Phylogenetic and Autecology Characteristics of Five Potentially Harmful Dinoflagellate Alexandrium Species (Dinophyceae, Gonyaulacales, Pyrocystaceae) in Tropical Waters: A. affine, A. fraterculus, A. leei, A. pseudogonyaulax, and A. tamiyavanichii
Abstract
1. Introduction
2. Results
2.1. Identifying Alexandrium Species
2.1.1. Morphological Observations
Alexandrium affine (Figure 1A–D)
Alexandrium fraterculus (Figure 1E–I)
Alexandrium leei (Figure 2A–D)
Alexandrium pseudogonyaulax (Figure 2E–I)
Alexandrium tamiyavanichii (Figure 3A–F)
2.1.2. Phylogenetic Analyses
2.2. Effects of Temperature and Salinity on Growth of Alexandrium Species
2.2.1. Alexandrium fraterculus
2.2.2. Alexandrium tamiyavanichii
2.2.3. Alexandrium leei
2.2.4. Alexandrium pseudogonyaulax
2.3. Paralytic Shellfish Toxins
3. Discussion
3.1. Identifying Alexandrium Species
3.1.1. Morphological Observations
3.1.2. Phylogenetic Data
3.2. Effects of Temperature and Salinity on Growth of Alexandrium Species
3.2.1. Alexandrium fraterculus
3.2.2. Alexandrium tamiyavanichii
3.2.3. Alexandrium leei
3.2.4. Alexandrium pseudogonyaulax
3.3. Toxins
4. Conclusions
5. Materials and Methods
5.1. Temperature, Salinity, and Sampling
5.2. Cell Isolation and Maintenance
5.3. DNA Extraction, Sequencing, and Phylogenetic Analysis
5.3.1. DNA Extraction and Amplification
- Denaturation at 94 °C for 30 s;
- Annealing at 47 °C–55 °C for 45 s;
- Extension at 72 °C for 90 s.
5.3.2. Phylogenetic and Bioinformatic Analysis
5.4. Growth Experiments
5.5. Paralytic Shellfish Toxin Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Guiry, M.D.; Guiry, G.M. AlgaeBase. World-Wide Electronic Publication, National University of Ireland, Galway. 2024. Available online: https://www.algaebase.org (accessed on 21 November 2024).
- Anderson, D.M.; Alpermann, T.J.; Cembella, A.D.; Collos, Y.; Masseret, E.; Montresor, M. The globally distributed genus Alexandrium: Multifaceted roles in marine ecosystems and impacts on human health. Harmful Algae 2012, 14, 10–35. [Google Scholar] [CrossRef] [PubMed]
- Van de Waal, D.; Tillmann, U.; Martens, H.; Krock, B.; Van Scheppeningen, Y.; John, U. Characterization of multiple isolates from an Alexandrium ostenfeldii bloom in The Netherlands. Harmful Algae 2015, 49, 94–104. [Google Scholar] [CrossRef]
- Liow, G.R.; Lau, W.L.S.; Law, I.K.; Gu, H.; Leaw, C.P.; Lim, P.T. Sexual processes and life cycle transitions of the tropical Pacific Alexandrium minutum (Dinophyceae). Phycol. Res. 2021, 69, 188–199. [Google Scholar] [CrossRef]
- Townhill, B.L.; Tinker, J.; Jones, M.; Pitois, S.; Creach, V.; Simpson, S.D.; Dye, S.; Bear, E.; John, P.K. Harmful algal blooms and climate change: Exploring future distribution changes. ICES J. Mar. Sci. 2018, 75, 1882–1893. [Google Scholar] [CrossRef]
- Young, N.; Sharpe, R.A.; Barciela, R.; Nichols, G.; Davidson, K.; Berdalet, E.; Fleming, L.E. Marine harmful algal blooms and human health: A systematic scoping review. Harmful Algae 2020, 98, 101901. [Google Scholar] [CrossRef]
- Park, T.G.; Lim, W.A.; Park, Y.T.; Lee, C.K.; Jeong, H.J. Economic impact, management and mitigation of red tides in Korea. Harmful Algae 2013, 30, S131–S143. [Google Scholar] [CrossRef]
- Wagey, G.A.; Wiadnyana, N.N.; Taylor, F.J.R. Short note on Alexandrium affine (Inoe and Fukuyo) Balech red tide in Ambon Bay Indonesia. SEAHAB 1998, 4, 1–2. [Google Scholar]
- Sidabutar, T.; Srimariana, E.S.; Cappenberg, H.A.W.; Wouthuyzen, S. Harmful algal bloom of the three selected coastal bays in Indonesia. IOP Conf. Ser. Earth Environ. Sci. 2022, 1119, 012035. [Google Scholar] [CrossRef]
- Tamiyavanich, S.; Kodama, M.; Fukuyo, Y. The occurrence of paralytic shellfish poisoning in Thailand. In Toxic Dinoflag; Anderson, D.M., White, A.W., Eds.; Elsevier: Amsterdam, The Netherlands, 1985; pp. 521–524. [Google Scholar]
- Fukuyo, Y.; Pholpunthin, P.; Yoshida, K. Protogonyaulaar (Dinophyceae) in the Gulf of Thailand. Bull. Plankton Soc. Jpn. 1988, 35, 9–20. [Google Scholar]
- Piumsomboon, A.; Songroop, C.; Kungsuwan, A.; Polpunthin, P. Species of the Dinoflagellate genus Alexandrium (Gonyaulacales) in the gulf of Thailand. In Harmful Algal Blooms 2000; Hallegraeff, G.M., Blackbum, S.I., Bolch, C.J., Lewis, R.J., Eds.; Intergovernmental Oceanographic Commission of UNESCO: Paris, France, 2001; pp. 12–15. [Google Scholar]
- Kodama, M.; Ogata, T.; Fukuyo, Y.; Ishimaru, T.; Pholpunthin, P.; Wisessang, S.; Saitanu, K.; Panikiyakarn, V.; Piyakarnchana, T. Non-toxic strains Protogonyaulax. Nippon. Suisan Gakkaishi 1987, 53, 1491. [Google Scholar] [CrossRef]
- Pholpunthin, P.; Wisessang, S.; Ogata, T.; Fukuyo, Y.; Kodama, M.; Ishimaru, T.; Piyakarnchana, T. The Second Asian Fisheries Forum; Hirano, R., Hanyu, I., Eds.; The Asian Fisheries Society: Manila, Philippines, 1990; pp. 903–906. [Google Scholar]
- Fu, Z.; Piumsomboon, A.; Punnarak, P.; Uttayarnmanee, P.; Leaw, C.P.; Lim, P.T.; Wang, A.; Gu, H. Diversity and distribution of harmful microalgae in the Gulf of Thailand assessed by DNA metabarcoding. Harmful Algae 2021, 106, 102063. [Google Scholar] [CrossRef] [PubMed]
- Lim, P.T.; Ogata, T. Salinity effect on growth and toxin production of four tropical Alexandrium species (Dinophyceae). Toxicon 2005, 45, 699–710. [Google Scholar] [CrossRef] [PubMed]
- Lau, W.L.S.; Law, K.; Liow, G.R.; Hii, K.S.; Usup, G.; Lim, P.T.; Leaw, C.P. Life-history stages of natural bloom populations and the bloom dynamics of a tropical Asian ribotype of Alexandrium minutum. Harmful Algae 2017, 70, 52–63. [Google Scholar] [CrossRef]
- Abdullah, N.; Teng, S.T.; Hanifah, A.H.; Law, I.K.; Tan, T.H.; Krock, B.; Harris, T.M.; Nagai, S.; Lim, P.T.; Tillmannm, U.; et al. Thecal plate morphology, molecular phylogeny, and toxin analyses reveal two novel species of Alexandrium (Dinophyceae) and their potential for toxin production. Harmful Algae 2023, 127, 102475. [Google Scholar] [CrossRef]
- Nguyen, N.L.; Larsen, J. Gonyaucales. In Potentially Toxic Microalgae of Vietnamese Waters; Nguyen, N.L., Larsen, J., Eds.; Opera Botanica; Council for Nordic Publication in Botany: Copenhagen, Denmark, 2004; Volume 140, pp. 5–216. [Google Scholar]
- Nguyen-Ngoc, L.; Larsen, J. On the genus Alexandrium (Dinoflagellata) in Vietnamese waters:-two new records of A. satoanum and A. tamutum. In Proceedings, International Conference on Harmful Algae; Moestrup, Ø., Doucette, G., Enevoldsen, H., Godhe, A., Hallegraeff, G., Luckas, B., Lundholm, N., Lewis, J., Rengefors, K., Sellner, K., et al., Eds.; International Society for the Study of Harmful Algae and Intergovernmental Oceanographic Commission of UNESCO: Copenhagen, Denmark, 2008; pp. 216–218. [Google Scholar]
- Nguyen-Luong, T.; Nguyen-Ngoc, L. Alexandrium species in Ben Tra—Tra Vinh coastal waters. Sai Gon Univ. J. Sci. 2016, 16, 92–101, (In Vietnamese with English abstract). [Google Scholar]
- Chu-Van, T.; Nguyen-Thi, M.H.; Le-Thanh, T.; Ton-That, P.; Nguyen-Ngoc, L.; Do-Thi, B.L. Distribution of harmful potential microalgae in some fishery culture area s in coastal waters of Vietnam. In Proceedings of the National Conference on Marine Biology and Sustainable Development; Publishing House of Natural Science and Technology: Hanoi, Vietnam, 2009; pp. 491–500, (In Vietnamese with English Abstract). [Google Scholar]
- Nguyen-Ngoc, L. An autecological study of the potentially toxic dinoflagellate Alexandrium affine isolated from Vietnamese waters. Harmful Algae 2004, 3, 117–129. [Google Scholar] [CrossRef]
- Band-Schmidt, C.J.; Lechuga-Devéze, C.H.; Kulis, D.M.; Anderson, D.M. Culture studies of Alexandrium affine Dinophyceae, a non-toxic cyst forming dinoflagellate from Bahía Concepción, Gulf of California. Bot. Mar. 2003, 46, 44–54. [Google Scholar] [CrossRef]
- Touzet, N.; Franco, J.M.; Raine, R. Morphogenetic diversity and biotoxin composition of Alexandrium (Dinophyceae) in Irish coastal waters. Harmful Algae 2008, 7, 782–797. [Google Scholar] [CrossRef]
- Tardivo Kubis, J.A.; Rodríguez, F.; Rossignoli, A.E.; Riobó, P.; Aguiar Juárez, D.; Sar, E.A.; Sunesen, I. Morphological, molecular and toxinological analyses of Alexandrium affine (Dinophyceae) from marine coastal waters of Buenos Aires Province (Argentina). Phycologia 2023, 62, 341–351. [Google Scholar] [CrossRef]
- Kim, H.S.; Park, H.; Wang, H.; Kim, T.; Ki, J.S. Saxitoxins-producing potential of the marine dinoflagellate Alexandrium affine and its environmental implications revealed by toxins and transcriptome profiling. Mar. Environ. Res. 2023, 185, 105874. [Google Scholar] [CrossRef]
- John, U.; Litaker, R.W.; Montresor, M.; Murray, S.; Brosnahan, M.L.; Anderson, D.M. Formal revision of the Alexandrium tamarense species complex (Dinophyceae) taxonomy: The introduction of five species with emphasis on molecular-based (rDNA) classification. Protist 2014, 165, 779–804. [Google Scholar] [CrossRef] [PubMed]
- Shin, H.H.; Li, Z.; Kim, H.J.; Park, B.S.; Lee, J.; Shin, A.Y.; Park, T.G.; Lee, K.W.; Han, K.H.; Youn, J.Y.; et al. Alexandrium catenella (Group I) and A. pacificum (Group IV) cyst germination, distribution, and toxicity in Jinhae-Masan Bay, Korea. Harmful Algae 2021, 110, 102122. [Google Scholar] [CrossRef] [PubMed]
- Gómez, F.; Artigas, L.F. Redefinition of the dinoflagellate genus Alexandrium based on Centrodinium: Reinstatement of Gessnerium and Protogonyaulax, and Episemicolon gen. nov. (Gonyaulacales, Dinophyceae). J. Mar. Biol. 2019, 2019, 1284104. [Google Scholar] [CrossRef]
- Mertens, K.N.; Adachi, M.; Anderson, D.M.; Band-Schmidt, C.J.; Bravo, I.; Brosnahan, M.L.; Bolch, C.J.; Calado, A.J.; Carbonell-Moore, M.C.; Chomérat, N.; et al. Morphological and phylogenetic data do not support the split of Alexandrium into four genera. Harmful Algae 2020, 98, 101902. [Google Scholar] [CrossRef]
- Klemm, K.; Cembella, A.; Clarke, D.; Cusack, C.; Arneborg, L.; Karlson, B.; Liu, Y.; Naustvoll, L.; Siano, R.; Gran-Stadniczenko, S.; et al. Apparent biogeographical trends in Alexandrium blooms for northern Europe: Identifying links to climate change and effective adaptive actions. Harmful Algae 2022, 119, 102335. [Google Scholar] [CrossRef]
- Collos, Y.; Gagne, C.; Laabir, M.; Vaquer, A.; Cecchi, P.; Souchu, P. Nitrogenous nutrition of Alexandrium catenella (Dinophyceae) in cultures and in Thau lagoon, southern France. Harmful Algae 2004, 40, 96–103. [Google Scholar]
- Collos, Y.; Vaquer, A.; Laabir, M.; Abadie, E.; Laugier, T.; Pastoureaud, A.; Souchu, P. Contributions of several nitrogen sources to growth of Alexandrium catenella during blooms in Thau lagoon, southern France. Harmful Algae 2007, 6, 781–789. [Google Scholar] [CrossRef]
- Collos, Y.; Bec, B.; Jauzein, C.; Abadie, E.; Laugier, T.; Lautier, J.; Pastoureaud, A.; Souchu, P.; Vaquer, A. Oligotrophication and emergence of picocyanobacteria and a toxic dinoflagellate in Thau lagoon, southern France. J. Sea Res. 2009, 61, 68–75. [Google Scholar] [CrossRef]
- Jauzein, C.; Labry, C.; Youenou, A.; Quéré, J.; Delmas, D.; Collos, Y. Growth an phosphorus uptake by the toxic dinoflagellate Alexandrium catenella (Dinophyceae) in response to phosphate limitation. J. Phycol. 2010, 46, 926–936. [Google Scholar] [CrossRef]
- Menezes, M.; Branco, S.; Miotto, M.C.; Alves-de-Souza, C. The Genus Alexandrium (Dinophyceae, Dinophyta) in Brazilian Coastal Waters. Front. Mar. Sci. 2018, 5, 421. [Google Scholar] [CrossRef]
- Balech, E. The Genus Alexandrium Halim (Dinoflagellata). In Sherkin Island Marine Station; Sherkin Island Co.: Cork, Ireland, 1995. [Google Scholar]
- Usup, G.; Pin, L.C.; Ahmad, A.; Teen, L.P. Alexandrium (Dinophyceae) species in Malaysian waters. Harmful Algae 2002, 1, 265–275. [Google Scholar] [CrossRef]
- Hernández-Becerril, D.U.; Pichardo-Velarde, J.G.; Alonso-Rodríguez, R.; Maciel-Baltazar, E.; Morquecho, L.; Esqueda-Lara, K.; Barón-Campis, S.A.; Quiroz-González, N. Diversity and distribution of species of the planktonic dinoflagellate genus Alexandrium (Dinophyta) from the tropical and subtropical Mexican Pacific Ocean. Bot. Mar. 2023, 66, 539–557. [Google Scholar] [CrossRef]
- Kita, T.; Fukuyo, Y. Description of the gonyaulacoid dinoflagellate Alexandrium hiranoi sp. nov. inhabiting tidepools on Japanese Pacific coast. Bull. Plankton Soc. Jpn. 1988, 35, 1–7. [Google Scholar]
- Lim, P.T.; Leaw, C.P.; Kaga, S.; Sekiguchi, K.; Ogata, T. Growth responses of five non toxic Alexandrium species (dinophyceae) to temperature and salinity. Mar. Res. Indones. 2007, 32, 189–195. [Google Scholar] [CrossRef]
- Prézelin, B.B.; Sweeney, B.M. Characterization of photosynthetic rhythms in marine dinoflagellates: II. Photosynthesis-irradiance curves and in vivo chlorophyll a fluorescence. Plant Physiol. 1977, 60, 388–392. [Google Scholar] [CrossRef]
- Lee, K.H.; Jeong, H.J.; Kang, H.C.; Ok, J.H.; You, J.H.; Park, S.A. Growth rates and nitrate uptake of co-occurring red-tide dinoflagellates Alexandrium affine and A. fraterculus as a function of nitrate concentration under light-dark and continuous light conditions. Algae 2019, 34, 237–251. [Google Scholar] [CrossRef]
- Lim, P.T.; Leaw, C.P.; Usup, G.; Kobiyama, A.; Koike, K.; Ogata, T. Effects of light and temperature on growth, nitrate uptake, and toxin production of two tropical dinoflagellates: Alexandrium tamiyavanichii and Alexandrium minutum (Dinophyceae) 1. J. Phycol. 2006, 42, 786–799. [Google Scholar] [CrossRef]
- Shikata, T.; Taniguchi, E.; Sakamoto, S.; Kitatsuji, S.; Yamasaki, Y.; Yoshida, M.; Oikawa, H. Phylogeny, growth and toxicity of the noxious red-tide dinoflagellate Alexandrium leei in Japan. Reg. Stud. Mar. Sci. 2020, 36, 101265. [Google Scholar] [CrossRef]
- Tulatz, S.; Krock, B.; Tillmann, U.; Meunier, C.L. Effects of Temperature, Salinity and CO2 Concentration on Growth and Toxin Production of the Harmful Algal Bloom species Alexandrium pseudogonyaulax (Dinophyceae) from the Danish Limfjord. Harmful Algae 2024, 140, 102756. [Google Scholar] [CrossRef]
- Juhl, A.R. Growth rates and elemental composition of Alexandrium monilatum, a red-tide dinoflagellate. Harmful Algae 2005, 4, 287–295. [Google Scholar] [CrossRef]
- Hakanen, P.; Suikkanen, S.; Franzén, J.; Franzén, H.; Kankaanpää, H.; Kremp, A. Bloom and toxin dynamics of Alexandrium ostenfeldii in a shallow embayment at the SW coast of Finland, northern Baltic Sea. Harmful Algae 2012, 15, 91–99. [Google Scholar] [CrossRef]
- Bill, B.D.; Moore, S.K.; Hay, L.R.; Anderson, D.M.; Trainer, V.L. Effects of temperature and salinity on the growth of Alexandrium (Dinophyceae) isolates from the Salish Sea. J. Phycol. 2016, 52, 230–238. [Google Scholar] [CrossRef] [PubMed]
- Yoshida, M. Alexandrium spp. (Dinophyceae) in the western North Pacific. Fish. Sci. 2002, 68 (Suppl. S1), 511–514. [Google Scholar] [CrossRef] [PubMed]
- Lim, P.T.; Sato, S.; Van Thuoc, C.; Tu, P.T.; Huyen, N.T.M.; Takata, Y.; Yoshida, M.; Kobiyama, A.; Koike, K.; Ogata, T. Toxic Alexandrium minutum (Dinophyceae) from Vietnam with new gonyautoxin analogue. Harmful Algae 2007, 6, 321–331. [Google Scholar] [CrossRef]
- Subong, B.J.J.; Benico, G.A.; Sulit, A.K.L.; Mendoza, C.O.; Cruz, L.J.; Azanza, R.V.; Jimenez, E.C. Toxicity and protein expression of Alexandrium species collected in the Philippine waters. Philipp. J. Sci. 2017, 146, 425–436. [Google Scholar]
- Triki, H.Z.; Laabir, M.; Moeller, P.; Chomérat, N.; Daly-Yahia, O.K. First report of goniodomin A production by the dinoflagellate Alexandrium pseudogonyaulax developing in southern Mediterranean (Bizerte Lagoon, Tunisia). Toxicon 2016, 111, 91–99. [Google Scholar] [CrossRef]
- Keller, M.D.; Selvin, R.C.; Claus, W.; Guillard, R.R. Media for the culture of oceanic ultraphytoplankton 1, 2. J. Phycol. 1987, 23, 633–638. [Google Scholar] [CrossRef]
- Fritz, L.; Triemer, R.E. A rapid simple technique utilizing calcofluor white M2R for the visualization of dinoflagellate thecal plates 1. J. Phycol. 1985, 21, 662–664. [Google Scholar] [CrossRef]
- Steidinger, K.A.; Tangen, K. Chapter 3 Dinoflagellates. In Identifying Marine Phytoplankton; Academy Press: St. Petersburg, FL, USA, 1997; pp. 387–584. [Google Scholar]
- Mertens, K.N.; Carbonell-Moore, M.C.; Pospelova, V.; Head, M.J.; Highfield, A.; Schroeder, D.; Gu, H.; Andree, K.B.; Fernandez, M.; Yamaguchi, A.; et al. Pentaplacodinium saltonense gen. et sp. nov.(Dinophyceae) and its relationship to the cyst-defined genus Operculodinium and yessotoxin-producing Protoceratium reticulatum. Harmful Algae 2018, 71, 57–77. [Google Scholar] [CrossRef]
- Mertens, K.N.; Morquecho, L.; Carbonell-Moore, C.; Meyvisch, P.; Gu, H.; Bilien, G.; Duval, A.; Derrien, A.; Pospelova, V.; Śliwińska, K.K.; et al. Pentaplacodinium lapazense sp. nov. from Central and Southern Gulf of California, a new non-toxic gonyaulacalean resembling Protoceratium reticulatum. Mar. Micropaleontol. 2023, 178, 102187. [Google Scholar] [CrossRef]
- Mertens, K.N.; Bringué, M.; Van Nieuwenhove, N.; Takano, Y.; Pospelova, V.; Rochon, A.; De Vernal, A.; Radi, T.; Dale, B.; Patterson, R.T.; et al. Process length variation of the cyst of the dinoflagellate Protoceratium reticulatum in the North Pacific and Baltic-Skagerrak region: Calibration as an annual density proxy and first evidence of pseudo-cryptic speciation. J. Quat. Sci. 2012, 27, 734–744. [Google Scholar] [CrossRef]
- Litaker, R.W.; Vandersea, M.W.; Faust, M.A.; Kibler, S.R.; Chinain, M.; Holmes, M.J.; Holland, W.C.; Tester, P.A. Taxonomy of Gambierdiscus including four new species, Gambierdiscus caribaeus, Gambierdiscus carolinianus, Gambierdiscus carpenteri and Gambierdiscus ruetzleri (Gonyaulacales, Dinophyceae). Phycologia 2009, 48, 344–390. [Google Scholar] [CrossRef]
- Chinain, M.; Faust, M.A.; Pauillac, S. Morphology and molecular analyses of three toxic species of Gambierdiscus (Dinophyceae): G. pacificus, sp. nov., G. australes, sp. nov., and G. polynesiensis, sp. nov. J. Phycol. 1999, 35, 1282–1296. [Google Scholar] [CrossRef]
- Nishimura, T.; Sato, S.; Tawong, W.; Sakanari, H.; Uehara, K.; Shah, M.M.; Suda, S.; Yasumoto, T.; Taira, Y.; Yamaguchi, H.; et al. Genetic diversity and distribution of the ciguatera- causing dinoflagellate Gambierdiscus spp. (Dinophyceae) in coastal areas of Japan. PLoS ONE 2013, 8, e60882. [Google Scholar] [CrossRef] [PubMed]
- Sato, S.; Nishimura, T.; Uehara, K.; Sakanari, H.; Tawong, W.; Hariganeya, N.; Smith, K.; Rhodes, L.; Yasumoto, T.; Taira, Y.; et al. Phylogeography of Ostreopsis along West Pacific coast, with special reference to a novel clade from Japan. PLoS ONE 2011, 6, e27983. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
- Nguyen, L.T.; Schmidt, H.A.; Von Haeseler, A.; Minh, B.Q. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef]
- Trifinopoulos, J.; Nguyen, L.T.; von Haeseler, A.; Minh, B.Q. W-IQ-TREE: A fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Res. 2016, 44, W232–W235. [Google Scholar] [CrossRef]
- Chernomor, O.; Von Haeseler, A.; Minh, B.Q. Terrace aware data structure for phylogenomic inference from supermatrices. Syst. Biol. 2016, 65, 997–1008. [Google Scholar] [CrossRef]
- Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.; Von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef]
- Minh, B.Q.; Nguyen, M.A.T.; Von Haeseler, A. Ultrafast approximation for phylogenetic bootstrap. Mol. Biol. Evol. 2013, 30, 1188–1195. [Google Scholar] [CrossRef]
- Ronquist, F.; Teslenko, M.; Van Der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [PubMed]
- Guillard, R.R.L. Division rates. In Handbook of Phycological Methods: Culture Methods and Growth Measurements; Stein, J.R., Ed.; Cambridge University Press: Cambridge, UK, 1973; pp. 289–311. [Google Scholar]
- Wickham, H.; Bryan, J. Readxl: Read Excel Files. 2023. Available online: https://github.com/tidyverse/readxl (accessed on 9 August 2024).
- Fox, J.; Weisberg, S. An R Companion to Applied Regression, 3rd ed.; Sage: Thousand Oaks, CA, USA, 2019; Available online: https://socialsciences.mcmaster.ca/jfox/Books/Companion/ (accessed on 9 August 2024).
- Kassambara, A. _Rstatix: Pipe-Friendly Framework for Basic Statistical Tests_. R Package Version 0.7.2. 2023. Available online: https://CRAN.R-project.org/package=rstatix (accessed on 24 January 2024).
- Wickham, H. ggplot2: Elegant Graphics for Data Analysis; Springer: New York, NY, USA, 2016; ISBN 978-3-319-24277-4. Available online: https://ggplot2.tidyverse.org (accessed on 24 January 2024).
Taxa | References |
---|---|
Alexandrium affine (Inoue et Fukuyo) Balech 1985 | [22] |
A. compressum (Fukuyo, Yoshida et Inoue) Balech 1995 | [22] |
A. concavum (Gaarder) Balech, emend. Nguyen-Ngoc et Larsen 2004 | [22] |
A. foedum Balech 1990 | [21] |
A. fraterculus (Balech) Balech 1985, | [22] |
A. gaarderae Nguyen-Ngoc et Larsen nom. nov. 2004 | [22] |
A. globosum Nguyen-Ngoc et Larsen sp. nov 2004 | [22] |
A. insuetum Balech 1985 | [22] |
A. kutnerae (Balech) Balech 1985 | [22] |
A. leei Balech 1985, | [22] |
A. minutum Halim 1960 | [22] |
A. ostenfeldii (Paulsen) Balech et Tangen 1985 | [22] |
A. pseudogonyaulax (Biecheler) Horiguchi ex Yuki et Fukuyo 1992 | [22] |
A. satoanum Balech 1992 | [19] |
A. tamarense (Lebour) Balech 1995 | [22] |
A. tamiyavanichii Balech 1994, | [22] |
A. tamutum M.Montresor, A.Beran and U.John 2004 | [19,20] |
Alignment | Length (bp) | Conserved Sites | Variable Sites | Parsim-Infor Sites | Singleton Sites |
---|---|---|---|---|---|
D1–D3 | 1136 | 296 | 754 | 507 | 228 |
D8–D10 | 954 | 688 | 260 | 138 | 122 |
ITS–5.8S–ITS2 | 641 | 104 | 524 | 434 | 90 |
N1/N0 | N2/N1 | N3/N2 | N4/N3 | N5/N4 | N6/N5 | N7/N6 | N8/N7 | N9/N8 | |
---|---|---|---|---|---|---|---|---|---|
Salinity | Temperature 24 °C | ||||||||
15 | 0.28 | 0.04 | 0.20 | 0.43 | 0.58 | 0.40 | 0.58 | 0.36 | −0.17 |
20 | 0.42 | 0.19 | 0.13 | 1.06 | 0.02 | 0.36 | 0.64 | 0.36 | 0.48 |
25 | −0.01 | 0.21 | 0.56 | 0.76 | 0.41 | 0.66 | 0.44 | 0.28 | 0.19 |
30 | −0.06 | 0.49 | 0.56 | 0.55 | 0.22 | 0.80 | 0.35 | 0.40 | 0.12 |
35 | 0.29 | 0.14 | 0.47 | 0.49 | 0.45 | 0.57 | 0.47 | −0.13 | 0.50 |
Temperature 27 °C | |||||||||
15 | −0.16 | 0.85 | 0.65 | 0.63 | 0.46 | 0.31 | 0.31 | 0.06 | −0.27 |
20 | 0.39 | 0.65 | 0.80 | 0.42 | 0.50 | 0.56 | 0.33 | 0.15 | −0.75 |
25 | 0.55 | 0.68 | 0.61 | 0.55 | 0.35 | 0.55 | 0.36 | 0.09 | −1.20 |
30 | 0.53 | 0.66 | 0.82 | 0.60 | 0.27 | 0.64 | 0.06 | 0.11 | −1.07 |
35 | 0.51 | 0.87 | 0.65 | 0.48 | 0.37 | 0.59 | 0.28 | 0.12 | −0.63 |
N1/N0 | N2/N1 | N3/N2 | N4/N3 | N5/N4 | N6/N5 | N7/N6 | N8/N7 | N9/N8 | |
---|---|---|---|---|---|---|---|---|---|
Salinity | Temperature 24 °C | ||||||||
15 | −0.05 | 0.02 | −0.59 | −0.21 | −0.18 | −0.18 | −0.41 | −0.40 | −0.72 |
20 | 0.30 | 0.15 | −0.04 | 0.41 | 0.18 | 0.24 | 0.25 | −0.07 | −0.27 |
25 | 0.31 | 0.04 | 0.25 | 0.50 | 0.15 | 0.15 | 0.29 | 0.12 | −0.04 |
30 | 0.29 | 0.07 | −0.01 | 0.03 | −0.01 | 0.12 | 0.01 | 0.10 | 0.02 |
35 | 0.27 | −0.03- | 0.05 | 0.09 | 0.04 | 0.10 | 0.04 | −0.01 | −0.08 |
Temperature 27 °C | |||||||||
15 | 0.07 | 0.19 | −0.02 | −0.38 | −0.38 | −0.50 | −0.41 | −2.42 | 0.54 |
20 | 0.14 | 0.59 | 0.07 | 0.14 | 0.27 | 0.15 | 0.24 | 0.09 | −0.07 |
25 | 0.01 | 0.97 | 0.16 | 0.37 | 0.32 | 0.11 | 0.57 | 0.11 | 0.21 |
30 | 0.39 | 0.23 | 0.36 | 0.86 | 0.30 | 0.10 | 0.16 | 0.13 | 0.19 |
35 | 0.16 | 0.45 | 0.38 | 0.21 | 0.86 | 0.12 | 0.08 | 0.07 | 0.03 |
Toxins | LODs (Limits of Detection) | |
---|---|---|
E276-3 (fg/Cell) | E276-4 (fg/Cell) | |
C1/C2 | 1.58 | 0.98 |
GTX 4 | 11.27 | 6.97 |
GTX 1 | 15.46 | 9.56 |
dc GTX 2 | 0.85 | 0.52 |
dc GTX 3 | 0.73 | 0.45 |
GTX 2 | 0.95 | 0.59 |
GTX5 | 3.12 | 1.93 |
GTX3 | 1.02 | 0.63 |
Neo STX | 9.61 | 5.95 |
dcSTX | 1.73 | 1.07 |
STX | 1.41 | 0.87 |
Target | Primer | Nucleotide Sequence (5′ to 3′) | Reference |
---|---|---|---|
D1–D3 | D1R | ACCCGCTGAATTTAAGCATA | [61] |
D3B | TCGGAGGGAACCAGCTACTA | [61] | |
D8–D10 | FD8 | GGATTGGCTCTGAGGGTTGGG | [62] |
RB | GATAGGAAGAGCCGACATCGA | [62] | |
677R | TGTGCCGCCCCAGCCAAACT | [63] | |
421F | ACAGCCAAG GGA ACGGGCTT | [63] | |
ITS–5.8S–ITS2 | ITSA | GTAACAAGGTHTCCGTAGGT | [64] |
ITSB | AKATGCTTAARTTCAGCRGG | [64] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nguyen-Ngoc, L.; Luat, D.-M.; Doan-Nhu, H.; Pham, H.M.; Krock, B.; Huynh-Thi, N.D.; Tran-Thi, L.V.; Tran-Thi, M.H.; Pham, A.H.; Nguyen-Tam, V.; et al. Phylogenetic and Autecology Characteristics of Five Potentially Harmful Dinoflagellate Alexandrium Species (Dinophyceae, Gonyaulacales, Pyrocystaceae) in Tropical Waters: A. affine, A. fraterculus, A. leei, A. pseudogonyaulax, and A. tamiyavanichii. Toxins 2025, 17, 81. https://doi.org/10.3390/toxins17020081
Nguyen-Ngoc L, Luat D-M, Doan-Nhu H, Pham HM, Krock B, Huynh-Thi ND, Tran-Thi LV, Tran-Thi MH, Pham AH, Nguyen-Tam V, et al. Phylogenetic and Autecology Characteristics of Five Potentially Harmful Dinoflagellate Alexandrium Species (Dinophyceae, Gonyaulacales, Pyrocystaceae) in Tropical Waters: A. affine, A. fraterculus, A. leei, A. pseudogonyaulax, and A. tamiyavanichii. Toxins. 2025; 17(2):81. https://doi.org/10.3390/toxins17020081
Chicago/Turabian StyleNguyen-Ngoc, Lam, Dang-Minh Luat, H. Doan-Nhu, H. M. Pham, B. Krock, N. D. Huynh-Thi, L. V. Tran-Thi, M. H. Tran-Thi, Anh H. Pham, V. Nguyen-Tam, and et al. 2025. "Phylogenetic and Autecology Characteristics of Five Potentially Harmful Dinoflagellate Alexandrium Species (Dinophyceae, Gonyaulacales, Pyrocystaceae) in Tropical Waters: A. affine, A. fraterculus, A. leei, A. pseudogonyaulax, and A. tamiyavanichii" Toxins 17, no. 2: 81. https://doi.org/10.3390/toxins17020081
APA StyleNguyen-Ngoc, L., Luat, D.-M., Doan-Nhu, H., Pham, H. M., Krock, B., Huynh-Thi, N. D., Tran-Thi, L. V., Tran-Thi, M. H., Pham, A. H., Nguyen-Tam, V., Nhan-Luu, T. T., & Do, H. H. (2025). Phylogenetic and Autecology Characteristics of Five Potentially Harmful Dinoflagellate Alexandrium Species (Dinophyceae, Gonyaulacales, Pyrocystaceae) in Tropical Waters: A. affine, A. fraterculus, A. leei, A. pseudogonyaulax, and A. tamiyavanichii. Toxins, 17(2), 81. https://doi.org/10.3390/toxins17020081