG[29]576
sei2AAAAAACTTACAGGCAGTCCATCTC
selj1Enterotoxin JCATCAGAACTGTTGTTCCGCTAG[31]146
selj2CTGAATTTTACCATCAAAGGTAC
ser1Enterotoxin RAGATGTGTTTGGAATACCCTAT[32]123
ser2CTATCAGCTGTGGAGTGCAT
ses1Enterotoxin STTCAGAAATAGCCAATCATTTCAA [8]195
ses2CCTTTTTGTTGAGAGCCGTC
set1Enterotoxin TGGTGATTATGTAGATGCTTGGG[8]170
set2TCGGGTGTTACTTCTGTTTGC
tst1Toxic shock syndrome toxinATGGCAGCATCAGCTTGATA[28]350
tst2TTTCCAATAACCACCCGTTT

Share and Cite

MDPI and ACS Style

Mello, P.L.; Moraes Riboli, D.F.; Pinheiro, L.; De Almeida Martins, L.; Vasconcelos Paiva Brito, M.A.; Ribeiro de Souza da Cunha, M.D.L. Detection of Enterotoxigenic Potential and Determination of Clonal Profile in Staphylococcus aureus and Coagulase-Negative Staphylococci Isolated from Bovine Subclinical Mastitis in Different Brazilian States. Toxins 2016, 8, 104. https://doi.org/10.3390/toxins8040104

AMA Style

Mello PL, Moraes Riboli DF, Pinheiro L, De Almeida Martins L, Vasconcelos Paiva Brito MA, Ribeiro de Souza da Cunha MDL. Detection of Enterotoxigenic Potential and Determination of Clonal Profile in Staphylococcus aureus and Coagulase-Negative Staphylococci Isolated from Bovine Subclinical Mastitis in Different Brazilian States. Toxins. 2016; 8(4):104. https://doi.org/10.3390/toxins8040104

Chicago/Turabian Style

Mello, Priscila Luiza, Danilo Flávio Moraes Riboli, Luiza Pinheiro, Lisiane De Almeida Martins, Maria Aparecida Vasconcelos Paiva Brito, and Maria De Lourdes Ribeiro de Souza da Cunha. 2016. "Detection of Enterotoxigenic Potential and Determination of Clonal Profile in Staphylococcus aureus and Coagulase-Negative Staphylococci Isolated from Bovine Subclinical Mastitis in Different Brazilian States" Toxins 8, no. 4: 104. https://doi.org/10.3390/toxins8040104

APA Style

Mello, P. L., Moraes Riboli, D. F., Pinheiro, L., De Almeida Martins, L., Vasconcelos Paiva Brito, M. A., & Ribeiro de Souza da Cunha, M. D. L. (2016). Detection of Enterotoxigenic Potential and Determination of Clonal Profile in Staphylococcus aureus and Coagulase-Negative Staphylococci Isolated from Bovine Subclinical Mastitis in Different Brazilian States. Toxins, 8(4), 104. https://doi.org/10.3390/toxins8040104

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop