Virulence Factor Genes and Antimicrobial Susceptibility of Staphylococcus aureus Strains Isolated from Blood and Chronic Wounds
Abstract
1. Introduction
2. Results
2.1. Antibiotic Susceptibility Analysis
2.2. Frequency of Virulence Genes
2.3. Relationship between the Resistance to Antibiotics and Presence of Toxin Genes
3. Discussion
4. Materials and Methods
4.1. Bacterial Identification and Antibiotic Susceptibility
4.2. Toxin Genes Detection
4.3. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Song, Y.; Du, X.; Li, T.; Zhu, Y.; Li, M. Phenotypic and molecular characterization of Staphylococcus aureus recovered from different clinical specimens of inpatients at a teaching hospital in Shanghai between 2005 and 2010. J. Med. Microbiol. 2013, 62, 274–282. [Google Scholar] [CrossRef]
- Grumann, D.; Nübel, U.; Bröker, B.M. Staphylococcus aureus toxins—Their functions and genetics. Infect. Genet. Evol. 2014, 21, 583–592. [Google Scholar] [CrossRef]
- Gallardo-García, M.M.; Sánchez-Espín, G.; Ivanova-Georgieva, R.; Ruíz-Morales, J.; Rodríguez-Bailón, I.; Viñuela González, V.; García-López, M.V. Relationship between pathogenic, clinical, and virulence factors of Staphylococcus aureus in infective endocarditis versus uncomplicated bacteremia: A case-control study. Eur. J. Clin. Microbiol. Infect. Dis. 2016, 35, 821–828. [Google Scholar] [CrossRef]
- Lina, G.; Piémont, Y.; Godail-Gamot, F.; Bes, M.; Peter, M.O.; Gauduchon, V.; Vandenesch, F.; Etienne, J. Involvement of Panton-Valentine leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia. Clin. Infect. Dis. 1999, 29, 1128–1132. [Google Scholar] [CrossRef]
- He, C.; Xu, S.; Zhao, H.; Hu, F.; Xu, X.; Jin, S.; Yang, H.; Gong, F.; Liu, Q. Leukotoxin and pyrogenic toxin Superantigen gene backgrounds in bloodstream and wound Staphylococcus aureus isolates from eastern region of China. BMC Infect. Dis. 2018, 18, 395. [Google Scholar] [CrossRef]
- Dinges, M.M.; Orwin, P.M.; Schlievert, P.M. Exotoxins of Staphylococcus aureus. Clin. Microbiol. Rev. 2000, 13, 16–34. [Google Scholar] [CrossRef]
- Kong, C.; Neoh, H.M.; Nathan, S. Targeting Staphylococcus aureus Toxins: A Potential form of Anti-Virulence Therapy. Toxins 2016, 8, 72. [Google Scholar] [CrossRef]
- El-Ghodban, A.; Ghenghesh, K.S.; Márialigeti, K.; Esahli, H.; Tawil, A. PCR detection of toxic shock syndrome toxin of Staphylococcus aureus from Tripoli, Libya. J. Med. Microbiol. 2006, 55, 179–182. [Google Scholar] [CrossRef]
- Hakimi Alni, R.; Mohammadzadeh, A.; Mahmoodi, P.; Alikhani Avicenna, M.Y. Detection of toxic shock syndrome toxin (tsst) gene among Staphylococcus aureus isolated from patients and healthy carriers. J. Clin. Microb. Infec. 2018, 5, 14249. [Google Scholar] [CrossRef]
- Zhao, Y.; Tang, J. Staphylococcal enterotoxin M causes intestine dysfunction via activating inflammation. J. Food. Saf. 2018, 38, 12465. [Google Scholar] [CrossRef]
- Merriman, J.A. Secreted Staphylococcus aureus Virulence Factors and Their Role in Chronic Wound Development and Persistence. Ph.D. Thesis, University of Iowa, Iowa City, IA, USA, 2015. [Google Scholar] [CrossRef]
- Fisher, E.L.; Otto, M.; Cheung, G.Y.C. Basis of Virulence in Enterotoxin-Mediated Staphylococcal Food Poisoning. Front. Microbiol. 2018, 9, 436. [Google Scholar] [CrossRef]
- Kulhankova, K.; Kinney, K.J.; Stach, J.M.; Gourronc, F.A.; Grumbach, I.M.; Klingelhutz, A.J.; Salgado-Pabón, W. The Superantigen Toxic Shock Syndrome Toxin 1 Alters Human Aortic Endothelial Cell Function. Infect. Immun. 2018, 86. [Google Scholar] [CrossRef]
- Kim, C.K.; Karau, M.J.; Greenwood-Quaintance, K.E.; Tilahun, A.Y.; Krogman, A.; David, C.S.; Pritt, B.S.; Patel, R.; Rajagopalan, G. Superantigen-Producing Staphylococcus aureus Elicits Systemic Immune Activation in a Murine Wound Colonization Model. Toxins 2015, 7, 5308–5319. [Google Scholar] [CrossRef] [PubMed]
- Pérez-Montarelo, D.; Viedma, E.; Larrosa, N.; Gómez-González, C.; Ruiz de Gopegui, E.; Muñoz-Gallego, I.; San Juan, R.; Fernández-Hidalgo, N.; Almirante, B.; Chaves, F. Molecular Epidemiology of. Front. Microbiol. 2018, 9, 2210. [Google Scholar] [CrossRef]
- Gupta, P.; Singh, H.S.; Shukla, V.K.; Nath, G.; Bhartiya, S.K. Bacteriophage Therapy of Chronic Nonhealing Wound: Clinical Study. Int. J. Low. Extrem. Wounds 2019, 18, 171–175. [Google Scholar] [CrossRef]
- Surveillance Report. Surveillance of Antimicrobial Resistance in Europe 2018. Available online: https://www.ecdc.europa.eu/en/publications-data/surveillance-antimicrobial-resistance-europe-2018 (accessed on 14 June 2020).
- Day, M.R.; Armstrong, D.G. Factors associated with methicillin resistance in diabetic foot infections. J. Foot Ankle Surg. 1997, 36, 322–325. [Google Scholar] [CrossRef]
- Ertugrul, B.M.; Oncul, O.; Tulek, N.; Willke, A.; Sacar, S.; Tunccan, O.G.; Yilmaz, E.; Kaya, O.; Ozturk, B.; Turhan, O.; et al. A prospective, multi-center study: Factors related to the management of diabetic foot infections. Eur. J. Clin. Microbiol. Infect. Dis. 2012, 31, 2345–2352. [Google Scholar] [CrossRef] [PubMed]
- Shettigar, K.; Jain, S.; Bhat, D.V.; Acharya, R.; Ramachandra, L.; Satyamoorthy, K.; Murali, T.S. Virulence determinants in clinical Staphylococcus aureus from monomicrobial and polymicrobial infections of diabetic foot ulcers. J. Med. Microbiol. 2016, 65, 1392–1404. [Google Scholar] [CrossRef] [PubMed]
- Yu, F.; Li, T.; Huang, X.; Xie, J.; Xu, Y.; Tu, J.; Qin, Z.; Parsons, C.; Wang, J.; Hu, L.; et al. Virulence gene profiling and molecular characterization of hospital-acquired Staphylococcus aureus isolates associated with bloodstream infection. Diagn. Microbiol. Infect. Dis. 2012, 74, 363–368. [Google Scholar] [CrossRef]
- Wang, L.X.; Hu, Z.D.; Hu, Y.M.; Tian, B.; Li, J.; Wang, F.X.; Yang, H.; Xu, H.R.; Li, Y.C. Molecular analysis and frequency of Staphylococcus aureus virulence genes isolated from bloodstream infections in a teaching hospital in Tianjin, China. Genet. Mol. Res. 2013, 12, 646–654. [Google Scholar] [CrossRef] [PubMed]
- Imani Fooladi, A.A.; Ashrafi, E.; Tazandareh, S.G.; Koosha, R.Z.; Rad, H.S.; Amin, M.; Soori, M.; Larki, R.A.; Choopani, A.; Hosseini, H.M. The distribution of pathogenic and toxigenic genes among MRSA and MSSA clinical isolates. Microb. Pathog. 2015, 81, 60–66. [Google Scholar] [CrossRef]
- Wang, X.; Shen, Y.; Huang, W.; Zhou, Y. Characterisation of community-acquired. Epidemiol. Infect. 2019, 147, e323. [Google Scholar] [CrossRef]
- Pomorska-Wesołowska, M.; Chmielarczyk, A.; Chlebowicz, M.; Ziółkowski, G.; Szczypta, A.; Natkaniec, J.; Romaniszyn, D.; Pobiega, M.; Dzikowska, M.; Krawczyk, L.; et al. Virulence and antimicrobial resistance of Staphylococcus aureus isolated from bloodstream infections and pneumonia in Southern Poland. J. Glob. Antimicrob. Resist. 2017, 11, 100–104. [Google Scholar] [CrossRef] [PubMed]
- Liang, Y.; Tu, C.; Tan, C.; El-Sayed Ahmed, M.A.E.; Dai, M.; Xia, Y.; Liu, Y.; Zhong, L.L.; Shen, C.; Chen, G.; et al. Antimicrobial resistance, virulence genes profiling and molecular relatedness of methicillin-resistant. Infect. Drug. Resist. 2019, 12, 447–459. [Google Scholar] [CrossRef] [PubMed]
- Adhikari, R.P.; Shrestha, S.; Barakoti, A.; Amatya, R. Inducible clindamycin and methicillin resistant Staphylococcus aureus in a tertiary care hospital, Kathmandu, Nepal. BMC Infect. Dis. 2017, 17, 483. [Google Scholar] [CrossRef]
- Razeghi, M.; Saffarian, P.; Goudarzi, M. Incidence of inducible clindamycin resistance and antibacterial resistance genes variability in clinical Staphylococcus aureus strains: A two-year multicenter study in Tehran, Iran. Gene Rep. 2019, 16, 100411. [Google Scholar] [CrossRef]
- Varshney, A.K.; Mediavilla, J.R.; Robiou, N.; Guh, A.; Wang, X.; Gialanella, P.; Levi, M.H.; Kreiswirth, B.N.; Fries, B.C. Diverse enterotoxin gene profiles among clonal complexes of Staphylococcus aureus isolates from the Bronx, New York. Appl. Environ. Microbiol. 2009, 75, 6839–6849. [Google Scholar] [CrossRef]
- Vitale, M.; Galluzzo, P.; Buffa, P.G.; Carlino, E.; Spezia, O.; Alduina, R. Comparison of Antibiotic Resistance Profile and Biofilm Production of. Antibiotics 2019, 8, 97. [Google Scholar] [CrossRef]
- Prince, A.; Wong Fok Lung, T. Consequences of metabolic interactions during Staphylococcus aureus infection. Toxins 2020, 9, 581. [Google Scholar] [CrossRef]
- Kim, M.K. Staphylococcus aureus toxins: From their pathogenic roles to anti-virulence therapy using natural products. Biotechnol. Bioproc. E 2019, 24, 424–435. [Google Scholar] [CrossRef]
- Tuchscherr, L.; Löffler, B.; Proctor, R.A. Persistence of Staphylococcus aureus: Multiple metabolic pathways impact the expression of virulence factors in small-colony variants (SCVs). Front. Microbiol. 2020, 11, 1028. [Google Scholar] [CrossRef]
- Becker, K.; Friedrich, A.W.; Lubritz, G.; Weilert, M.; Peters, G.; Von Eiff, C. Prevalence of genes encoding pyrogenic toxin superantigens and exfoliative toxins among strains of Staphylococcus aureus isolated from blood and nasal specimens. J. Clin. Microbiol. 2003, 41, 1434–1439. [Google Scholar] [CrossRef]
- Li, X.; Fang, F.; Zhao, J.; Lou, N.; Li, C.; Huang, T.; Li, Y. Molecular characteristics and virulence gene profiles of Staphylococcus aureus causing bloodstream infection. Braz. J. Infect. Dis. 2018, 22, 487–494. [Google Scholar] [CrossRef]
- Park, K.H.; Greenwood-Quaintance, K.E.; Cunningham, S.A.; Rajagopalan, G.; Chia, N.; Jeraldo, P.R.; Mandrekar, J.; Patel, R. Lack of correlation of virulence gene profiles of Staphylococcus aureus bacteremia isolates with mortality. Microb. Pathog. 2019, 133, 103543. [Google Scholar] [CrossRef]
- Monday, S.R.; Bohach, G.A. Genes encoding staphylococcal enterotoxins G and I are linked and separated by DNA related to other staphylococcal enterotoxins. J. Nat. Toxins 2001, 10, 1–8. [Google Scholar]
- Demir, C.; Aslantaş, Ö.; Duran, N.; Ocak, S.; Özer, B. Investigation of toxin genes in Staphylococcus aureus strains isolated in Mustafa Kemal University Hospital. Turk. J. Med. Sci. 2011, 41, 343–352. [Google Scholar] [CrossRef]
- Ferry, T.; Thomas, D.; Genestier, A.L.; Bes, M.; Lina, G.; Vandenesch, F.; Etienne, J. Comparative prevalence of superantigen genes in Staphylococcus aureus isolates causing sepsis with and without septic shock. Clin. Infect. Dis. 2005, 41, 771–777. [Google Scholar] [CrossRef]
- Nowrouzian, F.L.; Ali, A.; Badiou, C.; Dauwalder, O.; Lina, G.; Josefsson, E. Impacts of enterotoxin gene cluster-encoded superantigens on local and systemic experimental Staphylococcus aureus infections. Eur. J. Clin. Microbiol. Infect. Dis. 2015, 34, 1443–1449. [Google Scholar] [CrossRef] [PubMed]
- Dunyach-Remy, C.; Ngba Essebe, C.; Sotto, A.; Lavigne, J.P. Staphylococcus aureus Toxins and Diabetic Foot Ulcers: Role in Pathogenesis and Interest in Diagnosis. Toxins 2016, 8, 209. [Google Scholar] [CrossRef]
- Horváth, A.; Dobay, O.; Sahin-Tóth, J.; Juhász, E.; Pongrácz, J.; Iván, M.; Fazakas, E.; Kristóf, K. Characterisation of antibiotic resistance, virulence, clonality and mortality in MRSA and MSSA bloodstream infections at a tertiary-level hospital in Hungary: A 6-year retrospective study. Ann. Clin. Microbiol. Antimicrob. 2020, 19, 17. [Google Scholar] [CrossRef] [PubMed]
- Jarraud, S.; Cozon, G.; Vandenesch, F.; Bes, M.; Etienne, J.; Lina, G. Involvement of enterotoxins G and I in staphylococcal toxic shock syndrome and staphylococcal scarlet fever. J. Clin. Microbiol. 1999, 37, 2446–2449. [Google Scholar] [CrossRef]
- Nasirian, S.; Saadatmand, S.; Goudarzi, H.; Goudarzi, M.; Azimi, H. Molecular investigation of methicillin-resistant Staphylococcus aureus strains recovered from the intensive care unit (ICU) based on toxin, adhesion genes and agr locus type analysis. Arch. Clin. Infect. Dis. 2018, 13, e14495. [Google Scholar] [CrossRef]
- Rasmussen, G.; Monecke, S.; Ehricht, R.; Söderquist, B. Prevalence of clonal complexes and virulence genes among commensal and invasive Staphylococcus aureus isolates in Sweden. PLoS ONE 2013, 8, e77477. [Google Scholar] [CrossRef]
- Maeda, M.; Shoji, H.; Shirakura, T.; Takuma, T.; Ugajin, K.; Fukuchi, K.; Niki, Y.; Ishino, K. Analysis of Staphylococcal Toxins and Clinical Outcomes of Methicillin-Resistant Staphylococcus aureus Bacteremia. Biol. Pharm. Bull. 2016, 39, 1195–1200. [Google Scholar] [CrossRef]
- Al Fouzan, W.; Al-Haddad, A.; Udo, E.; Mathew, B.; Dhar, R. Frequency and clinical association of Panton-Valentine leukocidin-positive Staphylococcus aureus isolates: A study from Kuwait. Med. Princ. Pract. 2013, 22, 245–249. [Google Scholar] [CrossRef] [PubMed]
- Verdú-Expósito, C.; Romanyk, J.; Cuadros-González, J.; TesfaMariam, A.; Copa-Patiño, J.L.; Pérez-Serrano, J.; Soliveri, J. Study of susceptibility to antibiotics and molecular characterization of high virulence Staphylococcus aureus strains isolated from a rural hospital in Ethiopia. PLoS ONE 2020, 15, e0230031. [Google Scholar] [CrossRef] [PubMed]
- Víquez-Molina, G.; Aragón-Sánchez, J.; Pérez-Corrales, C.; Murillo-Vargas, C.; López-Valverde, M.E.; Lipsky, B.A. Virulence Factor Genes in Staphylococcus aureus Isolated From Diabetic Foot Soft Tissue and Bone Infections. Int. J. Low. Extrem. Wounds 2018, 17, 36–41. [Google Scholar] [CrossRef]
- Mottola, C.; Semedo-Lemsaddek, T.; Mendes, J.J.; Melo-Cristino, J.; Tavares, L.; Cavaco-Silva, P.; Oliveira, M. Molecular typing, virulence traits and antimicrobial resistance of diabetic foot staphylococci. J. Biomed. Sci. 2016, 23, 33. [Google Scholar] [CrossRef] [PubMed]
- Luxner, J.; Zarfel, G.; Johler, S.; Feierl, G.; Leitner, E.; Hoenigl, M.; Grisold, A.J. Genetic characterization of Staphylococcus aureus isolates causing bloodstream infections in Austria. Diagn. Microbiol. Infect. Dis. 2014, 78, 153–156. [Google Scholar] [CrossRef]
- Gergova, R.T.; Tsitou, V.S.; Gergova, I.I.; Muhtarova, A.A.; Mitov, I.G. Correlation of methicillin resistance and virulence genes of Staphylococcus aureus with infection types and mode of acquisition in Sofia, Bulgaria. Afr. J. Clin. Exper. Microbiol. 2019, 20, 280–288. [Google Scholar] [CrossRef]
- Talha, M.H.; Khazaal, S.S.; Al Hadraawy, M.K.; Mostafavi, S.K.S. Screening of antibiotic resistance genes and virulence determinants of Staphylococcus aureus from skin infections. Meta Gene 2020, 24, 100682. [Google Scholar] [CrossRef]
- Suleiman, A.; Umoh, V.; Kwaga, J.; Shaibu, S. Enterotoxigenicity and antibiotic resistance of Staphylococcus aureus isolated from sub-clinical bovine mastitis milk in plateau state, Nigeria. Res. J. Microbiol. 2013, 8, 101–107. [Google Scholar] [CrossRef][Green Version]
- Corredor Arias, L.F.; Luligo Espinal, J.S.; Moncayo Ortiz, J.I.; Santacruz Ibarra, J.J.; Álvarez Aldana, A. Relationship between super antigenicity, antimicrobial resistance and origin of Staphylococcus aureus isolated. Colomb. Med. 2016, 47, 15–20. [Google Scholar]
- Choopani, A.; Heiat, M.; Amini, E.; Golpuch, M.; Aghamollaei, H. The relationship between the presence of enterotoxin type B gene and antibiotic resistance in Staphylococcus aureus. J. Appl. Biotech. Rep. 2015, 2, 203–206. [Google Scholar]
- The European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters. Version 9.0. 2019. Available online: http://www.eucast.org (accessed on 22 September 2019).
- Jarraud, S.; Mougel, C.; Thioulouse, J.; Lina, G.; Meugnier, H.; Forey, F.; Nesme, X.; Etienne, J.; Vandenesch, F. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infect. Immun. 2002, 70, 631–641. [Google Scholar] [CrossRef] [PubMed]
- Bates, D.; Mächler, M.; Bolker, B.; Walker, S. Fitting Linear Mixed-Effects Models using lme4. J. Stat. Softw. 2015, 67, 1–48. [Google Scholar] [CrossRef]
Antibiotic | Total No. of S. aureus, R (%) | Chronic Wound (n = 100), R (%) | Blood (n = 100), R (%) | p Value |
---|---|---|---|---|
Benzylpenicillin | 171 (85.5) | 86 (86.0) | 85 (85.0) | 1 |
Cefoxitin | 44 (22.0) | 21 (21.0) | 23 (23.0) | 0.865 |
Ceftaroline | 0 | 0 | 0 | 1 |
Norfloxacin | 54 (27.0) | 31 (31.0) | 23 (23.0) | 0.265 |
Amikacin | 43 (21.5) | 31 (31.0) | 12 (12.0) | 0.002 |
Gentamicin | 14 (7.0) | 13 (13.0) | 1 (1.0) | 0.001 |
Tobramycin | 46 (23.0) | 32 (32.0) | 14 (14.0) | 0.004 |
Teicoplanin | 0 | 0 | 0 | 1 |
Vancomycin | 0 | 0 | 0 | 1 |
Erythromycin | 59 (29.5) | 30 (30.0) | 29 (29.0) | 1 |
Clindamycin | 60 (30.0) | 29 (29.0) | 31 (31.0) | 0.877 |
Tigecycline | 0 | 0 | 0 | 1 |
Linezolid | 0 | 0 | 0 | 1 |
Rifampicin | 0 | 0 | 0 | 1 |
Trimethoprim-sulfamethoxazole | 5 (2.5) | 3 (3.0) | 2 (2.0) | 1 |
Resistance Profile | Chronic Wound (n = 100) (%) | Blood (n = 100) (%) | ||
---|---|---|---|---|
MRSA | MSSA | MRSA | MSSA | |
Susceptible to all antibiotics | - | 6 (6.0) | - | 14 (14.0) |
P | 0 | 35 (35.0) | 0 | 46 (46.0) |
NOR | 0 | 2 (2.0) | 0 | 0 |
P, NOR | 1 (1.0) | 5 (5.0) | 2 (2.0) | 2 (2.0) |
P, AMK | 0 | 1 (1.0) | 0 | 0 |
P, G | 0 | 2 (2.0) | 0 | 0 |
E, CC | 0 | 3 (3.0) | 0 | 1 (1.0) |
AMK, TOB | 0 | 2 (2.0) | 0 | 0 |
P, AMK, TOB | 1 (1.0) | 5 (5.0) | 1 (1.0) | 3 (3.0) |
P, NOR, AMK | 0 | 1 (1.0) | 0 | 0 |
P, NOR, SXT | 0 | 0 | 1 (1.0) | 0 |
P, E, CC | 0 | 6 (6.0) | 1 (1.0) | 10 (10.0) |
P, AMK, G, TOB | 0 | 6 (6.0) | 0 | 0 |
P, AMK, G, CC | 0 | 0 | 1 (1.0) | 0 |
P, NOR, E, CC | 5 (5.0) | 0 | 7 (7.0) | 1 (1.0) |
P, NOR, AMK, G, SXT | 1 (1.0) | 0 | 0 | 0 |
P, AMK, G, TOB, E | 1 (1.0) | 0 | 0 | 0 |
P, NOR, TOB, E, CC | 3 (3.0) | 0 | 3 (3.0) | 0 |
P, NOR, AMK, G, TOB, SXT | 0 | 1 (1.0) | 0 | 0 |
P, NOR, AMK, TOB, E, CC | 9 (9.0) | 0 | 6 (6.0) | 0 |
P, NOR, AMK, TOB, CC, SXT | 0 | 0 | 1 (1.0) | 0 |
NOR, AMK, G, TOB, E, CC | 0 | 1 (1.0) | 0 | 0 |
P, NOR, AMK, G, TOB, E, CC, SXT | 0 | 1 (1.0) | 0 | 0 |
Virulence Genes | Total No. of S. aureus (%) | Chronic Wound (n = 100) (%) | Blood (n = 100) (%) | p Value | MRSA (n = 44) (%) | MSSA (n = 156) (%) | p Value |
---|---|---|---|---|---|---|---|
sea | 25 (12.5) | 19 (19.0) | 6 (6.0) | 0.009 | 2 (4.5) | 23 (14.7) | 0.071 |
seb | 4 (2.0) | 3 (3.0) | 1 (1.0) | 0.621 | 1 (2.3) | 3 (1.9) | 0.884 |
sec | 15 (7.5) | 8 (8.0) | 7 (7.0) | 1.000 | 5 (11.4) | 10 (6.4) | 0.271 |
sed | 32 (16.0) | 20 (20.0) | 12 (12.0) | 0.176 | 18 (40.9) | 14 (9.0) | 0.001 |
seg | 104 (52.0) | 59 (59.0) | 45 (45.0) | 0.066 | 34 (77.3) | 70 (44.9) | 0.001 |
sei | 107 (53.5) | 61 (61.0) | 46 (46.0) | 0.047 | 35 (79.5) | 72 (46.2) | 0.001 |
tst | 22 (11.0) | 13 (13.0) | 9 (9.0) | 0.499 | 4 (9.1) | 18 (11.5) | 0.647 |
eta | 27 (13.5) | 14 (14.0) | 13 (13.0) | 1,000 | 2 (4.5) | 25 (16.0) | 0.049 |
etb | 1 (0.5) | 0 | 1 (1.0) | 1,000 | 0 | 1 (0.6) | 0.594 |
luk-F/S-PV | 4 (2.0) | 3 (3.0) | 1 (1.0) | 0.621 | 1 (2.3) | 3 (1.9) | 0.884 |
Gene Profile | Chronic Wound (%) | Blood (%) | Gene Profile | Chronic Wound (%) | Blood (%) |
---|---|---|---|---|---|
Lack of tested genes | 19 (19.0) | 35 (35.0) | sed, seg, sei | 7 (7.0) | 6 (6.0) |
sei | 6 (6) | 1 (1.0) | seg, sei, eta | 7 (7.0) | 3 (3.0) |
seg | 5 (5.0) | 2 (2.0) | sec, seg, się | 4 (4.0) | 2 (2.0) |
eta | 1 (1.0) | 6 (6.0) | seg, sei, tst | 1 (1.0) | 4 (4.0) |
tst | 2 (2.0) | 2 (2.0) | sea, seg, sei | 2 (2.0) | 1 (1.0) |
sea | 3 (3.0) | 0 | sei, eta, luk-F/S-PV | 2 (2.0) | 0 |
sed | 0 | 3 (3.0) | sea, eta, etb | 0 | 1 (1.0) |
seb | 1 (1.0) | 0 | seg, sei, luk-F/S-PV | 0 | 1 (1.0) |
sec | 0 | 1 (1.0) | sea, sed, sei | 1 (1.0) | 0 |
seg, sei | 15 (15.0) | 21 (21.0) | sea, seb, luk-F/S-PV | 1 (1.0) | 0 |
sei, eta | 3 (3.0) | 0 | sec, sed, seg, sei | 1 (1.0) | 2 (2.0) |
sed, seg | 3 (3.0) | 0 | sea, seg, sei, tst | 3 (3.0) | 0 |
sea, eta | 0 | 2 (2.0) | sea, sed, seg, sei | 2 (2.0) | 0 |
sei, tst | 0 | 2 (2.0) | sea, seb, sed, seg | 1 (1.0) | 0 |
sea, seg | 1 (1.0) | 1 (1.0) | sed, seg, sei, tst | 1 (1.0) | 0 |
sea, sed | 0 | 1 (1.0) | sec, seg, sei, eta | 0 | 1 (1.0) |
seb, sei | 0 | 1 (1.0) | sec, seg, sei, tst | 0 | 1 (1.0) |
sea, sei | 1 (1.0) | 0 | sea, sed, seg, sei, tst | 2 (2.0) | 0 |
seg, eta | 1 (1.0) | 0 | sec, sed, seg, sei, tst | 2 (2.0) | 0 |
sea, tst | 1 (1.0) | 0 | sea, sec, seg, sei, tst | 1 (1.0) | 0 |
Variable | Estimate | SE | Unadjusted OR (95%CI) | p Value | Estimate | SE | Adjusted OR (95%CI) | p Value |
---|---|---|---|---|---|---|---|---|
Univariable models | Multivariable model | |||||||
chronic wound vs. blood | 0.729 | 0.337 | 2.07 (1.07–4.01) | 0.03 | 0.424 | 0.301 | 1.53 (0.85–2.75) | 0.158 |
sed | 2.565 | 0.405 | 13 (5.87–28.78) | <0.001 | 2.207 | 0.409 | 9.09 (4.08–20.27) | <0.001 |
seg | 1.334 | 0.326 | 3.8 (2.01–7.19) | <0.001 | 0.854 | 0.417 | 2.35 (1.04–5.32) | 0.04 |
sei | 0.849 | 0.333 | 2.34 (1.22–4.48) | 0.011 | −0.13 | 0.406 | 0.88 (0.4–1.95) | 0.749 |
sea | −0.495 | 0.514 | 0.61 (0.22–1.67) | 0.336 |
Target | Primer Sequence (5′→3′) | Product Size (bp) | Annealing Temp. (°C) | Reference |
---|---|---|---|---|
sea | GAAAAAAGTCTGAATTGCAGGGAACA | 560 | 55 | [58] |
CAAATAAATCGTAATTAACCGAAGGTTC | ||||
seb | ATTCTATTAAGGACACTAAGTTAGGGA | 404 | 57 | [58] |
ATCCCGTTTCATAAGGCGAGT | ||||
sec | GTAAAGTTACAGGTGGCAAAACTTG | 297 | 56 | [58] |
CATATCATACCAAAAAGTATTGCCGT | ||||
sed | GAATTAAGTAGTACCGCGCTAAATAATATG | 492 | 55 | [58] |
GCTGTATTTTTCCTCCGAGAGT | ||||
seg | AATTATGTGAATGCTCAACCCGATC | 642 | 55 | [43] |
AAACTTATATGGAACAAAAGGTACTAGTTC | ||||
sei | CTCAAGGTGATATTGGTGTAGG | 576 | 55 | [43] |
AAAAAACTTACAGGCAGTCCATCTC | ||||
eta | ACTGTAGGAGCTAGTGCATTTGT | 190 | 57 | [58] |
TGGATACTTTTGTCTATCTTTTTCATCAAC | ||||
etb | CAGATAAAGAGCTTTATACACACATTAC | 612 | 57 | [58] |
AGTGAACTTATCTTTCTATTGAAAAACACTA | ||||
luk-F/S-PV | ATCATTAGGTAAAATGTCTGGACATGATCCA | 433 | 50 | [58] |
GCATCAASTGTATTGGATAGCAAAAGC | ||||
tst | TTCACTATTTGTAAAAGTGTCAGACCCACT | 180 | 56 | [58] |
TACTAATGAATTTTTTTATCGTAAGCCCTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Budzyńska, A.; Skowron, K.; Kaczmarek, A.; Wietlicka-Piszcz, M.; Gospodarek-Komkowska, E. Virulence Factor Genes and Antimicrobial Susceptibility of Staphylococcus aureus Strains Isolated from Blood and Chronic Wounds. Toxins 2021, 13, 491. https://doi.org/10.3390/toxins13070491
Budzyńska A, Skowron K, Kaczmarek A, Wietlicka-Piszcz M, Gospodarek-Komkowska E. Virulence Factor Genes and Antimicrobial Susceptibility of Staphylococcus aureus Strains Isolated from Blood and Chronic Wounds. Toxins. 2021; 13(7):491. https://doi.org/10.3390/toxins13070491
Chicago/Turabian StyleBudzyńska, Anna, Krzysztof Skowron, Agnieszka Kaczmarek, Magdalena Wietlicka-Piszcz, and Eugenia Gospodarek-Komkowska. 2021. "Virulence Factor Genes and Antimicrobial Susceptibility of Staphylococcus aureus Strains Isolated from Blood and Chronic Wounds" Toxins 13, no. 7: 491. https://doi.org/10.3390/toxins13070491
APA StyleBudzyńska, A., Skowron, K., Kaczmarek, A., Wietlicka-Piszcz, M., & Gospodarek-Komkowska, E. (2021). Virulence Factor Genes and Antimicrobial Susceptibility of Staphylococcus aureus Strains Isolated from Blood and Chronic Wounds. Toxins, 13(7), 491. https://doi.org/10.3390/toxins13070491