The Pbo Cluster from Pseudomonas syringae pv. Phaseolicola NPS3121 Is Thermoregulated and Required for Phaseolotoxin Biosynthesis
Abstract
:1. Introduction
2. Results
2.1. Gene PSPPH_4550 Is Included within a Putative Genomic Island
2.2. Gene Expression Patterns
2.3. The Pbo Cluster Is Organized in Four Transcriptional Units
2.4. Production of Phaseolotoxin Requires the Participation of Pbo Genes
2.5. The Pbo Cluster Has a Limited Distribution among Pseudomonads and Is Not Associated with the Phaseolotoxin Cluster
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains, Media and Growth Conditions
4.2. Molecular Biology Techniques and Bioinformatics
4.3. Construction of P. syringae pv. Phaseolicola NPS3121 Mutants
4.4. Phaseolotoxin Bioassays
4.5. RNA Extraction and Reverse Transcription-PCR Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Arnold, D.L.; Lovell, H.C.; Jackson, R.W.; Mansfield, J.W. Pseudomonas syringae pv. phaseolicola: From ‘has bean’ to supermodel. Mol. Plant Pathol. 2011, 12, 617–627. [Google Scholar] [CrossRef]
- Mitchell, R.E. Isolation and structure of a chlorosis-inducing toxin of Pseudomonas phaseolicola. Phytochemistry 1976, 15, 1941–1947. [Google Scholar] [CrossRef]
- Tourte, C.; Manceau, C. A strain of Pseudomonas syringae which does not belong to pathovar phaseolicola produces phaseolotoxin. Eur. J. Plant Pathol. 1995, 101, 483–490. [Google Scholar] [CrossRef]
- Staskawicz, B.J.; Panopoulos, N.J. A rapid and sensitive microbiological assay for phaseolotoxin. Phytopathology 1979, 69, 663–666. [Google Scholar] [CrossRef]
- Mitchell, R.E.; Johnston, J.S.; Ferguson, A.R. Phaseolotoxin and other phosphosulphanyl compounds: Biological effects. Physiol. Plant Pathol. 1981, 19, 227–235. [Google Scholar] [CrossRef]
- Moore, R.E.; Niemczura, W.P.; Kwok, O.C.H.; Patil, S.S. Inhibitors of ornithine carbamoyltransferase from Pseudomonas syringae pv. phaseolicola. Revised structure of phaseolotoxin. Tetrahedron Lett. 1984, 25, 3931–3934. [Google Scholar] [CrossRef]
- Mitchell, R.E. Halo blight of beans: Toxin production by several Pseudomonas phaseolicola isolates. Physiol. Plant Pathol. 1978, 13, 37–49. [Google Scholar] [CrossRef]
- Nuske, J.; Fritsche, W. Phaseolotoxin production by Pseudomonas syringae pv. phaseolicola: The influence of temperature. J. Basic Microbiol. 1989, 29, 441–447. [Google Scholar] [CrossRef]
- Hernandez-Morales, A.; De la Torre-Zavala, S.; Ibarra-Laclette, E.; Hernandez-Flores, J.L.; Jofre-Garfias, A.E.; Martinez-Antonio, A.; Alvarez-Morales, A. Transcriptional profile of Pseudomonas syringae pv. phaseolicola NPS3121 in response to tissue extracts from a susceptible Phaseolus vulgaris L. cultivar. BMC Microbiol. 2009, 9, 257. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Aguilera, S.; López-López, K.; Nieto, Y.; Garcidueñas-Piña, R.; Hernández-Guzmán, G.; Hernández-Flores, J.L.; Murillo, J.; Alvarez-Morales, A. Functional characterization of the gene cluster from Pseudomonas syringae pv. phaseolicola NPS3121 involved in synthesis of phaseolotoxin. J. Bacteriol. 2007, 189, 2834–2843. [Google Scholar] [CrossRef] [Green Version]
- Mosqueda, G.; Van den Broeck, G.; Saucedo, O.; Bailey, A.M.; Alvarez-Morales, A.; Herrera-Estrella, L. Isolation and characterization of the gene from Pseudomonas syringae pv. phaseolicola encoding the phaseolotoxin-insensitive ornithine carbamoyltransferase. Mol. Gen. Genet. 1990, 222, 461–466. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Li, P.; Deng, Z.; Zhao, C. Ornithine transcarbamylase ArgK plays a dual role for the self-defense of phaseolotoxin producing Pseudomonas syringae pv. phaseolicola. Sci. Rep. 2015, 5, 12892. [Google Scholar] [CrossRef] [Green Version]
- Hernández-Guzmán, G.; Alvarez-Morales, A. Isolation and characterization of the gene coding for the amidinotransferase involved in the biosynthesis of phaseolotoxin in Pseudomonas syringae pv. phaseolicola. Mol. Plant-Microbe Interact. 2001, 14, 545–554. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.X.; Patil, S.S. The phtE locus in the phaseolotoxin gene cluster has ORFs with homologies to genes encoding amino acid transferases, the AraC family of transcriptional factors, and fatty acid desaturases. Mol. Plant-Microbe Interact. 1997, 10, 947–960. [Google Scholar] [CrossRef] [Green Version]
- Arai, T.; Kino, K. A novel L-amino acid ligase is encoded by a gene in the phaseolotoxin biosynthetic gene cluster from Pseudomonas syringae pv. phaseolicola 1448A. Biosci. Biotechnol. Biochem. 2008, 72, 3048–3050. [Google Scholar] [CrossRef] [Green Version]
- De la Torre-Zavala, S.; Aguilera, S.; Ibarra-Laclette, E.; Hernandez-Flores, J.L.; Hernández-Morales, A.; Murillo, J.; Alvarez-Morales, A. Gene expression of Pht cluster genes and a putative non-ribosomal peptide synthetase required for phaseolotoxin production is regulated by GacS/GacA in Pseudomonas syringae pv. phaseolicola. Res. Microbiol. 2011, 162, 488–498. [Google Scholar] [CrossRef] [PubMed]
- Ramírez-Zapata, D.; Ramos, C.; Aguilera, S.; Bardaji, L.; Martínez-Gil, M.; Murillo, J. Two homologues of the global regulator Csr/Rsm redundantly control phaseolotoxin biosynthesis and virulence in the plant pathogen Pseudomonas amygdali pv. phaseolicola 1448A. Microorganisms 2020, 8, 1536. [Google Scholar] [CrossRef]
- Barta, T.M.; Kinscherf, T.G.; Willis, D.K. Regulation of tabtoxin production by the lemA gene in Pseudomonas syringae. J. Bacteriol. 1992, 174, 3021–3029. [Google Scholar] [CrossRef] [Green Version]
- Hrabak, E.M.; Willis, D.K. Involvement of the lemA gene in production of syringomycin and protease by Pseudomonas syringae pv. syringae. Mol. Plant-Microbe Interact. 1993, 6, 368–375. [Google Scholar] [CrossRef]
- Rich, J.J.; Kinscherf, T.G.; Kitten, T.; Willis, D.K. Genetic evidence that the gacA gene encodes the cognate response regulator for the lemA sensor in Pseudomonas syringae. J. Bacteriol. 1994, 176, 7468–7475. [Google Scholar] [CrossRef] [Green Version]
- Waspi, U.; Blanc, D.; Winkler, T.; Ruedi, P.; Dudler, R. Syringolin, a novel peptide elicitor from Pseudomonas syringae pv. syringae that induces resistance to Pyricularia oryzae in rice. Mol. Plant-Microbe Interact. 1998, 11, 727–733. [Google Scholar] [CrossRef] [Green Version]
- Bender, C.L.; Alarcón-Chaidez, F.; Gross, D.C. Pseudomonas syringae phytotoxins: Mode of action, regulation, and biosynthesis by peptide and polyketide synthetases. Microbiol. Mol. Biol. Rev. 1999, 63, 266–292. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Finking, R.; Marahiel, M.A. Biosynthesis of nonribosomal peptides. Annu. Rev. Microbiol. 2004, 58, 453–488. [Google Scholar] [CrossRef]
- Arrebola, E.; Cazorla, F.M.; Pérez-García, A.; de Vicente, A. Chemical and metabolic aspects of antimetabolite toxins produced by Pseudomonas syringae pathovars. Toxins 2011, 3, 1089–1110. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sawada, H.; Kanaya, S.; Tsuda, M.; Suzuki, F.; Azegami, K.; Saitou, N. A phylogenomic study of the OCTase genes in Pseudomonas syringae pathovars: The horizontal transfer of the argK-tox cluster and the evolutionary history of OCTase genes on their genomes. J. Mol. Evol. 2002, 54, 437–457. [Google Scholar] [CrossRef]
- Murillo, J.; Bardaji, L.; de la Fuente, L.N.; Führer, M.E.; Aguilera, S.; Álvarez-Morales, A. Variation in conservation of the cluster for biosynthesis of the phytotoxin phaseolotoxin in Pseudomonas syringae suggests at least two events of horizontal acquisition. Res. Microbiol. 2011, 162, 253–261. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Nie, J.; Ward, L.; Madani, M.; Hsiang, T.; Zhao, Y.; De Boer, S.H. Comparative genomics-guided loop-mediated isothermal amplification for characterization of Pseudomonas syringae pv. phaseolicola. J. Appl. Microbiol. 2009, 107, 717–726. [Google Scholar] [CrossRef] [PubMed]
- Bardaji, L.; Echeverría, M.; Rodríguez-Palenzuela, P.; Martínez-García, P.M.; Murillo, J. Four genes essential for recombination define GInts, a new type of mobile genomic island widespread in bacteria. Sci. Rep. 2017, 7, 46254. [Google Scholar] [CrossRef] [Green Version]
- Jackson, R.W.; Vinatzer, B.; Arnold, D.L.; Dorus, S.; Murillo, J. The influence of the accessory genome on bacterial pathogen evolution. Mob. Genet. Elem. 2011, 1, 55–65. [Google Scholar] [CrossRef] [Green Version]
- Genka, H.; Baba, T.; Tsuda, M.; Kanaya, S.; Mori, H.; Yoshida, T.; Noguchi, M.T.; Tsuchiya, K.; Sawada, H. Comparative analysis of argK-tox clusters and their flanking regions in phaseolotoxin-producing Pseudomonas syringae pathovars. J. Mol. Evol. 2006, 63, 401–414. [Google Scholar] [CrossRef]
- Fujikawa, T.; Sawada, H. Genome analysis of Pseudomonas syringae pv. actinidiae biovar 6, which produces the phytotoxins, phaseolotoxin and coronatine. Sci. Rep. 2019, 9, 3836. [Google Scholar] [CrossRef] [PubMed]
- Reimer, J.M.; Aloise, M.N.; Harrison, P.M.; Schmeing, T.M. Synthetic cycle of the initiation module of a formylating nonribosomal peptide synthetase. Nature 2016, 529, 239–242. [Google Scholar] [CrossRef] [PubMed]
- Bloudoff, K.; Schmeing, T.M. Structural and functional aspects of the nonribosomal peptide synthetase condensation domain superfamily: Discovery, dissection and diversity. Biochim. Biophys. Acta Proteins Proteom. 2017, 1865, 1587–1604. [Google Scholar] [CrossRef]
- Weissman, K.J. Introduction to polyketide biosynthesis. Methods Enzymol. 2009, 459, 3–16. [Google Scholar] [CrossRef]
- Mitchell, R.E.; Parsons, E.A. A naturally-occurring analogue of phaseolotoxin (bean haloblight toxin). Phytochemistry 1977, 16, 280–281. [Google Scholar] [CrossRef]
- Tamura, K.; Imamura, M.; Yoneyama, K.; Kohno, Y.; Takikawa, Y.; Yamaguchi, I.; Takahashi, H. Role of phaseolotoxin production by Pseudomonas syringae pv. actinidiae in the formation of halo lesions of kiwifruit canker disease. Physiol. Mol. Plant Pathol. 2002, 60, 207–214. [Google Scholar] [CrossRef]
- Sieber, S.; Mathew, A.; Jenul, C.; Kohler, T.; Bär, M.; Carrion, V.J.; Cazorla, F.M.; Stalder, U.; Hsieh, Y.C.; Bigler, L.; et al. A Volatile Signal Controls Virulence in the Plant Pathogen Pseudomonas syringae pv. syringae and a Strategy for Infection Control in Organic Farming. ChemRxiv 2020. [Google Scholar] [CrossRef]
- Arrebola, E.; Carrion, V.J.; Cazorla, F.M.; Pérez-García, A.; Murillo, J.; de Vicente, A. Characterisation of the mgo operon in Pseudomonas syringae pv. syringae UMAF0158 that is required for mangotoxin production. BMC Microbiol. 2012, 12, 10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Greenwald, J.W.; Greenwald, C.J.; Philmus, B.J.; Begley, T.P.; Gross, D.C. RNA-seq analysis reveals that an ECF σ factor, AcsS, regulates achromobactin biosynthesis in Pseudomonas syringae pv. syringae B728a. PLoS ONE 2012, 7, e34804. [Google Scholar] [CrossRef] [Green Version]
- King, E.O.; Ward, N.K.; Raney, D.E. Two simple media for the demonstration of pyocyanin and fluorescin. J. Lab Clin. Med. 1954, 44, 301–307. [Google Scholar] [CrossRef]
- Miller, J.H. Experiments in Molecular Genetics; Cold Spring Harbor Laboratory: Cold Spring Harbor, NY, USA, 1972. [Google Scholar]
- Green, M.R.; Sambrook, J. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 2012. [Google Scholar]
- Yanisch-Perron, C.; Vieira, J.; Messing, J. Improved M13 phage cloning vectors and host strains: Nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 1985, 33, 103–119. [Google Scholar] [CrossRef]
- Peet, R.C.; Lindgren, P.B.; Willis, D.K.; Panopoulos, N.J. Identification and cloning of genes involved in phaseolotoxin production by Pseudomonas syringae pv. “phaseolicola”. J. Bacteriol. 1986, 166, 1096–1105. [Google Scholar] [CrossRef] [Green Version]
- Chen, W.P.; Kuo, T.T. A simple and rapid method for the preparation of gram-negative bacterial genomic DNA. Nucleic Acids Res. 1993, 21, 2260. [Google Scholar] [CrossRef]
- Joardar, V.; Lindeberg, M.; Jackson, R.W.; Selengut, J.; Dodson, R.; Brinkac, L.M.; Daugherty, S.C.; Deboy, R.; Durkin, A.S.; Giglio, M.G.; et al. Whole-genome sequence analysis of Pseudomonas syringae pv. phaseolicola 1448A reveals divergence among pathovars in genes involved in virulence and transposition. J. Bacteriol. 2005, 187, 6488–6498. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kelley, L.A.; Mezulis, S.; Yates, C.M.; Wass, M.N.; Sternberg, M.J. The Phyre2 web portal for protein modeling, prediction and analysis. Nat. Protoc. 2015, 10, 845–858. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mistry, J.; Chuguransky, S.; Williams, L.; Qureshi, M.; Salazar, G.A.; Sonnhammer, E.L.L.; Tosatto, S.C.E.; Paladin, L.; Raj, S.; Richardson, L.J.; et al. Pfam: The protein families database in 2021. Nucleic Acids Res. 2021, 49, D412–D419. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Windgassen, M.; Urban, A.; Jaeger, K.E. Rapid gene inactivation in Pseudomonas aeruginosa. FEMS Microbiol. Lett. 2000, 193, 201–205. [Google Scholar] [CrossRef]
- Staskawicz, B.J.; Panopoulos, N.J.; Hoogenraad, N.J. Phaseolotoxin insensitive ornithine carbamoyltransferase of Pseudomonas syringae pv. phaseolicola: Basis for immunity to phaseolotoxin. J. Bacteriol. 1980, 142, 720–723. [Google Scholar] [CrossRef] [Green Version]
Gene | Locus_Tag | Product | Conserved Domains (Confidence) | Annotation or Pfam Domain(s), Pfam Clan (E-Value) a |
---|---|---|---|---|
PSPPH_4538 | AAZ34646.1 | Catalytic component of the Tn7 transposition system (100) | Transposon Tn7-like transposase protein A, CL0236 (2.2 × 10−22) | |
PSPPH_4539 | AAZ33379.1 | Bacteriophage Mu transposase core domain (100) | Transposon Tn7-like transposase protein B, Integrase core domain, CL0219 (1.2 × 10−3) | |
PSPPH_4540 | Transposon Tn7-like transposition protein C (100) | Pseudogene | ||
PSPPH_4541 | AAZ34404.1 | Transposase TniQ. Transposition of the mercury-resistance (99.9) | TniQ (8.4 × 10−7) | |
PSPPH_4542 | AAZ37460.1 | SAP domain (51.8) | Tn7-like transposition protein D (4.9 × 10−4) | |
PSPPH_4543 | AAZ36781.1 | RecO N-terminal domain-like (25.4) | Hypothetical protein | |
pboP | PSPPH_4544 | AAZ33084.1 | Epoxide hydrolase (100) | Alpha/beta hydrolase family, CL0028 (3.3 × 10−10) |
pboO | PSPPH_4545 | AAZ34142.1 | Synthetase c, a nonribosomal peptide synthetase termination module (100) | Condensation domain, CL0149 (2.7 × 10−3) |
pboN | PSPPH_4546 | AAZ33594.1 | Initiation module of LgrA in the thiolation2 state (100) | AMP-binding enzyme, CL0378 (8.5 × 10−80), CL0531 (2.3 × 10−6) |
pboM | PSPPH_4547 | AAZ34320.1 | Ketosynthase- acyltransferase di-domain from module CurL of the curacin, a polyketide synthase (100) | Beta-ketoacyl synthase, CL0046 (3.7 × 10−56) |
pboL | PSPPH_4548 | AAZ35215.1 | Oxidoreductase from Streptomyces sp. in complex with FADH2 and glycerol (100) | Acyl-CoA dehydrogenase, CL0087 (6.1 × 10−18) |
pboK | PSPPH_4549 | AAZ32977.1 | Glutamine synthetase from Bacillus subtilis (44.5) | Hypothetical protein |
pboA | PSPPH_4550 | AAZ34936.1 | Condensation and adenylation domains of teixobactin-2 producing nonribosomal peptide synthetase Txo2 serine module (100) | AMP-binding enzyme, CL0378 (7.2 × 10−67), CL0531 (6.9 × 10−10) |
pboB | PSPPH_4551 | AAZ34497.1 | Priming beta- ketosynthase from the R1128 polyketide biosynthetic pathway (100) | 3-Oxoacyl-[acyl-carrier-protein (ACP)] synthase III, CL0046 (1.3 × 10−7) |
pboC | PSPPH_4552 | AAZ37563.1 | Thiolation-reductase di-domain from an archaeal non-2 ribosomal peptide synthetase (99.8) | Phosphopantetheine attachment site, CL0314 (1.3 × 10−8) |
pboD | not annotated | WP_057456395.1 | Uncharacterized protein ECA2234 (53.9) | Hypothetical protein |
pboE | PSPPH_4553 | AAZ32971.1 | Structure of E. coli YajR transporter (100) | Major Facilitator Superfamily, CL0015 (9.4 × 10−29) |
pboF | PSPPH_4554 | AAZ35479.1 | Lysine-2,3 aminomutase from Clostridium subterminale Sb4 (100) | Radical SAM protein, 4Fe-4S single cluster domain, CL0036 (4.1 × 10−11), CL0344 (7.9 × 10−5) |
pboG | PSPPH_4555 | AAZ36161.1 | Structure of L-amino acid ligase from Bacillus licheniformis (100) | ATP-grasp domain, CL0179 (2.9 × 10−10) |
pboH | PSPPH_4556 | AAZ34118.1 | Isoleucine-4-hydroxylase. Structure of Ido from Bacillus thuringiensis (100) | 2OG-Fe dioxygenase, CL0029 (7.8 × 10−34) |
pboI | PSPPH_4557 | AAZ35362.1 | E. coli D-galactonate:proton symporter mutant E13 (100) | Major Facilitator Superfamily, CL0015 (1.0 × 10−13) |
pboJ | PSPPH_4558 | AAZ34790.1 | NADH pyrophosphatase from E. coli K12 (99.9) | NUDIX domain, NUDIX hydrolase domain, CL0261 (3.2 × 10−17) |
PSPPH_4559 | AAZ36496.1 | Bipartite DNA-binding domain of Tc32 transposase bound to transposon DNA (99.2) | Helix-turn-helix domain of resolvase, CL0123 (7.4 × 10−6) |
Strain or Plasmid | Relevant Characteristics | Reference or Source |
---|---|---|
Bacterial strains | ||
Escherichia coli | ||
DH5α | F–endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG purB20 [φ80lacZΔM15] Δ(lacZYA-argF)U169 hsdR17(rK−mK+) λ− | [42] |
JM103 | endA1 glnV44 sbcBC rpsL thi-1 Δ(lac-proAB) F′[traD36 proAB+ lacIq lacZΔM15] | [43] |
P. syringae pv. phaseolicola | ||
NPS3121 | Rifr; wild-type strain, Tox+ | [44] |
PSpboO | Kmr Cbr; pboO mutant of NPS3121 | This study |
PSpboM | Kmr Cbr; pboM mutant of NPS3121 | This study |
PSpboL | Kmr Cbr; pboL mutant of NPS3121 | This study |
PSpboK | Kmr Cbr; pboK mutant of NPS3121 | This study |
PSpboA | Kmr Cbr; pboA mutant of NPS3121 | This study |
PSpboC | Kmr Cbr; pboC mutant of NPS3121 | This study |
PSpboE | Kmr Cbr; pboE mutant of NPS3121 | This study |
PSpboG | Kmr Cbr; pboG mutant of NPS3121 | This study |
PSpboJ | Kmr Cbr; pboJ mutant of NPS3121 | This study |
Plasmid pCR®4-TOPO® | Kmr Cbr; 3.95 kb | Invitrogen |
Gene | Primer Name | Primer Sequence (5′ → 3′) |
---|---|---|
pboO | S126d | GCCGTTGTGATAGCCGACAGTGA |
S127c | AACGCCAGCGCTTCATCCTTGT | |
pboM | S155d | GCTGCCTACGGCACAGGCATTGG |
S156c | GCGATTATGCCATCGTTGCTGCG | |
pboL | S136d | CCACGCTGGACAACATGGTGATC |
S137c | CATACTTTCTGGCCGCTACCCATTC | |
pboK | S122d | CATCTGTTCCAGCCGACGCAGA |
S123c | AACCCCGCGATCCTACAGACAGC | |
pboA | S134d | GCAAATTGCCAGTTGCGTTGCC |
S135c | CCTTTCGGTGTACCGGTAGAACCAG | |
pboC | S130d | GGGGTCATGCACCCGACACTTG |
S131c | CGTGCTTATCTGTGCCGATCGAGT | |
pboE | S157d | GCAGGCGCTGGTGATTGGCTTG |
S158c | GACACCAGCATGACCGGGATCTCG | |
pboG | S159d | CAGCGAGCCGGTCACTGAGCATC |
S160c | CCTGATTGAGCGCAATGCCGC | |
pboJ | S132d | TCTGTTCTGCAGCCTCAACGTGG |
S133c | TGAGCTGGACAAATTCAATGGAGTGA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Guardado-Valdivia, L.; Chacón-López, A.; Murillo, J.; Poveda, J.; Hernández-Flores, J.L.; Xoca-Orozco, L.; Aguilera, S. The Pbo Cluster from Pseudomonas syringae pv. Phaseolicola NPS3121 Is Thermoregulated and Required for Phaseolotoxin Biosynthesis. Toxins 2021, 13, 628. https://doi.org/10.3390/toxins13090628
Guardado-Valdivia L, Chacón-López A, Murillo J, Poveda J, Hernández-Flores JL, Xoca-Orozco L, Aguilera S. The Pbo Cluster from Pseudomonas syringae pv. Phaseolicola NPS3121 Is Thermoregulated and Required for Phaseolotoxin Biosynthesis. Toxins. 2021; 13(9):628. https://doi.org/10.3390/toxins13090628
Chicago/Turabian StyleGuardado-Valdivia, Lizeth, Alejandra Chacón-López, Jesús Murillo, Jorge Poveda, José Luis Hernández-Flores, Luis Xoca-Orozco, and Selene Aguilera. 2021. "The Pbo Cluster from Pseudomonas syringae pv. Phaseolicola NPS3121 Is Thermoregulated and Required for Phaseolotoxin Biosynthesis" Toxins 13, no. 9: 628. https://doi.org/10.3390/toxins13090628
APA StyleGuardado-Valdivia, L., Chacón-López, A., Murillo, J., Poveda, J., Hernández-Flores, J. L., Xoca-Orozco, L., & Aguilera, S. (2021). The Pbo Cluster from Pseudomonas syringae pv. Phaseolicola NPS3121 Is Thermoregulated and Required for Phaseolotoxin Biosynthesis. Toxins, 13(9), 628. https://doi.org/10.3390/toxins13090628