Next Article in Journal
Effect of Dietary Difructose Anhydride III Supplementation on the Metabolic Profile of Japanese Black Breeding Herds with Low-Level Chronic Exposure to Zearalenone in the Dietary Feed
Previous Article in Journal
Electrophysiological Evidence of Contralateral Neuromuscular Effects Following Long-Term Botulinum Toxin Therapy in Hemifacial Spasm
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Comprehensive Transcriptomic and m6A Epitranscriptomic Analysis Reveals Colchicine-Induced Kidney Toxicity via DNA Damage and Autophagy in HK2 Cells

1
Key Laboratory of Gastrointestinal Cancer (Fujian Medical University), Ministry of Education, Fuzhou 350108, China
2
Key Laboratory of Environment and Health, School of Public Health, Fujian Medical University, Fuzhou 350108, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Toxins 2025, 17(8), 408; https://doi.org/10.3390/toxins17080408
Submission received: 21 May 2025 / Revised: 24 July 2025 / Accepted: 12 August 2025 / Published: 14 August 2025

Abstract

Colchicine is commonly prescribed for inflammation and gout, but its nephrotoxicity and underlying mechanisms remain incompletely understood. The objective of this research was to clarify the association between m6A methylation modifications and nephrotoxicity caused by colchicine. A significant decrease in HK2 cell viability was observed following colchicine treatment, and mRNA sequencing (mRNA-seq) revealed the differential expression of genes associated with DNA damage and autophagy. Further methylated RNA immunoprecipitation sequencing (MeRIP-seq) analysis revealed an association between N6-methyladenosine (m6A) modifications and the expression of genes involved in DNA damage and autophagy after colchicine exposure. Molecular docking and a molecular dynamics (MD) analysis identified ZC3H13 as a potential regulator of colchicine-induced cytotoxicity in HK2. Experimental validation confirmed that colchicine induces DNA damage and autophagy in HK2 cells, with ZC3H13 playing a significant role in these processes. In conclusion, the findings suggested that colchicine-induced damage in HK2 cells is associated with changes in m6A methylation levels in target genes and the altered expression of m6A regulator.
Key Contribution: This study uncovers the critical role of m6A methylation in colchicine-induced nephrotoxicity by linking DNA damage, autophagy, and m6A regulator ZC3H13 in HK2 cells.

Graphical Abstract

1. Introduction

Derived from the lily family plants Colchicum autumnale, colchicine is a bioactive alkaloid that has been used for pain and inflammation relief since its earliest documentation in the Egyptian Ebers Papyrus circa 1550 BCE [1,2]. By suppressing leukocyte activity, reducing collagen synthesis, enhancing collagenase activity, and inducing mitotic arrest alongside concomitant inhibition of DNA synthesis, colchicine has collectively established itself as the cornerstone anti-inflammatory therapy for gout and familial Mediterranean fever [3,4].
Despite its clinical utility, overdose with colchicine triggers severe multiorgan toxicity. Its hepatic metabolism predominates through cytochrome P450 3A4 and P-glycoprotein-mediated biliary excretion, with 10–12% renal clearance, contraindicating hepatorenal impairment [5]. Nephrotoxicity manifests prominently as azotemia, proteinuria, and hematuria, progressing to oliguria or acute renal failure requiring dialysis [6]. Mechanistically, renal injury is correlated with direct toxicity, exemplified by a 5-fold surge in the renal isoform of serum alkaline phosphatase within 48 h following the ingestion of 12.5 mg, in parallel with elevated urea and creatinine levels. Recent studies have revealed that colchicine at low doses attenuated doxorubicin-induced cardiotoxicity through microtubule-regulated autolysosomal degradation and improved renal outcomes in chronic kidney disease by modulating innate immunity [7].
Recent research has shown that the toxicological effects of traditional herbal medicines are linked to m6A, the most common epitranscriptomic modification in eukaryotic mRNAs [8,9,10]. The dynamic regulation of m6A was mediated by methyltransferases such as the METTL3/METTL14 complex and demethylases including FTO and ALKBH5 [11]. m6A broadly participated in cellular differentiation, stress responses, and disease pathogenesis by modulating RNA splicing, stability, transport, and translation. Studies on m6A have revealed its critical roles in DNA damage repair and regulation of autophagy, with potential cross-talk with the biological effects of colchicine. Colchicine induced DNA damage, exhibited m6A regulatory capacity and enhanced global mRNA stability by inhibiting m6A modifications mediated by METTL14 and YTHDC1 [12,13]. Concurrently, m6A critically regulated the repair of DNA damage. For example, METTL3-dependent m6A modifications facilitated the recruitment of homologous recombination repair genes BRCA1 and RAD51, promoting genomic restoration [14]. Autophagy, a key mechanism for clearing damaged organelles, was precisely controlled by m6A through core genes such as ATG5 and LC3. The FTO-mediated stabilization of ATG5 and ATG7 mRNAs increased autophagosome formation, consequently facilitating autophagy [15]. By dynamically coordinating DNA repair and autophagy-related gene expression, m6A has emerged as a central node linking colchicine-induced genomic instability to cellular stress adaptation. This study systematically investigated this regulatory network, exploring colchicine-triggered DNA damage and activation of autophagy. The findings provided a theoretical foundation for optimizing colchicine applications.

2. Results

2.1. Structural and Purity Determination and Potential Targets of Colchicine

The chemical structure of colchicine was determined via nuclear magnetic resonance (NMR) spectroscopy (Figure 1A). The 1H and 13C NMR spectra (Figure 1B,C) exhibited characteristic signals consistent with the molecular formula C22H25NO6. A purity analysis via high-performance liquid chromatography (HPLC) revealed a single major peak with a retention time of 29.36 min (Figure 1D). Its purity was determined to be 99.35% via the peak area normalization method.
Using the PharmMapper server (version 2017), 298 potential target proteins interacting with colchicine were identified. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses of the predicted targets were conducted using the DAVID bioinformatics database. The GO enrichment analysis included chromatin remodeling, signal transduction in response to DNA damage, focal adhesion, lysosome, and regulation of cell cycle (Figure 1E). The KEGG pathway enrichment results comprised cellular senescence, glutathione metabolism, and AMPK signaling pathway (Figure 1F).

2.2. The Cell Viability Effect of Colchicine on HK2 Cells

A dose- and time-dependent decline in HK2 cell viability was observed upon colchicine exposure, with viability rates of 98.5%, 91.0%, and 88.4% at 1, 5, and 10 nM after 48 h, respectively, which further declined to 70.1%, 63.6%, and 48.7% at corresponding concentrations after 72 h (Figure 2A,B).

2.3. Differentially Expressed Genes (DEGs) in Colchicine-Treated HK2 Cells Determined via mRNA-Seq

To elucidate the molecular mechanisms of colchicine-induced renal cell injury, an mRNA-seq analysis was performed on HK2 cells exposed to 5 nM colchicine for 72 h. A principal component analysis (PCA) demonstrated clear separation between the colchicine-treated and control groups (Figure 3A). A total of 3751 DEGs were identified based on the thresholds of p < 0.05 and |log2(fold change)| > 0.585, comprising 1919 upregulated and 1832 downregulated genes (Figure 3B). The DAVID database was used to perform GO and KEGG pathway enrichment analyses for the functional annotation of DEGs. The GO enrichment results mainly included DNA damage response, cellular response to oxidative stress, DNA repair, regulation of autophagy, and lysosome (Figure 3C). Meanwhile, the KEGG enrichment results mainly included cell cycle, homologous recombination, and purine metabolism (Figure 3D). A circular heatmap representation further revealed alterations in the expression of genes associated with DNA damage response and the regulation of autophagy (Figure 3E,F).
Gene set enrichment analysis (GSEA) revealed that in the colchicine-treated groups compared with the controls, the RNA modification, meiotic cell cycle, homologous recombination, calcium ion transmembrane transport, and metal ion transmembrane transporter activity were significantly activated. Conversely, purine metabolism, cell–cell adhesion mediated by cadherin, and autolysosome pathways were suppressed (Figure 4).

2.4. Transcriptome-Wide Detection of m6A Modification After Colchicine Treatment of HK2 Cells

To investigate whether colchicine treatment induces alterations in m6A modifications in HK2 cells, a transcriptome-wide MeRIP-seq analysis was performed. In the control group, 9984 genes were identified with 42,046 m6A peaks detected, while the colchicine-treated group exhibited 40,177 m6A peaks among 10,521 m6A-modified genes (Figure 5A,B). The classical conserved m6A motif DRACH (D = A/G/U, R = A/G, H = A/C/U) was found to be significantly enriched in both the control and colchicine-treated groups according to the STREME analysis (Figure 5C). An analysis of peak distribution per transcript demonstrated that over 6000 transcripts harbored 1–3 m6A peaks in both groups, while only a minority contained more than 5 m6A modification peaks (Figure 5D). The m6A modifications were predominantly enriched in the coding sequence (CDS) regions of the transcripts (Figure 5E). Furthermore, an RMDisease analysis further revealed that 45% of m6A-modified genes and 23% of m6A peaks are involved in diseases (Figure 5F).

2.5. Integration of mRNA-Seq and MeRIP-Seq

Using a threshold of p < 0.05, the MeRIP-seq and mRNA-seq analyses identified 5496 differentially m6A-modified mRNAs and 7778 DEGs between the colchicine-treated and control groups. The intersection between differentially m6A-modified mRNAs and DEGs revealed 3246 overlapping genes (Figure 6A). With |log2(fold change)| > 0.585 as the selection criterion, 1096 DEGs were identified, comprising 622 upregulated and 474 downregulated genes (Figure 6B). A functional enrichment analysis was conducted using the DAVID database. The KEGG pathway analysis revealed that the upregulated genes were predominantly associated with the cell cycle, autophagy-animal, and DNA replication, while the downregulated genes were mainly enriched in pathways for the regulation of actin cytoskeleton, focal adhesion, and biosynthesis of amino acids. According to GO enrichment analysis, the upregulated genes showed significant enrichment in DNA damage response, DNA repair, autophagy, and mitochondrion, while the downregulated genes were enriched in cell adhesion, post-embryonic development, cell–cell junction, and ATP binding (Figure 6C–F).
The GSEA was performed to identify the signaling pathways affected by colchicine exposure. Relative to the control group, the colchicine treatment groups activated the DNA damage response and DNA replication pathways, while inhibiting renal system development and lysosomal lumen pathways (Figure 7).

2.6. Molecular Interactions and MD Simulations Between Colchicine and Differentially Expressed m6A Modification Regulators

The mRNA-seq and MeRIP-seq data were utilized to assess both the levels of m6A methylation regulator expression and m6A modification to identify potential regulators, as shown in Table 1 and Table S1. ZC3H13, YTHDC2, METTL14, METTL5, CBLL1, VIRMA, YTHDF1, FTO, WTAP, FMR1, and METTL3 exhibited significantly upregulated mRNA expression levels, whereas IGF2BP3, HNRNPC, HNRNPA2B1, RBM15B, and IGF2BP2 showed significantly downregulated mRNA expression levels.
The molecular interactions between colchicine and differentially expressed m6A regulators were assessed to identify potential targets of colchicine. The total score derived from SYBYL-X 2.0 was based on van der Waals forces, hydrogen bonds, hydrophobic interactions, receptor–ligand geometric matching, and entropic changes. The predicted interactions between colchicine and the m6A regulators METTL3, ZC3H13, YTHDF1, IGF2BP2, METTL14, VIRMA, IGF2BP3, RBM15B, CBLL1, and HNRNPC, along with their corresponding total scores, are presented in Table 2 and Figure 8. A total score greater than 5 indicated stable binding between the colchicine and the m6A regulators. mRNA-seq analysis and molecular docking indicated that ZC3H13 was a potential molecular target of colchicine. Reverse transcription quantitative polymerase chain reaction (RT-qPCR) analysis demonstrated an upregulation of ZC3H13 expression following colchicine treatment (Figure 9A). MD simulations were conducted to further explore the interaction between colchicine and ZC3H13.
The RMSD of the colchicine–ZC3H13 complex gradually reached a plateau during the MD simulation (Figure 9B), and the RMSF analysis quantified the residue fluctuations (Figure 9C). The Rg reflected the compactness of the protein structure during the simulation. As shown in Figure 9D, no notable changes in Rg were observed throughout the simulation, indicating that the protein structure maintained a high degree of compactness, suggesting its relative stability. Additionally, hydrogen bonds remained stable throughout the entire simulation process (Figure 9E). The total binding free energy began to stabilize 10 ns after the simulation started, indicating that the binding between ZC3H13 and colchicine gradually became stable (Figure 9F). The MD simulations indicated that ZC3H13 and colchicine could bind together stably.

2.7. Interactions Between Differentially Expressed m6A Modification Regulators and DNA Damage and Autophagy-Related Genes

A functional annotation based on the GO and KEGG databases indicated that pathways associated with DNA damage response and autophagy were significantly enriched. The STRING database was used to explore the potential regulatory interactions between differentially expressed m6A regulators and target genes in the related signaling pathways, and protein–protein interaction (PPI) networks were subsequently constructed. Among the DNA damage response related genes, CHEK1, BLM, PARP2, SIRT1, and DTL exhibited degrees of 8, 6, 5, 5, and 5, respectively. For the autophagy-related genes, SQSTM1, CHMP2B, ATG101, UVRAG, and SMCR8 showed degrees of 12, 7, 7, 6, and 5, respectively (Figure 10A,B). Substrates potentially regulated by m6A methylation factors were identified through CLIP-seq analysis. The m6A regulators YTHDF1, RBM15B, METTL3, IGF2BP3, IGF2BP2, and HNRNPC were selected to assess their regulatory associations with DNA damage response and autophagy-related genes (Figure 10C,D). Visualization using integrative genomics viewer (IGV) revealed increased m6A modification on DNA damage response genes RIF1 and OARD1, as well as autophagy-related genes DRAM1 and HERC1, in the colchicine-treated group (Figure 10E).

2.8. DNA Damage Induced by Colchicine

Hoechst 33342, a cell-permeable dye, specifically bound to the minor groove of double-stranded DNA and exhibited blue fluorescence. As shown in Figure 11A, 5 and 10 nM colchicine treatment induced chromatin condensation and nuclear fragmentation, indicating significant DNA damage compared with that in the control.
The cumulative effect of colchicine on the accumulation of phosphorylated H2AX (γ-H2AX) in HK2 cells was measured to evaluate DNA damage. After treating HK2 cells with 0, 1, 5, and 10 nM of colchicine for 72 h, the content of γ-H2AX in the cells was measured. Following DNA injury, histone H2AX was phosphorylated to generate γ-H2AX, which then accumulated at the damaged sites and formed a fluorescence-detectable focus. Upon exposure to 1, 5, and 10 nM of colchicine, the average fluorescence intensities were elevated 3.2-, 4.4-, and 5.2-fold relative to the baseline intensity observed with 0 nM (Figure 11B,C).

2.9. DNA Damage and Autophagy in HK2 Cells Induced by Colchicine

The mRNA expression levels associated with DNA damage and autophagy in the HK2 cells after colchicine treatment are presented in Figure 12A,B. In the genes associated with DNA damage, the expression levels of ATM, CHEK1, CHEK2, PRKDC, and CDKN1A were significantly elevated. Treatment with 10 nM colchicine resulted in a 1.7-fold increase in ATM expression and a 2.0-fold increase in CHEK2 expression compared with those in the control group. Among the autophagy-related genes, MTOR was downregulated, while LC3, SQSTM1 and ATG3 were upregulated. Treatment with 10 nM colchicine resulted in a 2.4-fold upregulation of the autophagy marker LC3 compared with that in the control. Moreover, MeRIP-qPCR showed altered m6A modification levels in these genes (Figure 12C). A Western blot analysis demonstrated colchicine-induced DNA damage due to the increase in CHEK2 in the 10 nM treatment group compared to controls. LC3-II/LC3-I, an indicator of autophagosome biogenesis, exhibited a dose-dependent increase, with a fold change of 1.76 in 10 nM treatment group, with a 28.2% upregulation in p62 levels compared with that in the control group (Figure 12D). An increase in the LC3-II/LC3-I ratio, along with an increase in p62 expression, indicated colchicine might impair autophagy flux by blocking autophagosome–lysosome fusion or lysosomal degradation, leading to the accumulation of LC3-II and p62.

2.10. Knockdown of ZC3H13 Gene Expression Reduced the Induction by Colchicine in HK2 Cells

To investigate the potential role of ZC3H13 in colchicine-induced nephrotoxicity, ZC3H13 expression was downregulated in HK2 cells through siRNA transfection, thereby enabling examination of its functional impact on colchicine responses. RT-qPCR analysis demonstrated that ZC3H13 knockdown significantly attenuated colchicine-mediated phenotypic alterations in HK2 cells (Figure 13A,B). Colchicine-treated HK2 cells transfected with si-ZC3H13 decreased LC3-II/LC3-I ratio, along with p62 protein levels (p < 0.001, Figure 13C,D). These findings suggested a critical involvement of ZC3H13 in colchicine-induced autophagic activation within HK2 cells.

3. Discussion

Colchicine, a bioactive alkaloid derived from plants of the genus Colchicum, exhibits remarkable pharmacological and toxicological properties. Its pharmacological effects have been extensively documented, including anti-inflammatory activity, cardioprotective effects, anti-proliferative actions, and metabolic regulation. The standard clinical dosage of colchicine for adults was established at 0.5 mg per day. O. Chappey et al. documented in their study “Colchicine concentration in leukocytes of patients with familial Mediterranean fever” that adult patients receiving 0.5 mg daily exhibited plasma concentrations of 0.33 nM [16]. Our experimental concentrations of 1, 5, and 10 nM represented 3-, 15-, and 30-fold increases, respectively, over these clinical exposure levels, thus providing a preclinical toxicological reference. However, its toxicological mechanisms diverged markedly from its pharmacological mechanisms. The molecular pathogenesis of colchicine toxicity involved a multifaceted cascade, including reduced β-tubulin acetylation and end-binding protein 1 displacement, disrupting microtubule dynamics and compromising cellular polarity and transport [17]. Mitochondrial dysfunction emerged via suppressed cytochrome C oxidase subunit IV expression, concomitant with a fourfold increase in reactive oxygen species and mtDNA leakage [18]. Notably, 10 nM colchicine activated PINK1/Parkin-mediated mitophagy, yet sustained exposure disrupted mitochondrial quality control [19]. At 100 nM, the HK2 cells underwent ferroptosis characterized by GPX4 downregulation and ACSL4 upregulation, which was reversible via iron chelation [20]. While colchicine toxicity was well-documented, its precise mechanisms remained elusive. Emerging evidence has suggested that DNA damage, autophagy, and m6A RNA modification were implicated in colchicine-induced toxicity. In this study, HK2 cells were employed to elucidate the toxicological mechanisms of colchicine from the perspectives of DNA damage and autophagy.
DNA damage was a common cellular stress response triggered by various endogenous metabolic byproducts or exogenous environmental insults and was involved in regulating a wide range of physiological and pathological processes. Double-strand breaks (DSBs), identified as the most harmful DNA damage type, compromised genomic integrity and stability. γ-H2AX upregulation was one of the earliest cellular events to occur in response to DSBs and was used as a biomarker to evaluate the presence and extent of DNA damage [21]. In the present study, treatment of the HK2 cells with colchicine led to increased nuclear fragmentation and a significant upregulation of γ-H2AX expression, indicating that colchicine induced DNA damage. In addition to serving as a marker of DNA damage, γ-H2AX was also involved in chromatin remodeling and the regulation of DNA repair processes [22]. Phosphatidylinositol 3-kinase-related kinase (PIKK) family members, including ATM and DNA-PKcs, mediated DNA damage response activation [23]. Subsequently, CHEK1 and CHEK2 orchestrated cell cycle arrest and coordinated DNA repair. Tumor protein p53 and p21 suppressed the cell cycle to facilitate DNA repair [24]. RT-qPCR analysis revealed that colchicine treatment significantly upregulated key DDR genes in HK2 cells, including ATM, DNA-PKcs, CHEK1, CHEK2, and CDKN1A, indicating colchicine-induced DNA damage. When DNA damage was not efficiently repaired, cells activated autophagy pathways to cope with persistent stress. Liu et al. demonstrated that under ultraviolet irradiation or methyl methanesulfonate treatment, the DNA damage response mediated by the ATR-Chk1 pathway could lead to pronounced activation of autophagy, contributing to cell death [25]. These findings suggested that the accumulation of DNA damage not only caused cell cycle arrest but could also provoke abnormal or excessive autophagic responses, thereby promoting progression toward cell death.
Autophagy is a process by which cells degrade and recycle proteins and organelles to maintain intracellular homeostasis [26,27]. The autophagy process is regulated by mTOR inhibition and AMPK activation, relying on a series of autophagy-related proteins [26]. Autophagosomes form and engulf damaged organelles, excessively accumulated proteins, and pathogens, which are recognized and guided by the autophagy receptor p62/SQSTM1. P62 binds to the autophagosomal membrane, facilitating phagophore expansion and elongation, and promotes LC3-I transformation into LC3-II [28]. LC3-II facilitates phagophore extension and maturation [29]. Ultimately, fusion between autophagosomes and lysosomes leads to degradation [8]. Ashok Kumar et al. demonstrated that colchicine treatment induced autophagic vacuoles and LC3-I to LC3-II conversion, suggesting autophagy activation in HCT116 cells [30]. Notably, use of the autophagy inhibitor 3-MA notably decreased colchicine-induced cell death, demonstrating that autophagy played a role in colchicine-induced cell death. Studies demonstrated that colchicine-induced DNA damage triggered protective autophagy, which selectively degraded key regulatory proteins including Rnr1, USP14, CHK1, and NOXA, thereby directly or indirectly disrupting DNA repair mechanisms and modulating cell fate decisions such as proliferation, apoptosis, or senescence. In this study, RT-qPCR analysis revealed abnormal alterations in the expression of autophagy-related genes MTOR, LC3, P62, and ATG3 in colchicine-treated HK2 cells. The protein expression levels of p62 and LC3-II were upregulated, as shown by Western blot analysis. Collectively, these results indicated that colchicine treatment induced autophagy.
m6A modification, the most prevalent epitranscriptomic modification in eukaryotic mRNAs, dynamically regulated RNA metabolism and participated in critical biological processes including DNA damage repair and autophagy activation [31]. In this study, GO and KEGG pathway enrichment analyses of DEGs and differentially methylated genes revealed predominant associations with DNA damage response and autophagy, consistent with colchicine-induced DNA damage and autophagic activation, suggesting m6A-mediated regulation of colchicine nephrotoxic effects. KEGG analysis further demonstrated that DEGs were enriched in cell cycle and homologous recombination pathways, while hypomethylated genes predominantly clustered in the post-embryonic developmental pathways, implying that the m6A-dependent modulation of colchicine results in antiproliferative effects. This study also identified inflammation-related pathways in DEGs and methylated genes, including TNF signaling and the inflammatory mediator regulation of TRP channels, aligning with the anti-inflammatory mechanisms of colchicine reported by Deftereos et al. [32]. Beyond colchicine, other herbal compounds have exhibited similar epigenetic regulatory mechanisms. For instance, Li et al. revealed a novel antihypertensive mechanism of rhynchophylline via SIRT3-dependent mitochondrial homeostasis modulation, validating SIRT3 agonists as potential therapeutic strategies. These findings collectively underscored the pivotal role of epitranscriptomic modifications in phytomedicine research [33].

4. Conclusions

This study demonstrated that colchicine modulates the expression of DNA damage- and autophagy-related genes while altering m6A modification levels in HK2 cells, indicating its role in renal cytotoxicity. The study indicated that γ-H2AX and DNA damage-related genes such as ATM and CHEK1 were upregulated and that autophagy markers such as LC3-II and p62 were changed. Furthermore, m6A modifications were implicated in the regulation of DNA damage and autophagic pathways. These results revealed a mechanistic link among DNA damage, autophagy, and m6A modification in colchicine-induced nephrotoxicity.

5. Materials and Methods

5.1. Chemical Reagent, Cell Culture, and siRNA Transfection

Colchicine was purchased from Must Bio-Technology (Chengdu, China). Its chemical structure was characterized via 1H and 13C NMR spectroscopy at 400 MHz using a Bruker AVANCE III 400 MHz spectrometer (Bruker BioSpin, Rheinstetten, Germany). The purity was verified via HPLC analysis using a Dionex UltiMate 3000 system (Thermo Fisher Scientific, Waltham, MA, USA) equipped with a C18 column (4.6 mm × 250 mm, 5 μm). The human renal proximal tubular epithelial cells (HK2) were obtained from the American Type Culture Collection (ATCC) and cultured in DMEM containing 10% fetal bovine serum (Gibco, New York, NY, USA) and 1% penicillin–streptomycin. The cells were incubated at 37 °C with 5% CO2. Colchicine was dissolved in dimethyl sulfoxide (DMSO), and the final working concentration of DMSO in the cell culture experiments was 0.1%.
HK2 cells were seeded in 12-well plates and transfected with si-ZC3H13 (GenePharma, Shanghai, China) at approximately 60% confluency. For transfection, 17 μL buffer, 40 pmol si-ZC3H13, and 3 μL transfection reagent (GenePharma) were mixed gently to form complexes, which were then added to cells. RNA was extracted 48 h post-transfection to assess silencing efficiency. Cells were treated with 5 nM colchicine 36 h post-transfection for 72 h. The siRNA sequences used in this study are listed in Table S2.

5.2. Cell Viability Assay

The HK2 cells were plated in 96-well plates at an initial density of 3 × 103 cells and cultured overnight in a 37 °C incubator (Thermo Fisher, Langenselbold, Germany) to allow for adherence. The cells were then treated with colchicine at concentrations of 0, 1, 5, 10, 50, and 100 nM for 48 h and 72 h. Subsequently, 10 μL of 5 mg/mL MTT solution was added to each well and incubated at 37 °C in the dark for 4 h. The supernatant was discarded, followed by the addition of 100 μL of DMSO to dissolve formazan crystals. A multifunctional microplate reader (BioTek, Santa Clara, CA, USA) was employed to measure absorbance at 490 nm.

5.3. PharmMapper Predicted Potential Targets of Colchicine

The molecular structure of colchicine was retrieved from the PubChem database and subjected to energy minimization to generate a mol2 file, which was subsequently submitted to the PharmMapper server for analysis. The resulting UniProt IDs were standardized using the UniProt database and converted to their corresponding gene symbols for subsequent enrichment analysis.

5.4. RNA Extraction from HK2 Cells

The HK2 cells were cultured in 6-well plates and treated with colchicine at 0, 1, 5, and 10 nM for 72 h. Then, TRIzol reagent (Invitrogen, Carlsbad, CA, USA) was added to lyse the cells. A Qubit 3.0 fluorometer (Thermo Fisher, Waltham, MA, USA) was employed to determine the RNA concentration.

5.5. High-Throughput Sequencing

Total RNA was extracted from the HK2 cells following 72 h of exposure to 5 nM colchicine. mRNA-seq and MeRIP-seq were performed by Seqhealth (Wuhan, China). The mRNA was sheared into fragments of approximately 100–200 nt, with one portion used as the input group, and the remaining fragments were subjected to immunoprecipitation (IP) using an m6A-specific antibody to enrich for the IP group [34,35]. Libraries for both groups were constructed using the unique molecular identifier strategy and sequenced on the Novaseq 6000 sequencer (Illumina, San Diego, CA, USA).

5.6. Bioinformatics Analysis

Trim Galore was used to perform quality control and adapter trimming of the raw sequencing data. Alignment of the cleaned reads to the hg19 human genome reference was performed using Hisat2 [36]. StringTie was utilized to quantify transcript expression, and DESeq was employed to detect DEGs. The package ExomePeak2 was employed to identify m6A methylation peaks and differential methylation [37]. STREME was utilized to characterize m6A-associated motif sequences [38]. The disease relevance of m6A methylation sites was assessed using RMDisease [39]. The visualization of m6A methylation profiles was performed with the IGV software (version 2.14). The mRNA-seq and MeRIP-seq datasets were submitted to the GEO database (ID: GSE295178).

5.7. Molecular Docking and MD Simulation

To investigate the binding interactions between colchicine and differentially expressed m6A regulators, molecular docking was carried out using SYBYL-X 2.0. The protein structures were retrieved from the Uniprot and PDB databases and then preprocessed using PYMOL. This preprocessing involved the removal of excess ligands, the deletion of redundant peptide chains, and elimination of water molecules.
Using the Python package XPONGE (version 1.3.4), the complex was constructed [40]. Simulations were performed using the FF14SB united-atom force field. The systems were solvated with the SPC/E water model and neutralized with K+ and Cl, and periodic boundary conditions were applied. Energy minimization was performed with a tolerance of 5.0 kJ/mol, followed by 100 ps NVT equilibration at 300 K and 100 ps NPT simulation at 1 bar. Each system underwent a 50 ns MD simulation. To assess binding stability in a dynamic context, a range of MD trajectory analyses were applied to the simulation results, including the Rg, the number of hydrogen bonds, and the total binding free energy.

5.8. DNA Damage Detected via Nuclear Staining

Following 72 h of colchicine treatment in a 24-well plate, the HK2 cells were treated with 0.03% H2O2 for 20 min as a DNA damage positive control. Hoechst 33342 (Beyotime, Shanghai, China) staining of the HK2 cells was carried out at 37 °C for 10 min under dark conditions. Nuclear morphology was examined using a fluorescence microscope (Zeiss, Oberkochen, Germany) with an excitation wavelength of 365 nm.

5.9. Fluorescence Analysis of γ-H2AX

The HK2 cells were exposed to 0, 1, 5, and 10 nM colchicine for 72 h, followed by fixation using 4% paraformaldehyde. The cells were incubated with γ-H2AX rabbit monoclonal antibody for 1 h at 25 °C. The nuclei were subsequently stained with DAPI following 1 h of incubation with a fluorescently labeled secondary antibody. The cells were observed and imaged under an inverted fluorescence microscope (Zeiss), and the fluorescence intensity was measured using ImageJ software (version 1.53t). The experiment were replicated three times independently.

5.10. Reverse Transcription Quantitative PCR (RT-qPCR) and MeRIP-qPCR Analysis

RNA was reverse-transcribed into cDNA using a reverse transcription premix kit (Accurate Biology, Changsha, China). RT-qPCR was performed using SYBR Green Pro Taq HS Premix II on the AriaMX Real-Time PCR System (Agilent, Santa Clara, CA, USA). Relative mRNA expression levels were determined using the 2−ΔΔCt method, with GAPDH as the internal reference gene. The primer sequences are listed in Table 3.
The HK2 cells were treated with 5 nM colchicine for 72 h. Total RNA was extracted, and a portion was reserved as the input group. Protein A/G magnetic beads (Selleck, Houston, TX, USA) were pre-incubated with anti-m6A antibody (Proteintech, Wuhan, China) or IgG control in an immunoprecipitation buffer at room temperature for 1 h. The remaining RNA was incubated with the antibody–bead complexes in immunoprecipitation buffer containing RNasin at 4 °C overnight. After incubation, the complexes were eluted with an elution buffer at 55 °C for 1 h to release any bound RNA. The immunoprecipitated RNA was then extracted using the TRIzol method. Both input and immunoprecipitated RNA samples were reverse-transcribed into cDNA, followed by an RT-qPCR analysis.

5.11. Western Blot Analysis

The HK2 cells were treated with 0, 1, 5, and 10 nM colchicine for 72 h. Total protein was extracted with a RIPA buffer containing inhibitors, centrifuged at 12,000× g for 15 min. The proteins were transferred to PVDF membranes after separation via 15% SDS-PAGE. Following blocking with 5% skim milk, the membranes were incubated at 4 °C overnight with primary antibodies, including LC3 (Selleck, Houston, TX, USA), CHEK2 and p62 (Proteintech, Wuhan, China). Secondary antibodies (Proteintech) were applied for 90 min. Signals were detected using an Amersham Imager 680 System (Cytiva, Marlborough, MA, USA) and analyzed using ImageJ. The experiments were replicated three times independently.

5.12. Statistical Analysis

One-way analysis of variance (ANOVA) was conducted on the experimental data using the SPSS 26 software (IBM, New York, NY, USA). Results were presented as mean ± standard deviation, with statistical significance determined at p < 0.05. Each experiment was repeated at least three times independently.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/toxins17080408/s1, Table S1: The m6A modification levels of regulators in colchicine-treated HK2 cells; Table S2: Sequence of siRNA-ZC3H13.

Author Contributions

Conceptualization, A.Z.; methodology, A.Z.; software, K.T. and C.L.; formal analysis, K.T., J.W., D.Z., J.L. and L.W.; investigation, K.T., J.W., D.Z., L.Y. and W.Z.; data curation, J.L., L.W. and C.L.; writing—original draft preparation, K.T., J.W., D.Z., J.L., L.W., L.Y. and W.Z.; writing—review and editing, A.Z.; funding acquisition, A.Z. All authors have read and agreed to the published version of the manuscript.

Funding

The research was financially supported by funding from the Joint Funds for the Innovation of Science and Technology, Fujian Province (2024Y9087).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in this article and supplementary material. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
mRNA-seqmRNA sequencing
MeRIP-seqMethylated RNA immunoprecipitation sequencing
MDMolecular dynamics
NMRNuclear magnetic resonance
HPLCHigh-performance liquid chromatography
GOGene Ontology
KEGGKyoto Encyclopedia of Genes and Genomes
DEGsDifferentially expressed genes
PCAPrincipal component analysis
GSEAGene set enrichment analysis
CDSCoding sequence
RT-qPCRReverse transcription quantitative polymerase chain reaction
PPIProtein–protein interaction
IGVIntegrative Genomics Viewer
γ-H2AXPhosphorylated H2AX
DSBsDouble-strand breaks

References

  1. Imazio, M.; Nidorf, M. Colchicine and the heart. Eur. Heart J. 2021, 42, 2745–2760. [Google Scholar] [CrossRef]
  2. Casey, A.; Quinn, S.; McAdam, B.; Kennedy, M.; Sheahan, R. Colchicine-regeneration of an old drug. Ir. J. Med. Sci. 2023, 192, 115–123. [Google Scholar] [CrossRef]
  3. Schwarz, N.; Fernando, S.; Chen, Y.C.; Salagaras, T.; Rao, S.R.; Liyanage, S.; Williamson, A.E.; Toledo-Flores, D.; Dimasi, C.; Sargeant, T.J.; et al. Colchicine exerts anti-atherosclerotic and -plaque-stabilizing effects targeting foam cell formation. FASEB J. 2023, 37, e22846. [Google Scholar] [CrossRef] [PubMed]
  4. Adham Foumani, E.; Irani, S.; Shokoohinia, Y.; Mostafaie, A. Colchicine of colchicum autumnale, A traditional anti-inflammatory medicine, induces apoptosis by activation of apoptotic genes and proteins expression in human breast (MCF-7) and mouse breast (4T1) cell lines. Cell J. 2022, 24, 647–656. [Google Scholar] [CrossRef] [PubMed]
  5. Slobodnick, A.; Shah, B.; Krasnokutsky, S.; Pillinger, M.H. Update on colchicine, 2017. Rheumatology 2018, 57, i4–i11. [Google Scholar] [CrossRef]
  6. Seixas, R.; Lopes, D.; Couto, M.; Pereira, J.; Paiva, J. Severe colchicine intoxication: A case report and review of literature in adults. Cureus 2021, 13, e19151. [Google Scholar] [CrossRef] [PubMed]
  7. Peng, Y.; Li, Z.G.; Zhang, J.C.; Dong, Y.S.; Zhang, C.L.; Dong, Y.M.; Zhai, Y.F.; Zheng, H.L.; Liu, M.D.; Zhao, J.; et al. Low-Dose colchicine ameliorates doxorubicin cardiotoxicity via promoting autolysosome degradation. J. Am. Heart Assoc. 2024, 13, e033700. [Google Scholar] [CrossRef]
  8. Lin, X.H.; Zhang, J.; Wu, Z.K.; Shi, Y.; Chen, M.T.; Li, M.D.; Hu, H.; Tian, K.; Lv, X.Q.; Li, C.T.; et al. Involvement of autophagy in mesaconitine-induced neurotoxicity in HT22 cells revealed through integrated transcriptomic, proteomic, and m6A epitranscriptomic profiling. Front. Pharmacol. 2024, 15, 1393717. [Google Scholar] [CrossRef]
  9. Wu, Q.B.; Chen, M.T.; Lin, Y.F.; Zhang, J.; Gao, X.Y.; Wu, Y.J.; Wu, C.J.; Wen, J.X.; Li, J.Q.; Li, C.T.; et al. Multiomics profiling uncovers curdione-induced reproductive toxicity in HTR-8/SVneo cells. Heliyon 2024, 10, e38650. [Google Scholar] [CrossRef]
  10. Lin, B.A.; Zhang, J.; Chen, M.T.; Gao, X.Y.; Wen, J.X.; Tian, K.; Wu, Y.J.; Chen, Z.K.; Yang, Q.M.; Zhu, A.; et al. Comprehensive profiling of transcriptome and m6A epitranscriptome uncovers the neurotoxic effects of yunaconitine on HT22 cells. Evol. Bioinform. 2024, 20, 1–16. [Google Scholar] [CrossRef]
  11. Wu, Y.J.; Chen, X.Y.; Bao, W.Q.; Hong, X.Y.; Li, C.T.; Lu, J.T.; Zhang, D.C.; Zhu, A. Effect of humantenine on mRNA m6A modification and expression in human colon cancer cell line HCT116. Genes 2022, 13, 781. [Google Scholar] [CrossRef]
  12. Barnieh, F.M.; Ribeiro Morais, G.; Garland, H.; Loadman, P.M.; Falconer, R.A. Targeted delivery of a colchicine analogue provides synergy with ATR inhibition in cancer cells. Biochem. Pharmacol. 2022, 201, 115095. [Google Scholar] [CrossRef]
  13. Chen, M.; Yang, D.F.; Zhou, Y.Z.; Yang, C.Z.; Lin, W.H.; Li, J.; Liu, J.T.; Ye, J.M.; Huang, W.H.; Ma, W.T.; et al. Colchicine blocks abdominal aortic aneurysm development by maintaining vascular smooth muscle cell homeostasis. Int. J. Biol. Sci. 2024, 20, 2092–2110. [Google Scholar] [CrossRef]
  14. Zhang, C.F.; Chen, L.P.; Peng, D.; Jiang, A.; He, Y.R.; Zeng, Y.R.; Xie, C.; Zhou, H.X.; Luo, X.T.; Liu, H.Y.; et al. METTL3 and N6-Methyladenosine promote homologous recombination-mediated repair of DSBs by modulating DNA-RNA hybrid accumulation. Mol. Cell 2020, 79, 425–442.e7. [Google Scholar] [CrossRef]
  15. Wang, X.X.; Wu, R.F.; Liu, Y.H.; Zhao, Y.L.; Bi, Z.; Yao, Y.X.; Liu, Q.; Shi, H.L.; Wang, F.Q.; Wang, Y.Z. m6A mRNA methylation controls autophagy and adipogenesis by targeting Atg5 and Atg7. Autophagy 2019, 16, 1221–1235. [Google Scholar] [CrossRef]
  16. Chappey, O.; Niel, E.; Dervichian, M.; Wautier, J.L.; Scherrmann, J.M.; Cattan, D. Colchicine concentration in leukocytes of patients with familial Mediterranean fever. Br. J. Clin. Pharmacol. 1994, 38, 87–89. [Google Scholar] [CrossRef] [PubMed]
  17. Wordeman, L.; Vicente, J.J. Microtubule targeting agents in disease: Classic drugs, novel roles. Cancers 2021, 13, 5650. [Google Scholar] [CrossRef]
  18. Zong, Y.; Li, H.; Liao, P.; Chen, L.; Pan, Y.; Zheng, Y.Q.; Zhang, C.Q.; Liu, D.L.; Zheng, M.H.; Gao, J.J. Mitochondrial dysfunction: Mechanisms and advances in therapy. Signal Transduct. Target. Ther. 2024, 9, 124. [Google Scholar] [CrossRef] [PubMed]
  19. Narendra, D.P.; Youle, R.J. The role of PINK1-Parkin in mitochondrial quality control. Nat. Cell Biol. 2024, 26, 1639–1651. [Google Scholar] [CrossRef] [PubMed]
  20. Chen, W.; Wang, B.; Liang, S.S.; Zheng, L.N.; Fang, H.; Xu, S.; Zhang, T.F.; Wang, M.; He, X.; Feng, W.Y. Fullerenols as efficient ferroptosis inhibitor by targeting lipid peroxidation for preventing drug-induced acute kidney injury. J. Colloid Interface Sci. 2025, 680, 261–273. [Google Scholar] [CrossRef]
  21. Prabhu, K.S.; Kuttikrishnan, S.; Ahmad, N.; Habeeba, U.; Mariyam, Z.; Suleman, M.; Bhat, A.A.; Uddin, S. H2AX: A key player in DNA damage response and a promising target for cancer therapy. Biomed. Pharmacother. 2024, 175, 116663. [Google Scholar] [CrossRef]
  22. Gong, P.; Guo, Z.H.; Wang, S.P.; Gao, S.F.; Cao, Q.H. Histone phosphorylation in DNA damage response. Int. J. Mol. Sci. 2025, 26, 2405. [Google Scholar] [CrossRef]
  23. Urushihara, Y.; Hashimoto, T.; Fujishima, Y.; Hosoi, Y. AMPK/FOXO3a pathway increases activity and/or expression of ATM, DNA-PKcs, Src, EGFR, PDK1, and SOD2 and Induces radioresistance under nutrient starvation. Int. J. Mol. Sci. 2023, 24, 12828. [Google Scholar] [CrossRef] [PubMed]
  24. Minagawa, Y.; Ishino, K.; Wada, R.; Kudo, M.; Naito, Z.; Takeshita, T.; Ohashi, R. High expression of p21 as a potential therapeutic target in ovarian clear-cell carcinoma. Anticancer Res. 2020, 40, 5631–5639. [Google Scholar] [CrossRef]
  25. Liu, M.; Zeng, T.; Zhang, X.; Liu, C.; Wu, Z.; Yao, L.; Xie, C.; Xia, H.; Lin, Q.; Xie, L.; et al. ATR/Chk1 signaling induces autophagy through sumoylated RhoB-mediated lysosomal translocation of TSC2 after DNA damage. Nat. Commun. 2018, 9, 4139. [Google Scholar] [CrossRef]
  26. Liu, S.Z.; Yao, S.J.; Yang, H.; Liu, S.J.; Wang, Y.J. Autophagy: Regulator of cell death. Cell Death Dis. 2023, 14, 648. [Google Scholar] [CrossRef]
  27. Yamamoto, H.; Zhang, S.; Mizushima, N. Autophagy genes in biology and disease. Nat. Rev. Genet. 2023, 24, 382–400. [Google Scholar] [CrossRef]
  28. Galluzzi, L.; Green, D.R. Autophagy-independent functions of the autophagy machinery. Cell 2019, 177, 1682–1699. [Google Scholar] [CrossRef]
  29. Ito, S.I.; Tanaka, Y. Evaluation of LC3-II release via extracellular vesicles in relation to the accumulation of intracellular LC3-positive vesicles. J. Vis. Exp. 2024, 212, e67385. [Google Scholar] [CrossRef] [PubMed]
  30. Kumar, A.; Singh, B.; Sharma, P.R.; Bharate, S.B.; Saxena, A.K.; Mondhe, D.M. A novel microtubule depolymerizing colchicine analogue triggers apoptosis and autophagy in HCT-116 colon cancer cells. Cell Biochem. Funct. 2016, 34, 69–81. [Google Scholar] [CrossRef] [PubMed]
  31. Chen, S.Z.; Zheng, X.H.; Lin, Q.; Wang, X.M.; Liu, Z.Z. Dendrobine inhibits hepatic gluconeogenesis and promotes glycogen synthesis through control of m6A RNA modification of PEPCK/G6Pase by METTL3 in hepatocytes. Epigenet. Insights 2024, 17, e005. [Google Scholar] [CrossRef]
  32. Deftereos, S.G.; Beerkens, F.J.; Shah, B.; Giannopoulos, G.; Vrachatis, D.A.; Giotaki, S.G.; Siasos, G.; Nicolas, J.; Arnott, C.; Patel, S.; et al. Colchicine in cardiovascular disease: In-depth review. Circulation 2022, 145, 61–78. [Google Scholar] [CrossRef]
  33. Lin, L.; Sun, B.W.; Hu, Y.L.; Yang, W.Q.; Li, J.; Wang, D.Y.; Zhang, L.; Lu, M.K.; Li, Y.; Li, Y.L.; et al. Rhynchophylline as an agonist of sirtuin 3 ameliorates endothelial dysfunction via antagonizing mitochondrial damage of endothelial progenitor cells. Brit. J. Pharmacol. 2025, 182, 3476–3502. [Google Scholar] [CrossRef]
  34. Huang, D.Y.; Meng, J.; Chen, K.Q. AI techniques have facilitated the understanding of epitranscriptome distribution. Cell Genom. 2024, 4, 100718. [Google Scholar] [CrossRef] [PubMed]
  35. Zhang, Y.X.; Jiang, J.; Ma, J.M.; Wei, Z.; Wang, Y.; Song, B.W.; Meng, J.; Jia, G.F.; de Magalhães, J.P.; Rigden, D.J.; et al. DirectRMDB: A database of post-transcriptional RNA modifications unveiled from direct RNA sequencing technology. Nucleic Acids Res. 2023, 51, D106–D116. [Google Scholar] [CrossRef] [PubMed]
  36. Song, B.W.; Huang, D.Y.; Zhang, Y.X.; Wei, Z.; Su, J.L.; Pedro de Magalhães, J.; Rigden, D.J.; Meng, J.; Chen, K.Q. m6A-TSHub: Unveiling the context-specific m(6)A methylation and m(6)A-affecting mutations in 23 human tissues. Genom. Proteom. Bioinform. 2023, 21, 678–694. [Google Scholar] [CrossRef]
  37. Tang, Y.J.; Chen, K.Q.; Song, B.W.; Ma, J.M.; Wu, X.Y.; Xu, Q.R.; Wei, Z.; Su, J.L.; Liu, G.; Rong, R.; et al. m6A-Atlas: A comprehensive knowledgebase for unraveling the N6-methyladenosine (m6A) epitranscriptome. Nucleic Acids Res. 2021, 49, D134–D143. [Google Scholar] [CrossRef] [PubMed]
  38. Bailey, T.L. STREME: Accurate and versatile sequence motif discovery. Bioinformatics 2021, 37, 2834–2840. [Google Scholar] [CrossRef]
  39. Song, B.W.; Wang, X.; Liang, Z.M.; Ma, J.M.; Huang, D.Y.; Wang, Y.; de Magalhães, J.P.; Rigden, D.J.; Meng, J.; Liu, G.; et al. RMDisease V2.0: An updated database of genetic variants that affect RNA modifications with disease and trait implication. Nucleic Acids Res. 2023, 51, D1388–D1396. [Google Scholar] [CrossRef]
  40. Wu, Q.B.; Gao, X.Y.; Lin, Y.F.; Wu, C.J.; Zhang, J.; Chen, M.T.; Wen, J.X.; Wu, Y.J.; Tian, K.; Bao, W.Q.; et al. Integrating epigenetics, proteomics, and metabolomics to reveal the involvement of Wnt/β-Catenin signaling pathway in oridonin-induced reproductive toxicity. Toxics 2024, 12, 339. [Google Scholar] [CrossRef]
Figure 1. (A) The chemical structure of colchicine. (B) 1H NMR and (C) 13C NMR spectra of colchicine recorded at 400 MHz. (D) HPLC analysis of colchicine purity. (E) GO and (F) KEGG pathway enrichment analyses of potential target proteins of colchicine derived from the PharmMapper database.
Figure 1. (A) The chemical structure of colchicine. (B) 1H NMR and (C) 13C NMR spectra of colchicine recorded at 400 MHz. (D) HPLC analysis of colchicine purity. (E) GO and (F) KEGG pathway enrichment analyses of potential target proteins of colchicine derived from the PharmMapper database.
Toxins 17 00408 g001
Figure 2. HK2 cell viability was assessed after (A) 48 h and (B) 72 h of exposure to colchicine at 0, 1, 5, 10, 50, and 100 nM. * p < 0.05, *** p < 0.001, n = 3.
Figure 2. HK2 cell viability was assessed after (A) 48 h and (B) 72 h of exposure to colchicine at 0, 1, 5, 10, 50, and 100 nM. * p < 0.05, *** p < 0.001, n = 3.
Toxins 17 00408 g002
Figure 3. Transcriptomic profiling of HK2 cells treated with 5 nM colchicine for 72 h. (A) PCA plot showing the separation between the control and colchicine-treated groups. (B) Volcano plot of DEGs. (C) GO and (D) KEGG enrichment analyses of DEGs. Circular heatmaps of DEGs involved in (E) DNA damage response and (F) regulation of autophagy.
Figure 3. Transcriptomic profiling of HK2 cells treated with 5 nM colchicine for 72 h. (A) PCA plot showing the separation between the control and colchicine-treated groups. (B) Volcano plot of DEGs. (C) GO and (D) KEGG enrichment analyses of DEGs. Circular heatmaps of DEGs involved in (E) DNA damage response and (F) regulation of autophagy.
Toxins 17 00408 g003
Figure 4. GSEA revealed enrichment in pathways related to (A) RNA modification, (B) meiotic cell cycle, (C) homologous recombination, (D) purine metabolism, (E) calcium ion transmembrane transport, (F) metal ion transmembrane transporter activity, (G) cell–cell adhesion mediated by cadherin, and (H) autolysosome.
Figure 4. GSEA revealed enrichment in pathways related to (A) RNA modification, (B) meiotic cell cycle, (C) homologous recombination, (D) purine metabolism, (E) calcium ion transmembrane transport, (F) metal ion transmembrane transporter activity, (G) cell–cell adhesion mediated by cadherin, and (H) autolysosome.
Toxins 17 00408 g004
Figure 5. m6A modification patterns in HK2 cells after treatment with 5 nM colchicine for 72 h. Venn diagrams show the overlap of m6A (A) genes and (B) peaks between the control and colchicine-treated groups. (C) Sequence motifs of m6A peaks in the control and colchicine groups. (D) Distribution of the number of m6A peaks per gene in the control and colchicine-treated groups. (E) Density distribution of m6A-modified peaks in mRNA. (F) Pie charts depicting the proportion of disease-associated m6A genes and m6A peaks.
Figure 5. m6A modification patterns in HK2 cells after treatment with 5 nM colchicine for 72 h. Venn diagrams show the overlap of m6A (A) genes and (B) peaks between the control and colchicine-treated groups. (C) Sequence motifs of m6A peaks in the control and colchicine groups. (D) Distribution of the number of m6A peaks per gene in the control and colchicine-treated groups. (E) Density distribution of m6A-modified peaks in mRNA. (F) Pie charts depicting the proportion of disease-associated m6A genes and m6A peaks.
Toxins 17 00408 g005
Figure 6. Differential mRNA expression and m6A modification analysis in HK2 cells treated with 5 nM colchicine for 72 h. (A) Venn diagram illustrating the overlap between DEGs and m6A-modified genes. (B) Volcano plot depicting the distribution of DEGs. Representative (C) KEGG and (D) GO enrichment pathways for upregulated genes following colchicine treatment. Representative (E) KEGG and (F) GO enrichment pathways for downregulated genes following colchicine treatment. The DEGs and differential m6A peaks were identified using p < 0.05.
Figure 6. Differential mRNA expression and m6A modification analysis in HK2 cells treated with 5 nM colchicine for 72 h. (A) Venn diagram illustrating the overlap between DEGs and m6A-modified genes. (B) Volcano plot depicting the distribution of DEGs. Representative (C) KEGG and (D) GO enrichment pathways for upregulated genes following colchicine treatment. Representative (E) KEGG and (F) GO enrichment pathways for downregulated genes following colchicine treatment. The DEGs and differential m6A peaks were identified using p < 0.05.
Toxins 17 00408 g006
Figure 7. GSEA revealed enrichment in the (A) DNA damage response, (B) DNA replication pathways, (C) lysosomal lumen, and (D) renal system development pathways.
Figure 7. GSEA revealed enrichment in the (A) DNA damage response, (B) DNA replication pathways, (C) lysosomal lumen, and (D) renal system development pathways.
Toxins 17 00408 g007
Figure 8. Three-dimensional and two-dimensional molecular docking models illustrated the interactions between colchicine and differentially expressed m6A regulators, including (A) METTL3, (B) ZC3H13, (C) YTHDF1, (D) IGF2BP2, (E) METTL14, (F) VIRMA, (G) IGF2BP3, (H) RBM15B, (I) CBLL1, and (J) HNRNPC.
Figure 8. Three-dimensional and two-dimensional molecular docking models illustrated the interactions between colchicine and differentially expressed m6A regulators, including (A) METTL3, (B) ZC3H13, (C) YTHDF1, (D) IGF2BP2, (E) METTL14, (F) VIRMA, (G) IGF2BP3, (H) RBM15B, (I) CBLL1, and (J) HNRNPC.
Toxins 17 00408 g008
Figure 9. (A) Analysis of ZC3H13 mRNA expression via RT-qPCR. (B) RMSD of the backbone atoms. (C) RMSF of amino acids for complexes. (D) Rg of the complex as a function of time during the simulation. (E) Hydrogen bonds formed by amino acids in the complexes. (F) Total binding free energy of the colchicine–ZC3H13 complex during MD simulations. * p < 0.05, *** p < 0.001, n = 3.
Figure 9. (A) Analysis of ZC3H13 mRNA expression via RT-qPCR. (B) RMSD of the backbone atoms. (C) RMSF of amino acids for complexes. (D) Rg of the complex as a function of time during the simulation. (E) Hydrogen bonds formed by amino acids in the complexes. (F) Total binding free energy of the colchicine–ZC3H13 complex during MD simulations. * p < 0.05, *** p < 0.001, n = 3.
Toxins 17 00408 g009
Figure 10. Interaction networks linking m6A regulators with (A) DNA damage response genes and (B) autophagy-related genes. Substrate prediction for the m6A regulators based on genes from (C) DNA damage response and (D) autophagy-related pathways. (E) Levels of m6A modification on RIF1, OARD1, HERC1, and DRAM1 as observed via IGV.
Figure 10. Interaction networks linking m6A regulators with (A) DNA damage response genes and (B) autophagy-related genes. Substrate prediction for the m6A regulators based on genes from (C) DNA damage response and (D) autophagy-related pathways. (E) Levels of m6A modification on RIF1, OARD1, HERC1, and DRAM1 as observed via IGV.
Toxins 17 00408 g010
Figure 11. The impact of colchicine on DNA damage in HK2 cells following 72 h of exposure. (A) Nuclear fragments visualized with Hoechst 33342 staining. Orange dashed boxes indicated regions shown at higher magnification. (B) Representative images of γ-H2AX immunofluorescence intensity. (C) Quantitative analysis of γ-H2AX immunofluorescence. *** p < 0.001, n = 3. Scale bar = 100 μm.
Figure 11. The impact of colchicine on DNA damage in HK2 cells following 72 h of exposure. (A) Nuclear fragments visualized with Hoechst 33342 staining. Orange dashed boxes indicated regions shown at higher magnification. (B) Representative images of γ-H2AX immunofluorescence intensity. (C) Quantitative analysis of γ-H2AX immunofluorescence. *** p < 0.001, n = 3. Scale bar = 100 μm.
Toxins 17 00408 g011
Figure 12. RT-qPCR analysis of mRNA expression related to (A) DNA damage and (B) autophagy. (C) MeRIP-qPCR analysis of m6A levels in DNA damage- and autophagy-related genes following 72 h treatment with 5 nM colchicine. (D) The expression of CHEK2, LC3, and p62 proteins was assessed in colchicine-treated HK2 cells. * p < 0.05, ** p < 0.01, *** p < 0.001, n = 3.
Figure 12. RT-qPCR analysis of mRNA expression related to (A) DNA damage and (B) autophagy. (C) MeRIP-qPCR analysis of m6A levels in DNA damage- and autophagy-related genes following 72 h treatment with 5 nM colchicine. (D) The expression of CHEK2, LC3, and p62 proteins was assessed in colchicine-treated HK2 cells. * p < 0.05, ** p < 0.01, *** p < 0.001, n = 3.
Toxins 17 00408 g012
Figure 13. (A) The knockdown efficiency of ZC3H13 was assessed following transfection with siRNA-ZC3H13 and treatment with colchicine, followed by (B) RT-qPCR analysis of LC3 and p62 mRNA expression, (C,D) Western blot and quantitative analysis of p62 and LC3 proteins. * p < 0.05, ** p < 0.01, *** p < 0.001, n = 3.
Figure 13. (A) The knockdown efficiency of ZC3H13 was assessed following transfection with siRNA-ZC3H13 and treatment with colchicine, followed by (B) RT-qPCR analysis of LC3 and p62 mRNA expression, (C,D) Western blot and quantitative analysis of p62 and LC3 proteins. * p < 0.05, ** p < 0.01, *** p < 0.001, n = 3.
Toxins 17 00408 g013
Table 1. The mRNA expression levels of m6A regulators in colchicine-treated HK2 cells.
Table 1. The mRNA expression levels of m6A regulators in colchicine-treated HK2 cells.
GeneRegulationBase MeanLog2Fold Changep Valuep adj
IGF2BP3reader3355−0.611.20 × 10−234.24 × 10−22
ZC3H13writer14,8080.581.99 × 10−153.44 × 10−14
YTHDC2reader14420.496.04 × 10−127.17 × 10−11
METTL14writer20910.531.68 × 10−101.70 × 10−9
HNRNPCreader27,180−0.455.73 × 10−94.80 × 10−8
METTL5writer10700.616.25 × 10−95.22 × 10−8
CBLL1writer15340.437.25 × 10−96.01 × 10−8
HNRNPA2B1reader80,606−0.301.66 × 10−81.32 × 10−7
RBM15Bwriter3167−0.294.09 × 10−51.95 × 10−4
VIRMAwriter47320.252.01 × 10−48.37 × 10−4
YTHDF1reader21820.262.09 × 10−36.93 × 10−3
FTOeraser15860.373.19 × 10−31.01 × 10−2
WTAPwriter58630.255.72 × 10−31.69 × 10−2
FMR1reader44430.177.15 × 10−32.06 × 10−2
METTL3writer15930.211.95 × 10−24.93 × 10−2
IGF2BP2reader9542−0.232.75 × 10−26.61 × 10−2
ALKBH5eraser31410.082.46 × 10−13.86 × 10−1
IGF2BP1reader39710.123.50 × 10−15.04 × 10−1
RBM15writer11660.305.49 × 10−16.96 × 10−1
YTHDF3reader19760.196.70 × 10−17.92 × 10−1
YTHDC1reader12,5030.086.90 × 10−18.06 × 10−1
YTHDF2reader24830.029.28 × 10−19.61 × 10−1
Table 2. The interactions between colchicine and m6A regulators.
Table 2. The interactions between colchicine and m6A regulators.
ProteinPDB/
Uniprot ID
Total ScoreCrashPolarH-Bond NumberResidues Involved in H-Bond FormationHydrophobic Contact NumberResidues Involved in Hydrophobic Contacts
METTL35IL27.783−3.0221.0631Tyr40613Ser511, Leu404, Glu481, His482, Thr510, Val432, Trp398, Trp431, Ile400, Asp395, Lys513, Thr433, Pro396
ZC3H13Q5T2007.169−1.5612.8343Arg29, Asn44, Arg437Tyr53, Cys57, Arg58, Phe59, Leu30, Cys42, Ser33
YTHDF18BS46.808−2.4350.0010-8Arg542, Arg550, Glu546, Gln543, Arg404, Tyr539, Asp400, Lys469
IGF2BP26ROL6.304−1.5932.4531Ser4257Arg576, Val579, Gln580, Lys583, Gu426, Glu428, Pro482
METTL145IL25.999−1.9381.8821Thr2847Gln131, Ile262, Pro130, Cys120, Phe281, Phe123, Gln282
VIRMA7YG45.910−0.9733.1191Ser10558Lys709, Asp755, Ala756, Trp760, Phe757, Ser810, Gln713, Lys1059
IGF2BP36FQ15.689−2.2542.9404Asn140, Ser58, Arg86
(2 H-bonds)
7Glu71, Ile68, Gly59, Pro67, Glu69, Val151, Lys150, Ala152
RBM15BQ8NDT25.478−1.4343.9712Arg822, Thr4186Arg445, Arg819, Arg818, Asn823, Leu820, Leu463
CBLL1Q75N035.077−3.3952.8783Gln170, Ser167, Arg1994Val197, Val169, Ile168, Pro196
HNRNPC2MXY5.016−1.8092.1572Lys89, Asn839Ile82, Arg99, Asp71, Asn91, Val90, Asp81, Lys98, Gly96, Val97
Table 3. Sequences of primers used in RT-qPCR.
Table 3. Sequences of primers used in RT-qPCR.
GeneForward Primer (5′-3′)Reverse Primer (5′-3′)
ATMGCTGTGGTGGAGGGAAGATGTTACCCTGCCTGGCGTGTTGATGAG
ATRCACCACCAGACAGCCTACAATGCCCAGAGCCACTTTGCCCTTTCC
CHEK1CTGCCACATGATCGGACCATCGGAGAATCGCTTGAACCCAGGAGAC
CHEK2CCAGCCAGTCCTCTCACTCCAGGGTTCTTGGTCCTCAGGTTCTTGG
PRKDCAGTGAGCCAGCCTGCCTTGCACCTTCTCTGAATCCTCTGAACTG
CDKN1ATCCAGCGACCTTCCTCATCCACTCCATAGCCTCTACTGCCACCATC
MTORGAGATACGCTGTCATCCCTTTACTGTATTATTGACGGCATGCTC
LC3GCCTTCTTCCTGCTGGTGAACCTCCTCGTCTTTCTCCTGCTCGTAG
SQSTM1TGATTGAGTCCCTCTCCCAGATGCCCGCTCCGATGTCATAGTTCTTGG
ATG3CGGTGCAAACAGATGGAATATTGTGTGATCTCTTTAACGGCTTC
ZC3H13GAGGTGACAGAAGCAGAGCATACGGCGGTGGAGGAGGAAGAAG
GAPDHTGACATCAAGAAGGTGGTGAAGCAGGTGTCGCTGTTGAAGTCAGAGGAG
ATM: ataxia telangiectasia mutated; ATR: ataxia telangiectasia and rad3-related protein; CHEK1: checkpoint kinase 1; CHEK2: checkpoint kinase 2; PRKDC: protein kinase, DNA-activated, catalytic subunit; CDKN1A: cyclin-dependent kinase inhibitor 1A; MTOR: mechanistic target of rapamycin; LC3: microtubule-associated protein 1A/1B-light chain 3; SQSTM1: sequestosome 1; ATG3: autophagy related 3; ZC3H13: Zinc finger CCCH-type containing 13; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Tian, K.; Wen, J.; Zhang, D.; Lin, J.; Weng, L.; Yang, L.; Zhao, W.; Li, C.; Zhu, A. Comprehensive Transcriptomic and m6A Epitranscriptomic Analysis Reveals Colchicine-Induced Kidney Toxicity via DNA Damage and Autophagy in HK2 Cells. Toxins 2025, 17, 408. https://doi.org/10.3390/toxins17080408

AMA Style

Tian K, Wen J, Zhang D, Lin J, Weng L, Yang L, Zhao W, Li C, Zhu A. Comprehensive Transcriptomic and m6A Epitranscriptomic Analysis Reveals Colchicine-Induced Kidney Toxicity via DNA Damage and Autophagy in HK2 Cells. Toxins. 2025; 17(8):408. https://doi.org/10.3390/toxins17080408

Chicago/Turabian Style

Tian, Kun, Jiaxin Wen, Dongcheng Zhang, Jiaxuan Lin, Lixiang Weng, Lele Yang, Wei Zhao, Chutao Li, and An Zhu. 2025. "Comprehensive Transcriptomic and m6A Epitranscriptomic Analysis Reveals Colchicine-Induced Kidney Toxicity via DNA Damage and Autophagy in HK2 Cells" Toxins 17, no. 8: 408. https://doi.org/10.3390/toxins17080408

APA Style

Tian, K., Wen, J., Zhang, D., Lin, J., Weng, L., Yang, L., Zhao, W., Li, C., & Zhu, A. (2025). Comprehensive Transcriptomic and m6A Epitranscriptomic Analysis Reveals Colchicine-Induced Kidney Toxicity via DNA Damage and Autophagy in HK2 Cells. Toxins, 17(8), 408. https://doi.org/10.3390/toxins17080408

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop